Double antibody sandwich coupled DNAzyme tau protein detection kit and application thereof

Abstract

The present application relates to a tau protein detection kit of double antibody sandwich coupling DNAzyme and application thereof, relates to the technical field of biological detection, and comprises a first antibody coupling a first component of catalytically active DNAzyme, a second antibody coupling a second component of catalytically active DNAzyme, a fluorescent probe and a reaction buffer.The detection method of the present application can accurately capture the subtle signal of tau protein, and provides strong support for early diagnosis of neurodegenerative diseases such as Alzheimer's disease.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically to a Tau protein detection kit with a double antibody sandwich coupled with DNAzyme and its application. Background Technology

[0002] Alzheimer's disease (AD), a common neurodegenerative disease, imposes a heavy burden on global public health. Its pathogenesis is complex, and effective early diagnostic methods are still lacking. Tau protein is one of the important biomarkers for Alzheimer's disease. In the brains of AD patients, Tau protein undergoes hyperphosphorylation and aggregates to form neurofibrillary tangles, leading to neuronal dysfunction and death, and consequently, a gradual loss of cognitive and memory abilities. Therefore, accurately detecting the Tau protein content in biological samples (such as blood and cerebrospinal fluid) is crucial for the early diagnosis of AD, monitoring disease progression, and evaluating treatment effectiveness.

[0003] Traditional methods for detecting Tau protein mainly include enzyme-linked immunosorbent assay (ELISA) and Western blotting. While ELISA offers high sensitivity, its procedures are cumbersome, require a long processing time, and place high demands on the laboratory environment and operators. Western blotting, on the other hand, suffers from poor quantitative accuracy and requires large sample volumes. Furthermore, these traditional methods often fail to meet the high sensitivity and specificity requirements of clinical diagnosis when detecting low concentrations of Tau protein.

[0004] In recent years, with the continuous development of biotechnology, novel detection technologies based on nucleic acid aptamers and nanomaterials have gradually emerged. However, these technologies still have some limitations, such as the need to further improve the stability and specificity of nucleic acid aptamers, and the complexity and high cost of the preparation and modification processes of nanomaterials. Therefore, there is an urgent need to develop a new, more efficient, sensitive, and specific Tau protein detection technology to meet the growing needs of neuroscience research and clinical diagnosis. In view of this, this invention provides a Tau protein detection kit based on a double-antibody sandwich coupled with a DNAzyme and its applications. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a Tau protein detection kit using a double-antibody sandwich-coupled DNAzyme and its applications. The aim is to provide a highly efficient, accurate, and practical kit for detecting Tau protein, thereby promoting the development of research and clinical diagnosis related to neurodegenerative diseases such as Alzheimer's disease.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] In a first aspect, a Tau protein detection kit with a double antibody sandwich conjugated to a DNAzyme includes a first antibody conjugated to a first component of a catalytically active DNAzyme, a second antibody conjugated to a second component of a catalytically active DNAzyme, a fluorescent probe, and a reaction buffer.

[0008] The first antibody has a specific epitope for Tau protein, and the second antibody has a specific epitope for Tau protein; the first component of the catalytically active DNAzyme and the second component of the catalytically active DNAzyme assemble into an active DNAzyme in the presence of Tau protein.

[0009] Based on the above technical solution, the present invention can be further improved as follows.

[0010] Furthermore, the sequence of the first component of the catalytically active DNAzyme is as shown in any one of SEQ ID NO: 1-12; preferably, it is as shown in SEQ ID NO: 7;

[0011] The sequence of the second component of the catalytically active DNAzyme is shown in any one of SEQ ID NO: 13-24. Preferably, it is shown in SEQ ID NO: 19.

[0012] Furthermore, the molar ratio of the first component of the catalytically active DNAzyme to the first antibody is 1:2 to 1:10;

[0013] The molar ratio of the second component of the catalytically active DNAzyme to the second antibody is 1:2 to 1:10.

[0014] Furthermore, the first antibody conjugated to the first component of a catalytically active DNAzyme is prepared by the following method:

[0015] The first antibody is prepared into a first antibody solution; a solution of the first component of the catalytically active DNAzyme and a solution of the first coupling agent are added to the first antibody solution, and the coupling reaction is carried out at 37±0.5℃ for 0.5-2 hours. The mixture is then separated and dialyzed sequentially to obtain the first antibody coupled with the first component of the catalytically active DNAzyme.

