Construction and application of gene knockout plasmid targeting plasmodium lnc30 gene promoter region
By constructing a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene, the problem of insufficient research on the function of lncRNA in Plasmodium falciparum was solved, its regulatory mechanism in the pathogenesis of malaria was revealed, and new tools and approaches were provided for the development of antimalarial drugs.
Patent Information
- Application Number
- CN202510779038.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-09-09
AI Technical Summary
There is little research on the functions of lncRNAs in Plasmodium falciparum, especially lncRNAs derived from intergenic regions. Existing technologies make it difficult to effectively explore their regulatory mechanisms in the pathogenesis of malaria and apply them to the screening and development of antimalarial drugs.
A CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene was constructed. By designing a specific sgRNA, it was amplified and seamlessly cloned into a vector for transfection with Plasmodium falciparum to study its gene expression regulation mechanism and screen for drugs that inhibit the growth and development of Plasmodium falciparum.
The study revealed the key role of lnc30 in the development of Plasmodium falciparum, provided a new molecular tool for screening antimalarial drug targets, and significantly enhanced the growth advantage and merozoite invasion ability of Plasmodium falciparum, with significant scientific value and application prospects.
Smart Images
Figure CN120608088A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to the construction and application of a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene. Background Art
[0002] Malaria is a serious infectious disease caused by Plasmodium parasites and is one of the three most serious infectious diseases worldwide. The pathogen that causes malaria is Plasmodium. There are five species of Plasmodium that can parasitize humans: Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, and Plasmodium knowlesi. Among these, Plasmodium falciparum is the most virulent and has the highest mortality rate. The erythrocytic stage of Plasmodium falciparum, during its development within human erythrocytes, is the only pathogenic stage that results in clinical symptoms. The erythrocytic stage of Plasmodium falciparum undergoes multiple morphological changes, including rings, macrotrophozoites, schizonts, and merozoites, and its antigens are expressed in mutually exclusive ways. This suggests that the erythrocytic stage of Plasmodium falciparum possesses sophisticated gene expression regulation mechanisms, however, these mechanisms remain incompletely understood. Long noncoding RNAs (lncRNAs) play an important role in regulating gene expression in organisms, but the functions of lncRNAs in Plasmodium falciparum, particularly those derived from intergenic regions, are poorly understood. Therefore, it is necessary to explore the functions and regulatory mechanisms of key lncRNAs in Plasmodium falciparum and construct a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene for application in the screening, development and mechanism research of antimalarial drugs. Summary of the Invention
[0003] The present invention provides a method for constructing a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene, comprising the following steps:
[0004] (1) sgRNA design: Based on CRISPR-Cas9 technology, a specific sgRNA was designed for the promoter region of the lnc30 gene, including:
[0005] The nucleotide sequence of the lnc30 gene is shown in SEQ ID NO.1;
[0006] The target sequence of sgRNA-1 is: 5′-ATGCATGTTTCCGCTGCTTG-3′, as shown in SEQ ID NO. 2;
[0007] The target sequence of sgRNA-2 is: 5′-TTCATAAACAAGTATATGTG-3′, as shown in SEQ ID NO. 3;
[0008] (2) sgRNA amplification: Add 20-25 bp of homology arm sequences that completely match the two ends of the target vector at both ends of the sgRNA sequence in (1), and obtain a double-stranded sgRNA expression cassette by PCR amplification;
[0009] (3) Seamless cloning construction: directly connect the PCR product described in (2) to the linearized vector using seamless ligation technology;
[0010] (4) Plasmid verification: After confirming the absence of mutations through transformation → single clone screening → whole plasmid sequencing, it is used to transfect Plasmodium.
[0011] The PCR amplification program is as follows: 94°C for 2 min; 94°C for 30 s; 72°C for 30 s; 94°C for 30 s; 72°C for 30 s; 60°C for 30 s; 40°C for 30 s; 25°C for 30 s; 16°C for 30 s; and 4°C for 30 s.
[0012] The application of the CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene constructed by the above method in the study of the gene expression regulation mechanism of Plasmodium falciparum, or in the screening or preparation of drugs that inhibit the growth and development of Plasmodium falciparum.
[0013] This study, published in the journal Nature Communications, discovered for the first time a previously unreported lncRNA, lnc30, in the 3D7 strain of Plasmodium falciparum. Overexpression of lnc30 significantly enhances the growth advantage of Plasmodium falciparum and its ability to invade erythrocytes, participating in the regulation of erythrocytic development. Knockdown of lnc30 may lead to parasite death, revealing the key role of lnc30 in the development of Plasmodium falciparum. This provides a new molecular tool for antimalarial drug target screening, malaria diagnosis, and pathogenesis research, with significant scientific value and application prospects. The present invention further constructed a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene. This plasmid can be transfected into Plasmodium falciparum and used to study the regulatory mechanisms of gene expression in Plasmodium falciparum, as well as to screen or prepare drugs that inhibit the growth and development of Plasmodium falciparum. This approach has significant scientific value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 .Identification and intracellular localization of full-length lnc30.
[0015] in Figure 1Figure A is a 5'RACE PCR agarose gel image; M is a 5000 bp ladder; 1 is a positive control PCR product; 2 is a no-template control PCR product; 3 is a no-enzyme control PCR product; 4 is a lnc30 5'RACE PCR product; the white arrow indicates that the positive control product is 2.1 kb in length; the black arrow indicates that the lnc30 PCR product is 1 kb in length.
[0016] in Figure 1 Figure B is a 3'RACE PCR agarose gel image: M is a 5000 bp ladder; 1 is a no-template control; 2 is a no-enzyme control; 3 is the 3'RACE PCR product of lnc30; the black arrow indicates that the PCR product of lnc30 is 150 bp in length.
[0017] in Figure 1 C in the figure is the length of lnc30 verified by Northern Blot; M is the RNA marker; 1 is the northern blot product of lnc30; the black arrow indicates the length of lnc30.
[0018] in Figure 1 D in the figure is the predicted secondary structure of lnc30.
[0019] in Figure 1 Figure E shows the localization information of lnc30 in Plasmodium falciparum 3D7 detected by FISH: DAPI is a fluorescent dye indicating the cell nucleus; Scramble is a negative control probe; U4 (U4 snRNA) is a positive control probe.
[0020] Figure 2 .Construction diagram of overexpression plasmid: A is the PLN-30 overexpression plasmid map; B is the control plasmid PLN map.
[0021] Figure 3 .Figure 1 shows the results of identification of lnc30 overexpressing insect strains.
[0022] in Figure 3 A in the figure is PCR identification of the BSD resistance gene; M is DL2000 DNA Marker; 1 is the 3D7 strain without plasmid transfection; 2 is the strain transfected with the control plasmid (con); 3 is the strain transfected with the overexpression plasmid (lnc30oe); the arrow indicates the BSD resistance gene, which is 399 bp in length.
[0023] in Figure 3 Figure B shows the qPCR verification of lnc30 transcription levels at different stages: the horizontal axis represents the different time points of the control and overexpression plasmid-transfected insect strains; the vertical axis represents the relative expression level of lnc30.
[0024] Figure 4 .Growth curve results of lnc30 overexpressing and control insect strains.
[0025] in Figure 4 A in the figure is the growth curve of the transfected worm strain. The horizontal axis is the number of days, and the vertical axis is the blood rate.
[0026] in Figure 4 B in the figure is the experiment of the number of merozoites of the transfected strain: the horizontal axis is the group, and the vertical axis is the number of merozoites;
[0027] in Figure 4 C in the figure is the merozoite invasion experiment of the transfected strain: the horizontal axis is the time for counting the parasitic blood rate, and the vertical axis is the parasitic blood rate;
[0028] in Figure 4 D in the figure is the relative expression level of the Var gene in the transfected strain; the horizontal axis is the gene number of the 58 var genes; the vertical axis is the relative expression level of the var gene; U6 snRNA was used as the internal reference gene in the qRT-PCR experiment to calculate the relative expression level of each lncRNA at different stages (2-ΔΔCt);
[0029] in Figure 4 Figure E shows the adhesion experiment of the transfected parasite strain: the black arrow indicates HUVEC (human umbilical vein endothelial cells); the red arrow indicates the red blood cells infected with Plasmodium adhered to HUVEC; the parasite blood rate is * represents P < 0.05, represents P < 0.01, and * represents P < 0.001; the parasite blood rate is the ratio of red blood cells infected with Plasmodium falciparum to all red blood cells.