[0016] Furthermore, the volume ratio of the first antibody solution, the solution of the first component of the catalytically active DNAzyme, and the solution of the first coupling agent is 1:2-10:5-20; the concentration of the first antibody solution is 1 g / L; the concentration of the solution of the first component of the catalytically active DNAzyme is 10 μM; and the concentration of the solution of the first coupling agent is 10 mg / mL.

[0017] The first coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.

[0018] Furthermore, the second antibody, conjugated to a second component of a catalytically active DNAzyme, is prepared by the following method:

[0019] The second antibody is prepared into a second antibody solution; the solution of the second component of the catalytically active DNAzyme and the solution of the second coupling agent are added to the second antibody solution, and the coupling reaction is carried out at 37±0.5℃ for 0.5-2 hours. The mixture is then separated and dialyzed sequentially to obtain the second antibody coupled with the second component of the catalytically active DNAzyme.

[0020] Furthermore, the volume ratio of the second antibody solution, the solution of the second component of the catalytically active DNAzyme, and the solution of the second coupling agent is 1:2-10:5-20; the concentration of the second antibody solution is 1 g / L; the concentration of the solution of the second component of the catalytically active DNAzyme is 10 mM; and the concentration of the solution of the second coupling agent is 10 mg / mL.

[0021] The second coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.

[0022] Furthermore, the reaction buffer comprises a phosphate buffer with a concentration of 10mM-50mM, a sodium chloride with a concentration of 100mM-300mM, a potassium chloride with a concentration of 10mM-50mM, magnesium ions with a concentration of 1mM-5mM, and ethylenediaminetetraacetic acid with a concentration of 0.1mM-1mM, with a pH range of 7.2-7.8.

[0023] Furthermore, the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO: 25.

[0024] Secondly, the aforementioned double-antibody sandwich-coupled DNAzyme Tau protein detection kit is used in the preparation of reagents for detecting Tau protein.

[0025] The key components of the Tau protein detection kit based on a double antibody sandwich-coupled DNAzyme of the present invention function as follows:

[0026] (1) Antibody part:

[0027] The first antibody precisely targets a specific epitope of the Tau protein and is chemically bonded to a specific DNA sequence, which is the first component of a catalytically active DNAzyme. The specific sequence is shown in any one of SEQ ID NO: 1-12; preferably, it is shown in SEQ ID NO: 7 (GCTAGCATCTGCTAGCTCGATCGATCCATCTCTTCAGTTCGACGTACCGAAAGGTACG). This antibody, with its highly specific recognition ability of the Tau protein, plays a pioneering role in the detection system, not only accurately capturing the target protein but also providing the necessary conditions for the subsequent assembly and activation of the DNAzyme.

[0028] The second antibody also targets a unique epitope of the Tau protein and is linked to a specific DNA sequence corresponding to the second component of the aforementioned DNAzyme, as shown in any one of SEQ ID NO: 13-24. Preferably, it is shown in SEQ ID NO: 19 (TCGAACCTTCAGAGATAGTGAGTCGTACGTACGATCTACGTAGCTACTACGTA). This second antibody works synergistically with the first antibody to construct a stable and highly specific double-antibody sandwich structure, greatly enhancing the recognition and binding efficiency of the Tau protein. Simultaneously, it ensures that, in the presence of the antigen, the coupled DNAzyme components can be effectively brought closer together, promoting successful assembly into an active DNAzyme.

[0029] (2) Fluorescent probe assembly:

[0030] The fluorescent probe, meticulously designed to contain both a fluorophore and a quencher, has the specific sequence shown in SEQ ID NO: 25 (GGTAGAGAAG / rU / / rU / ATCACTCA), where / rU / represents an RNA base. This probe specifically interacts with active DNAzymes; once recognized and cleaved, the fluorophore and quencher immediately separate, releasing a fluorescent signal. This ingenious design achieves efficient conversion from biomolecular interactions to an optical signal that can be captured by detection instruments. Furthermore, the intensity of the fluorescent signal shows a clear correlation with the content of Tau protein in the sample, laying a solid foundation for subsequent quantitative analysis.

[0031] (3) Reaction buffer system:

[0032] The reaction buffer, phosphate buffer, acts as the guardian of the system's acid-base balance, ensuring the stability of the reaction environment. Sodium chloride and potassium chloride, by regulating ionic strength, create suitable conditions for maintaining the activity and interaction of biomolecules. Magnesium ions actively participate in specific enzymatic reactions, playing a crucial role in maintaining the activity of related molecules. Ethylenediaminetetraacetic acid, with its strong chelating ability, effectively removes metal ions that may interfere with the reaction. In summary, this buffer system meticulously creates an ideal environment for the efficient binding of antibodies and antigens, the precise assembly of DNAzymes, and the smooth reaction of fluorescent probes.

[0033] The detection method of the Tau protein detection kit based on double antibody sandwich-coupled DNAzyme of the present invention includes the following steps:

[0034] (1) Sample pretreatment stage: The sample to be tested is thoroughly mixed with the first antibody and the second antibody, which are conjugated to the first component of the catalytically active DNAzyme, in a carefully prepared reaction buffer. The reaction temperature is strictly controlled within the suitable range of 25-37℃, and the reaction time is set to 5-30 minutes. During this process, the first and second antibodies, with their excellent specific affinity for Tau protein, quickly and accurately bind tightly to the Tau protein molecules in the sample, thereby forming a stable and structurally regular antibody-antigen-antibody sandwich complex. The formation of this complex not only achieves effective capture of the target protein, but also cleverly promotes the DNAzyme components conjugated to the antibody to come closer to each other, and successfully assembles into a catalytically active DNAzyme under suitable environmental conditions, which is fully prepared for the subsequent signal transduction process.

[0035] (2) Signal conversion stage: The fluorescent probe is precisely added to the reaction system that has completed antibody-antigen binding and DNAzyme assembly, and the reaction is maintained for 5-30 minutes. At this time, the active DNAzyme in the system, with its highly specific recognition ability, quickly locks onto the fluorescent probe and exerts its catalytic activity, precisely cleaving the fluorescent probe at a specific site. This key operation causes the originally tightly bound fluorescent group and quenching group to separate instantly, thereby relieving the quenching effect. The fluorescent group can release a strong fluorescent signal that can be sensitively captured by the fluorescence detection instrument. The generation of this signal marks the successful conversion from the interaction at the biomolecular level to the optical signal, providing an intuitive and reliable basis for subsequent quantitative detection.

[0036] (3) Quantitative Analysis Stage: Advanced fluorescence detection instruments are used to precisely measure the intensity of the fluorescence signal released in the reaction system. Based on a pre-established standard curve using a series of known concentrations of Tau protein standards, a scientifically sound mathematical model and rigorous statistical methods are employed to accurately calculate the concentration of Tau protein in the sample. The establishment of this standard curve fully considers various factors that may affect the detection results. Through the accumulation and in-depth analysis of a large amount of experimental data, the quantitative relationship between fluorescence signal intensity and Tau protein concentration is ensured to have high accuracy and reliability. This calculation result provides crucial quantitative information for clinical diagnosis and disease research, helping to gain a deeper understanding of disease progression and assess treatment effectiveness.

[0037] In the detection system of this invention, based on the core principle of the double-antibody sandwich method for detecting Tau protein, two antibodies targeting different specific epitopes of Tau protein are selected. Precise chemical coupling technology is used to connect specific DNA sequences corresponding to the two components of the catalytically active DNAzyme to the two antibodies respectively. When a Tau protein-containing sample is added to the reaction system, the two antibodies specifically bind to Tau protein to form a sandwich complex, bringing the linked DNAzyme components closer together and assembling into a complete and active DNAzyme. This active DNAzyme can specifically bind to a fluorescent probe containing both a fluorophore and a quencher group. Its catalytic activity cleaves the probe, separating the fluorophore and quencher group, releasing a fluorescent signal that can be captured by the detection instrument. The intensity of the fluorescent signal is correlated with the Tau protein content in the sample, and quantitative detection can be achieved through a pre-established standard curve. As an important biomarker for Alzheimer's disease, the detection kit and method of this invention can achieve highly sensitive and specific detection of Tau protein, providing key technical support for early diagnosis and disease monitoring of Alzheimer's disease, and contributing to the advancement of precision medicine for related diseases.