[0030] Figure 5 .Construction of lnc30 low-expression plasmid and identification of BSD-resistant gene in control insect strain.
[0031] in Figure 5 A in the figure is the knockdown plasmid map of low-expression lnc30; Figure 5 B in the figure is the agarose gel electrophoresis result of the BSD drug screening gene of the control insect strain; M is the DL2000 DNA Marker; 1 is the 3D7 insect strain without plasmid transfection; 2 is the insect strain transfected with the control plasmid; the arrow indicates that the BSD resistance gene PCR product is 399 bp in length. DETAILED DESCRIPTION
[0032] Our laboratory previously predicted 55 previously unannotated lncRNAs using a combination of RNA-Seq and bioinformatics analysis. This study validated these predictions using RT-PCR, confirming the existence of 31 of these lncRNAs, including the lnc30 described in this study.
[0033] The erythrocytic development of Plasmodium falciparum can be divided into four stages based on their morphology: the ring stage (rs), the trophozoite stage (ts), the schizont stage (ss), and the merozoite stage (ms). The ring stage (rs) and the schizont stage (ss), respectively, represent the early and late stages of the erythrocytic development. The two stages exhibit significant morphological differences, and the formation of mature schizonts requires repeated nuclear divisions, making them the most active stages. This study used qRT-PCR to analyze the expression profiles of 31 validated novel lncRNAs during the ring and schizont stages. The results showed that, among these 31 novel lncRNAs, lnc30 was significantly more highly expressed in the schizont stage compared to the ring stage.
[0034] Experimental Materials:
[0035] The parasite strain involved in the present invention is the MR4: Plasmodium falciparum 3D7 parasite strain belonging to the American ATCC.
[0036] The primers involved in the present invention are synthesized by Sangon Bioengineering Co., Ltd.
[0037] The primers for lnc30 are as follows:
[0038] qPCR30-5': 5'TTATTGTAAAGATAAAATTTGTCTGTAGTG 3'
[0039] qPCR30-3': 5'ATTTATGTAAAAAAATTTATTGATATACATGT 3'.
[0040] The empty overexpression plasmid was PLN-ENR-GFP plasmid.
[0041] The knockdown empty plasmid is Crispr-dCas9 plasmid.
[0042] Primer sequence analysis: Primer5.0;
[0043] Statistical analysis: GraphPad Prism5, Excel, SPSS;
[0044] Sequence alignment analysis: DNAMAN, SeqMan;
[0045] Plasmid mapping: SnapGene.
[0046] Experimental methods
[0047] 1. Construction of Overexpression Plasmid
[0048] 1.1 Construction of pBSD plasmid
[0049] The original plasmid pLN-ENR-GFP was digested with HindⅢ restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid.
[0050] 1.2 Construction of pBSD-30 plasmid
[0051] The U6 promoter gene was obtained by PCR and purified, and then ligated into the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid.
[0052] The full-length gene 30 was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid.
[0053] (The U6 gene promoter is a strong RNA polymerase III promoter specifically designed for efficient transcription of non-coding RNAs. The U6 promoter has high expression capacity. Connecting lncRNA30 to the U6 promoter can ensure that lncRNA30 reaches a high expression level in cells, which is conducive to functional research.)
[0054] 2. Construction of gene knockout plasmid
[0055] A method for constructing a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of a Plasmodium lncRNA (lnc30) gene comprises the following steps:
[0056] (1) sgRNA design:
[0057] CRISPRgentool software was used to design specific sgRNA for the lnc30 promoter region, where:
[0058] The target sequence of sgRNA-1 is: 5'-ATGCATGTTTCCGCTGCTTG-3' (SEQ ID NO. 2)
[0059] The target sequence of sgRNA-2 is: 5'-TTCATAAACAAGTATATGTG-3' (SEQ ID NO. 3)
[0060] The sgRNA (single-guide RNA) is a core component of the CRISPR-Cas9 gene editing system, responsible for guiding the Cas9 nuclease to precisely cut the target DNA sequence.