[0038] The beneficial effects of this invention are:

[0039] (1) The innovative combination of DNAzyme assembly activation mechanism and specific fluorescent probe introduced in this invention enables sensitive detection of low concentrations of Tau protein, with a detection limit of 6.0 pg / mL. Even in the early stages of the disease, when the level of Tau protein changes only slightly, the detection method of this invention can still accurately capture this subtle signal, providing strong support for the early diagnosis of neurodegenerative diseases such as Alzheimer's disease. Early diagnosis is of decisive significance for the intervention and treatment of the disease and can significantly improve the prognosis and quality of life of patients.

[0040] (2) The entire detection process of the present invention is simple in design and easy to master. It does not require complicated instruments and equipment or complicated operating procedures. At the same time, the required sample size is relatively small, which greatly reduces the burden on patients. The detection time is short and the test results can be provided quickly to meet the needs of rapid clinical detection and large-scale screening. This makes the present invention have a wide range of application prospects in clinical practice. It can be widely used not only in large medical institutions, but also in grassroots medical units or areas with limited resources. It provides practical and feasible technical means for the early prevention and intervention of diseases. Attached Figure Description

[0041] Figure 1 This is a schematic diagram illustrating the principle of the present invention;

[0042] Figure 2 This is a fluorescence signal diagram of the present invention;

[0043] Figure 3 This is a curve fitting diagram of the standard curve of this invention;

[0044] Figure 4 This is a diagram showing the optimized size of the ring in the neck ring structure of Part A of the present invention;

[0045] Figure 5 This is a diagram showing the optimized results of the complementary sequences in this invention;

[0046] Figure 6 This is a diagram showing the results of the selection and determination of antibody pairs in this invention;

[0047] Figure 7 This is a linear correlation fitting diagram between antibody pair 10 of this invention and the sample;

[0048] Figure 8 This is a linear fitting graph showing the correlation between antibody pair 16 of this invention and the sample. Detailed Implementation

[0049] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0050] Description of the source of materials and reagents:

[0051] First antibody (Shenzhen Heavy Chain Biotechnology Co., Ltd.); Second antibody (Shenzhen Heavy Chain Biotechnology Co., Ltd.); Fluorescent probe (Sangon Biotech (Shanghai) Co., Ltd.); Tau protein (Shenzhen Heavy Chain Biotechnology Co., Ltd.); Sulfo-NHS (Sangon Biotech (Shanghai) Co., Ltd.); EDC (Sangon Biotech (Shanghai) Co., Ltd.).

[0052] Example

[0053] 1. The process of antibody coupling with a specific DNA sequence (5' end) Figure 1 ).

[0054] (1) The coupling process between the first antibody and a specific DNA sequence (5' end):

[0055] Prepare 1 mg of primary antibody (Tau antibody 1, targeting a specific epitope of the Tau protein) and dissolve it in 1 mL of 0.1 M borate buffer (pH 8.5) to form an antibody solution.

[0056] Take 100 μL of antibody solution, add 50 μL of a specific DNA sequence solution with a concentration of 10 mM (the DNA sequence is modified with an NH2 group at the 5' end, GCTAGCATCTGCTAGCTCGATCGATCCATCTCTTCAGTTCGACGTACCGAAAGGTA CG, SEQ ID NO: 7), then add 20 μL of a coupling agent with a concentration of 10 mg / mL (such as EDC and Sulfo-NHS), and gently stir the mixture at 37 °C for 1 hour.

[0057] After the reaction is complete, the reaction mixture is first treated with a Protein A / G column or magnetic beads to separate the antibody and unbound DNA. Then, the antibody is dissociated to obtain the DNA-conjugated antibody. The first antibody conjugated with the DNA sequence is collected and dialyzed overnight with phosphate-buffered saline (PBS) containing 0.05% bovine serum albumin (BSA) to obtain the first antibody conjugation product, which is stored at 4°C for later use.

[0058] (2) The coupling process between the second antibody and a specific DNA sequence (3' end):

[0059] Weigh 1 mg of the second antibody (Tau antibody 2, targeting another specific epitope of the Tau protein) and dissolve it in 1 mL of 0.1 M borate buffer (pH 8.5) to form an antibody solution.

[0060] Take 100 μL of the antibody solution, add 50 μL of a specific DNA sequence solution with a concentration of 10 mM (the DNA sequence is modified with an NH2 group at the 3' end, TCGAACCTTCAGAGATAGTGAGTCGTACGTACGATCTACGTAGCTACTACGTA, SEQ ID NO: 19), then add 20 μL of a coupling agent with a concentration of 10 mg / mL (such as EDC), and gently stir the mixture at 37 °C for 1 hour.

[0061] After the reaction is complete, the reaction mixture is first treated with a Protein A / G column or magnetic beads to separate the antibody and unbound DNA. Then, the antibody is dissociated to obtain the DNA-conjugated antibody. The first antibody conjugated with the DNA sequence is collected and dialyzed overnight with phosphate-buffered saline (PBS) containing 0.05% bovine serum albumin (BSA) to obtain the second antibody conjugation product, which is stored at 4°C for later use.

[0062] 2. Establish a standard curve using the test kit.

[0063] Preparation of Tau protein standard series: Take a certain amount of high-purity recombinant Tau protein standard (known concentration of 500 ng / mL), and continuously dilute it with the reagent kit reaction buffer to prepare a series of Tau protein standard solutions of different concentrations, ranging from 0 ng / mL to 500 ng / mL, such as 0 ng / mL, 10 ng / mL, 20 ng / mL, 50 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, and 500 ng / mL. Set up three parallel samples for each concentration.

[0064] Detection reaction procedure: Add 10 μL of Tau protein standard solution of each concentration to the corresponding well of a 96-well plate. Add 5 μL of 10X reaction buffer, 5 μL of the first antibody conjugate solution, 5 μL of the second antibody conjugate solution, and 2 μL of fluorescent probe solution to each well, and add water to a total volume of 50 μL. Gently vortex to mix, and incubate at 37°C for 25 minutes to allow the antibody to bind to Tau protein and form an antibody-antigen-antibody sandwich complex. This promotes the assembly of the conjugated DNAzyme components into their active form, allowing the active DNAzyme to cleave the fluorescent probe and release a fluorescent signal.

[0065] Fluorescence detection and data processing: The fluorescence intensity of each well was detected using a qPCR instrument, and the data were recorded. Figure 2 A standard curve was plotted using professional data analysis software (such as OriginPro) with the concentration of Tau protein standards as the x-axis (X) and the average fluorescence intensity as the y-axis. A suitable curve fitting model (such as a four-parameter logistic regression model) was selected to fit the data, yielding the standard curve equation (e.g., [missing equation]). Figure 3) and related statistical parameters (such as R) 2 Value, requiring R 2 ≥0.99), used for calculating the concentration of Tau protein in subsequent test samples.

[0066] 3. Experimental testing.

[0067] 3.1 Design of DNAzyme.

[0068] (1) Optimization of the size of the ring in the neck ring structure of Part A:

[0069] DNAzymes consist of two parts: Part A (the first component of the catalytically active DNAzyme) and Part B (the second component of the catalytically active DNAzyme), corresponding to the DNA portions of the first and second antibodies in the diagram. Figure 1 ).

[0070] (2) First, a set of perfectly complementary double-stranded DNAs was designed to test the effect of loop size in the neck loop structure of the DNAzyme on the probe cleavage ability. Loops of 2bp, 3bp, 4bp, 6bp, 8bp, and 10bp were designed as shown in Table 1, and the reaction system is shown in Table 2. The reaction conditions were: 95℃ for 5 min, 37℃ for 30 min, and the fluorescence intensity was measured for comparison. Figure 4 ).

[0071] The sequence in Table 1 is as follows:

[0072]

[0073]

[0074] Table 2 Reaction system (50 μL)

[0075] Ingredients concentration PBS (pH 7.4) 20mM NaCl 100mM KCl 20mM <![CDATA[mg 2+ ]]> 5mM EDTA 0.5mM Part A 100nM Part B 100nM Probe 100nM

[0076] Depend on Figure 4 The results showed that probes with a 4bp to 8bp cleavage capability were the strongest.