[0061] Mechanism of action of sgRNA: After sgRNA binds to the target DNA (such as the lnc30 promoter region) through its targeting sequence, the Cas9 protein generates a double-strand break (DSB) on the DNA, ultimately leading to the knockout of the target gene.
[0062] (2) sgRNA amplification: Add 20-25bp homology arm sequences (completely matching the ends of the target vector) to both ends of the sgRNA sequence and obtain a double-stranded sgRNA expression frame by PCR amplification. (Homology arms: short DNA sequences homologous to the ends of the vector, used to guide the precise connection of the recombinase)
[0063] (3) Seamless cloning construction: Use seamless connection technology to directly connect the PCR product to the linearized vector, avoiding the efficiency loss of traditional enzyme cutting and connection methods. (Seamless connection: Using homologous recombinase to achieve seamless connection between PCR product and vector)
[0064] (4) Plasmid verification: After confirming the absence of mutations through transformation → single clone screening → whole plasmid sequencing, it is used to transfect Plasmodium.
[0065] 3. Plotting the Growth Curve
[0066] After successful large-scale culture, pBSD, a control group (p30), a weak promoter experimental group (pU6+30), and a strong promoter experimental group (pU6+30) were synchronized twice during the ring stage to achieve high synchronization. After calculating the hemophilia, the cells were diluted to 0.5% with fresh red blood cells. Three replicate wells were constructed for each group. For the next five days, only the medium was changed without adding blood. Slides were stained daily, and the hemophilia was calculated. Graphs were generated using GraphPad Prism 5 software.
[0067] 4. Counting the number of merozoites
[0068] After successful large-scale culture, pBSD, a control group (pBSD), a weak promoter experimental group (p30), and a strong promoter experimental group (pU6+30) were synchronized twice at the ring stage to achieve high synchronization. After calculating parasite blood counts, the cells were diluted to 1% with fresh red blood cells at the schizont stage. Three replicate wells were constructed for each group. After 24 hours, parasites were transformed into ring-stage parasites, and slides were smeared for blood count calculation. GraphPad Prism 5 software was used for graphing.
[0069] 5. Adhesion Assay
[0070] 1) Cell Slides: When the cells have grown to about 90%, digest them with trypsin. After complete digestion, pipette and evenly inoculate them into a 24-well plate with cell slides placed in advance and culture for 1-2 days (add a drop of culture medium to the well before placing the slides, otherwise the cells will grow all over the plate and it will be impossible to count them).
[0071] 2) When the cells reach 80%-90% growth, inoculate each tube with 500 μl of red blood cells infected with the transfected Plasmodium falciparum strain 3D7. Incubate at 37°C for 1 hour, shaking every 15 minutes. Resuspend the infected red blood cells in complete medium containing 1640 for the growth of Plasmodium falciparum and add them to HUVEC cells that have been pre-washed with 1640.
[0072] 3) Gently wash three times with PBS or use 1640 complete medium to wash away non-adherent red blood cells.
[0073] 4) Fix the slides with 1% glutaraldehyde for 1 hour at room temperature.
[0074] 5) After fixation, rinse thoroughly and stain with Giemsa for approximately 1 hour at room temperature. Observe adhesion under a microscope.
[0075] 6) Count the number of infected erythrocytes adhered to 300-500 HUVECs (human umbilical vein endothelial cells). Design three parallel wells and calculate the average number of infected erythrocytes adhered to each HUVEC (human umbilical vein endothelial cell). Take photos and prepare graphs.
[0076] 6. Gametophyte Experiment
[0077] Gametocyte culture method:
[0078] 1) Maintain a hematocrit of 4% with a parasite blood rate of less than 6%
[0079] 2) When the blood rate of the ring stage reaches 3%-5%, synchronization is carried out. This is recorded as day 0
[0080] 3) On the second day (recorded as day 1), only change the medium without adding blood. When changing the medium, be sure to preheat it to 37℃ in advance.