[0077] (2) Optimization of complementary sequences of Part A and Part B:

[0078] This invention designs 12 sets of complementary sequences to optimize the complementary sequences of Part A and Part B, as shown in Table 3.

[0079] The sequences in Table 3 are as follows:

[0080]

[0081]

[0082]

[0083] Depend on Figure 5 It is known that the activity of a DNAzyme depends on the binding of Part A and Part B through complementary sequences of a certain length. If the ΔG value of the complementary sequences of Part A and Part B is too high, Part A and Part B will not bind easily, thus reducing the detection sensitivity; conversely, it will increase non-specific signals. Ultimately, this invention selected the 7th combination.

[0084] 3.2 Selection and determination of antibody pairs.

[0085] Six total Tau protein antibodies were collected and labeled using Part A and Part B sequences of the DNAzyme, respectively. The total Tau protein antigen was serially diluted to 200 pg / mL, and cross-pairing tests were performed on the above antibodies, resulting in 30 pairing combinations. Each combination was tested three times, and the average value was calculated. The antigen signal value was compared with the signal value of the blank dilution. Figure 6 ).

[0086] Depend on Figure 6 It is understood that the present invention selects antibodies No. 10 and No. 16 for further confirmation of the combination.

[0087] 3.3 Confirmation of the effectiveness of the kit of the present invention.

[0088] Based on clinical diagnostic results and control kit detection information (Aβ1-42 / Aβ1-40 / T-Tau / p-Tau-181 / α-synuclein combined detection kit (flow cytometry), Jiangxi Medical Device Registration Certificate No. 20232400002, Jiangxi Saiji Biotechnology Co., Ltd.), 20 samples with gradient concentrations were taken and tested using the established antibody pairs No. 10 and No. 16. A linear relationship between sample concentration and luminescence value was established, and the correlation between the antibody pairs and the samples was evaluated (Table 4 and...). Figure 7-8 ).

[0089] Table 4. Correlation between antibody pairs and samples

[0090]

[0091]

[0092] From Table 4 and Figure 7-8 It can be seen that antibody pair 10 and antibody pair 16 have similar reactivity with the antigen, with signal-to-noise ratios both above 20. However, the correlation between antibody pair 16 and the sample is only 0.8602, while the correlation between antibody pair 10 and the sample is 0.9853. Therefore, antibody pair 10...

[0093] (4) Blank limit and detection limit analysis

[0094] Five blank samples and five low-concentration samples were used, with each sample tested four times. The results are shown below:

[0095] Table 5. Test results for blank samples

[0096] Number of tests Blank Sample 1 Blank Sample 2 Blank Sample 3 Blank Sample 4 Blank Sample 5 1 4.62 4.93 5.00 5.21 5.01 2 4.75 4.73 4.99 4.97 5.06 3 5.14 4.93 4.70 5.16 5.33 4 5.00 5.34 4.74 5.32 5.35

[0097] Table 6. Test results for low-value samples

[0098] Number of tests Low value sample 1 Low value sample 2 Low value sample 3 Low value sample 4 Low value sample 5 1 8.26 8.00 8.50 7.98 8.56 2 7.76 7.95 8.37 8.19 8.22 3 7.78 7.50 8.12 8.61 7.46 4 7.65 8.32 7.38 7.40 8.40

[0099] Based on the data in Tables 5 and 6 above, a normality test was performed. This study used a nonparametric method to evaluate the LoB estimate and a parametric method to evaluate the LoD estimate.

[0100] Nonparametric method for evaluating LoB estimates: Combine the test results of 5 blank samples and sort them from low to high. Calculate the LoB estimate using a typical Type I error risk α = 0.05 and the corresponding percentile P = 1 - α = 0.95.

[0101] In summary, the blank limit of this invention is 5.34 pg / mL.

[0102] Parametric method for evaluating LoD estimate: The pooled standard deviation SDz is calculated from the measurement results of multiple low concentration level samples, and LoD is calculated according to the following formula.

[0103]

[0104]

[0105] LOD = LOB + kSDz (3);

[0106] Table 7. Calculation of SDz and LoD for LoD low-value sample test results.

[0107]

[0108] It is known that the detection limit of the present invention is 6.0 pg / mL.

[0109] In summary, the innovative combination of the DNAzyme assembly activation mechanism and the specific fluorescent probe introduced in this invention enables the sensitive detection of low concentrations of Tau protein. Even in the early stages of the disease, when Tau protein levels show only slight changes, the detection method of this invention can still accurately capture this subtle signal, providing strong support for the early diagnosis of neurodegenerative diseases such as Alzheimer's disease. Early diagnosis is of decisive significance for disease intervention and treatment, and can significantly improve patients' prognosis and quality of life.

[0110] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A Tau protein detection kit using a double-antibody sandwich-conjugated DNAzyme, characterized in that, The Tau protein detection kit includes a first antibody conjugated to a first component of a catalytically active DNAzyme, a second antibody conjugated to a second component of a catalytically active DNAzyme, a fluorescent probe, and a reaction buffer. The first antibody has a specific epitope for Tau protein, and the second antibody has a specific epitope for Tau protein; the first component of the catalytically active DNAzyme and the second component of the catalytically active DNAzyme assemble into an active DNAzyme in the presence of Tau protein; The sequence of the first component of the catalytically active DNAzyme is shown in SEQ ID NO: 7; The sequence of the second component of the catalytically active DNAzyme is shown in SEQ ID NO:

19.

2. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 1, characterized in that, The molar ratio of the first component of the catalytically active DNAzyme to the first antibody is 1:2 to 1:10; The molar ratio of the second component of the catalytically active DNAzyme to the second antibody is 1:2 to 1:

10.

3. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 1, characterized in that, The first antibody conjugated to the first component of a catalytically active DNAzyme is prepared by the following method: The first antibody is prepared into a first antibody solution; a solution of the first component of the catalytically active DNAzyme and a solution of the first coupling agent are added to the first antibody solution, and the coupling reaction is carried out at 37±0.5℃ for 0.5-2 hours. The mixture is then separated and dialyzed sequentially to obtain the first antibody coupled with the first component of the catalytically active DNAzyme.

4. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 3, characterized in that, The volume ratio of the first antibody solution, the solution of the first component of the catalytically active DNAzyme, and the solution of the first coupling agent is 1:2-10:5-20; the concentration of the first antibody solution is 1 g / L; the concentration of the solution of the first component of the catalytically active DNAzyme is 10 μM; and the concentration of the solution of the first coupling agent is 10 mg / mL. The first coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.

5. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 1, characterized in that, The second antibody, conjugated to a second component of a catalytically active DNAzyme, is prepared by the following method: The second antibody is prepared into a second antibody solution; the solution of the second component of the catalytically active DNAzyme and the solution of the second coupling agent are added to the second antibody solution, and the coupling reaction is carried out at 37±0.5℃ for 0.5-2 hours. The mixture is then separated and dialyzed sequentially to obtain the second antibody coupled with the second component of the catalytically active DNAzyme.

6. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 5, characterized in that, The volume ratio of the second antibody solution, the solution of the second component of the catalytically active DNAzyme, and the solution of the second coupling agent is 1:2-10:5-20; the concentration of the second antibody solution is 1 g / L; the concentration of the solution of the second component of the catalytically active DNAzyme is 10 μM; and the concentration of the solution of the second coupling agent is 10 mg / mL. The second coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.

7. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 1, characterized in that, The reaction buffer comprises phosphate buffer at a concentration of 10 mM-50 mM, sodium chloride at a concentration of 100 mM-300 mM, potassium chloride at a concentration of 10 mM-50 mM, magnesium ions at a concentration of 1 mM-5 mM, and ethylenediaminetetraacetic acid at a concentration of 0.1 mM-1 mM, with a pH range of 7.2-7.

8.

8. The Tau protein detection kit with double antibody sandwich-conjugated DNAzyme according to claim 1, characterized in that, The nucleotide sequence of the fluorescent probe is shown in SEQ ID NO:

25.

9. The use of the Tau protein detection kit with double antibody sandwich coupled DNAzyme according to any one of claims 1 to 8 in the preparation of products for detecting Tau protein.

Images