[0081] 4) When the ring stage is reached (usually the second day), dilute the blood rate to 0.1%
[0082] 5) Change the fluid every day but do not add blood
[0083] 6) Sexual parasites can be observed around day 9, which are in stages III-IV, and stage V parasites can be observed around day 10-12
[0084] Example 1: Identification and sequence analysis of lnc30 ( Figure 1 )
[0085] We used RACE (rapid-amplification of cDNA ends) to identify the full-length sequences of late highly expressed lncRNAs. Only the 5'RACE and 3'RACE of lnc30 were successfully obtained, while the others were unsuccessful. The 5' sequence of lnc30 was extended by 267 bp (see Figure 1 A in the ), the 3' sequence was extended by 30 bp (see Figure 1 Finally, by sequencing the complete clone, we determined that the full length of lnc30 was 705 nt. We further used the Northern Blot method to detect and verify lnc30, and the results showed that a clear and highly specific band appeared at 705 nt. Figure 1 C in the figure, which is consistent with the RACE results. The secondary structure of lnc30 was then analyzed, and the results showed that the secondary structure of lnc30 is complex, with multiple stem-loop structures (see Figure 1 D in the figure) indicates that it can form a relatively stable structure, thus laying the foundation for its function. In order to clarify the localization of lnc30 in Plasmodium falciparum cells, we used FISH (fluorescence in situ hybridization) technology to detect it. The results showed that the signal of lnc30 completely overlapped with DAPI, indicating that lnc30 is located in the cell nucleus (see Figure 1 E).
[0086] RACE assay: SMARTer RACE kits were used for rapid cloning of the 5' and 3' ends. Sequencing confirmed the full length of lnc30 to be 705 nt, with a 267 bp extension at the 5' end and a 30 bp extension at the 3' end. Sequencing confirmed the sequence of lnc30 as shown in SEQ ID NO: 1.
[0087] Northern Blot verification: prepare 6% polyacrylamide-urea denaturing gel, separate RNA by electrophoresis and transfer to membrane, hybridize with digoxigenin-labeled specific probe (5'-CGTTATAATAAGTACGTACATAACTATCTAAATATACTTACAACACTGGA-3'), and chemiluminescence detection shows a specific band at 705 nt.
[0088] The SEQ ID NO: 1 sequence is:
[0089] Example 2: Construction, identification and phenotypic study of lnc30 overexpressing insect strains
[0090] 1. Construction of lnc30 overexpression plasmid
[0091] The full-length sequence of lnc30 was cloned into the original plasmid PLN-ENR-GFP, and the CAM promoter of the original plasmid was transformed into the U6 promoter suitable for Plasmodium falciparum, named PLN-30 overexpression (see Figure 2 A). PLN plasmid was used as a control plasmid (see Figure 2 B). The transformed recombinant plasmids were verified to be completely correct by sequencing.
[0092] 2. Transfection and Construction of Lnc30 Overexpression Strains
[0093] The constructed plasmid was transformed into the ring-stage Plasmodium falciparum 3D7 strain using electroporation (transfection parameters: 310V / 950uf). Thirty days after transfection, an increase in parasite blood count was observed. The genome was extracted and tested for BSD resistance genes. Results showed that compared to the untransfected 3D7 strain, both the control plasmid-transfected strain (con) and the overexpression plasmid-transfected strain (lnc30oe) showed the presence of the BSD gene (see ). Figure 3 A), indicating that the plasmid transfection was successful.
[0094] qRT-PCR was further used to detect whether lnc30 was overexpressed. The results showed that the expression level of lnc30 in the overexpression strain (lnc30oe) was significantly higher than that in the control group (con) (see Figure 3 B), indicating that the lnc30 overexpression strain was successfully constructed.
[0095] 3. Phenotypic Observation of Lnc30 Overexpression Strains
[0096] The overexpression plasmid transfected strain (lnc30oe) and the control plasmid transfected strain (con) were synchronized continuously and the changes in their parasite blood rate were observed for 8 consecutive days. The results are shown below. Figure 4 As shown in Figure A, compared with the control plasmid transfected strain (con), although the initial blood rate was the same, the blood rate of the lnc30oe strain increased significantly after one growth cycle, indicating that the overexpression plasmid transfected strain (lnc30oe) had a significant growth advantage.
[0097] In order to clarify the reasons why the overexpression plasmid transfectant strain (lnc30oe) has a growth advantage, the present invention explored the two aspects of merozoite number and merozoite invasion ability.
[0098] (1) Merozoite number experiment
[0099] We counted the number of merozoites in 40 consecutive schizonts obtained after synchronizing the lnc30 overexpressing strain (lnc30 oe) and the control plasmid transfected strain (con). 60 schizonts were randomly selected from each group. The results showed that there was no difference in the number of merozoites between the experimental group and the control group (p = 0.2845) (see Figure 4 (B in Figure 1). Therefore, the growth advantage of the lnc30-overexpressing strain is not due to the production of more merozoites.
[0100] (2) Merozoite invasion experiment
[0101] Late schizonts were enriched to make the initial parasitic blood rate of schizonts the same. After 12 hours, all of them were ring bodies. The parasitic blood rate of lnc30oe was higher than that of the control group, and the difference was statistically significant (see Figure 4C in the figure), therefore, the growth advantage is likely due to the increased invasion ability of merozoites. In Plasmodium, enhanced adhesion ability can lead to increased invasion ability. So does the overexpression of lnc30 affect the transcription level of var genes related to adhesion? So we tested 58 var genes in lnc30oe and con strains. qRT-PCR results showed that in the lnc30 overexpression strain, only pf3D7-0900100 in the adhesion-related var gene family increased by 3 times (see Figure 4 D), HUVEC cells were used to further detect the adhesion ability of red blood cells infected with Plasmodium (see Figure 4 However, the results showed that the adhesion ability of erythrocytes infected with the lnc30-overexpressing strain was not enhanced, suggesting that the increased merozoite invasion ability is not caused by enhanced adhesion ability.
[0102] Regarding the aforementioned studies examining merozoite number and merozoite invasion ability, the authors found that lnc30 overexpression promoted parasite growth but did not increase merozoite number or adhesion ability. This finding suggests a novel mechanism by which lncRNAs contribute to malarial parasite pathogenicity—one that transcends traditional adhesion pathways and instead achieves a growth advantage by finely regulating the host-parasite interface. This suggests a qualitative shift in invasion efficiency, rather than a quantitative dependence. For example, lnc30 may enhance the invasion success rate of individual merozoites by regulating post-translational modifications or conformational changes in parasite surface proteins (such as AMA1 and the RON complex) without altering the total number of adhesion molecules. Alternatively, lnc30 may induce the parasite to secrete specific enzymes (such as serine proteases) that pre-degrade cytoskeletal proteins in localized regions of the erythrocyte membrane, pre-softening the membrane and making it more susceptible to invasion. However, the specific mechanism of action of lnc30 in invasion requires further investigation.
[0103] Based on the experiments that have been completed, it is suggested that lnc30 can be used as a potential drug target for the development of antimalarial drugs, and the ability of merozoites to invade red blood cells can be affected by controlling the expression level of lnc30.
[0104] Example 3: Construction and transfection of lnc30 knockdown plasmid
[0105] sgRNA targeting lnc30 was designed using Crispr Gentool software. After adding 20-25bp of sequence homologous to the two ends of the plasmid to be connected, PCR was performed to obtain the sgRNA double strand:
[0106] SgRNA-5'10ul
[0107] SgRNA-3'10ul
[0108] 5ul sterile water
[0109] PCR procedure:
[0110] 94℃2min
[0111] 94℃30s
[0112] 72℃30s
[0113] 94℃30s
[0114] 72℃30s
[0115] 60℃30s
[0116] 40℃30s
[0117] 25℃30s
[0118] 16℃30s
[0119] 4℃30s
[0120] Use seamless connection method to directly connect the sgRNA PCR product to the vector:
[0121]
[0122] The above system was added to a sterile Epp tube and connected at 37°C for 30 minutes.
[0123] The ligation product is transformed, single clones are picked, and the plasmid is extracted and sent to a sequencing company for sequencing. After the sequencing results are correctly aligned, the entire plasmid can be sequenced and prepared for transfection.
[0124] The original plasmid of low expression plasmid was donated by the Jiang research group of Shanghai Pasteur Institute, Chinese Academy of Sciences. Figure 5 As shown, the sgRNA targeting the lnc30 promoter region was successfully linked into the original vector, and the knockdown plasmid for low-expression lnc30 was successfully constructed (see Figure 5 After sequencing verification, the A) in the figure was transfected into the ring stage Plasmodium falciparum 3D7 strain by electroporation, and the control strain was successfully constructed. However, after repeated experiments, a low-expressing strain was still not obtained. At the same time, the control plasmid was transfected, and a transfected strain was successfully obtained 30 days after transfection. Through the detection of drug screening genes (see Figure 5 B) further demonstrates the successful generation of a control plasmid transfectant. Despite repeated experiments, the present invention failed to construct a low-expressing strain. Comparing the phenotypic observations of the production curves of the lnc30-overexpressing strain suggests that lnc30 expression may play a crucial role in the survival of Plasmodium falciparum, and knocking down lnc30 may lead to the death of Plasmodium falciparum. This further demonstrates that lnc30 is an important target for the prevention and treatment of Plasmodium falciparum.
[0125] Summary: This study identified lnc30 in the erythrocytic stage of Plasmodium falciparum for the first time and found that it is highly expressed in the schizont stage and localized to the nucleus. Overexpression enhances merozoite invasion, while knockout may lead to the death of Plasmodium falciparum. Based on these findings, the present invention also constructed an lnc30 gene knockout plasmid, which is applicable to the study of gene expression regulation mechanisms in Plasmodium falciparum and the screening of drugs that inhibit the growth and development of Plasmodium falciparum. This provides a new approach and tool for the treatment and research of malaria, with significant scientific value and application prospects.
Claims
1. A method for constructing a gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene, characterized in that The following steps are involved: (1) sgRNA design: Based on CRISPR-Cas9 technology, a specific sgRNA was designed for the promoter region of the lnc30 gene, including: The nucleotide sequence of the lnc30 gene is shown in SEQ ID NO.1; The target sequence of sgRNA-1 is: 5′-ATGCATGTTTCCGCTGCTTG-3′, as shown in SEQ ID NO. 2; The target sequence of sgRNA-2 is: 5′-TTCATAAACAAGTATATGTG-3′, as shown in SEQ ID NO. 3; (2) sgRNA amplification: Add 20-25 bp of homology arm sequences that completely match the two ends of the target vector at both ends of the sgRNA sequence in (1), and obtain a double-stranded sgRNA expression cassette by PCR amplification; (3) Seamless cloning construction: directly connect the PCR product described in (2) to the linearized vector using seamless ligation technology; (4) Plasmid verification: After confirming the absence of mutations through transformation → single clone screening → whole plasmid sequencing, it is used to transfect Plasmodium.
2. The construction method according to claim 1, characterized in that The PCR amplification procedure is: React at 94°C for 2 minutes; react at 94°C for 30 seconds; react at 72°C for 30 seconds; react at 94°C for 30 seconds; react at 72°C for 30 seconds; react at 60°C for 30 seconds; react at 40°C for 30 seconds; react at 25°C for 30 seconds; react at 16°C for 30 seconds; react at 4°C for 30 seconds.
3. Use of the CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene constructed by the method according to any one of claims 1-2 in the study of gene expression regulation mechanisms in Plasmodium falciparum.
4. Use of a CRISPR-Cas9 gene knockout plasmid targeting the promoter region of the Plasmodium lnc30 gene constructed by the method according to any one of claims 1 to 2 in screening or preparing drugs that inhibit the growth and development of Plasmodium falciparum.