Pichia pastoris strain, fermentation agent and application thereof

Abstract

The application provides a Pichia sp. strain, a fermentation agent and application, and the Pichia sp. strain is classified and named as Pichia sp. WJL-M4, and the preservation number is CGMCC No. 30666. The Pichia sp. WJL-M4 has the advantages of high acid reduction efficiency, stable acid reduction effect, improved total flavonoid content and improved taste, and the like, by using the Pichia sp. WJL-M4 which has the ability of quinic acid tolerance and can efficiently degrade malic acid to treat sea buckthorn deoiled juice and reduce the content of malic acid.

Description

Technical Field

[0001] This application relates to the field of food biotechnology, and in particular to a Pichia pastoris strain, a fermentation agent, and its application. Background Technology

[0002] Organic acids are natural substances found in fruits and vegetables, and are important indicators for measuring their flavor and nutritional quality, directly affecting the quality of fruits, vegetables, and their products. Organic acids can give fruits and vegetables a refreshing and pleasant sour taste, but excessive organic acid content can make them taste unbearably sour and astringent. The types and amounts of organic acids vary greatly among different types of fruits and vegetables.

[0003] Sea buckthorn is widely cultivated in Northwest China and is a raw material for developing functional foods. Currently, it is mainly used in the production of yogurt, cheese, chocolate, and baked goods. Sea buckthorn has high acidity, primarily due to malic acid and quinic acid. This high acidity leads to an imbalance in the sugar-acid ratio, resulting in an unpleasant taste. To obtain beverages with a good taste after processing, sugar must be added to overcome the strong acidity caused by the high malic and quinic acid levels, achieving a suitable sugar-acid ratio and thus improving the flavor. However, as people's living standards continue to improve, they have higher demands for product quality and tend to choose foods with nutritional value and health benefits. Adding large amounts of sugar contradicts the current low-sugar diet trend; at the same time, adding large amounts of sugar increases product costs and leads to unnecessary sugar consumption.

[0004] Quinic acid, with its multiple phenolic hydroxyl groups, is a highly effective antioxidant that can inhibit the deterioration of fruit juice. Given the unique composition of organic acids in sea buckthorn, the key challenge in sea buckthorn processing and industrial development lies in how to retain quinic acid while efficiently degrading malic acid in a quinic acid environment—that is, preserving more active ingredients while improving taste. Summary of the Invention

[0005] To address the aforementioned issues, this application provides a Pichia pastoris strain that can be applied to sea buckthorn juice. It can degrade malic acid while retaining quinic acid, resulting in a large degradation amount and a fast degradation rate, thus giving the sea buckthorn juice a better sensory evaluation.

[0006] This application provides a Pichia sp. strain, classified as Pichia sp. WJL-M4, with accession number CGMCC No.30666.

[0007] The Pichia sp. WJL-M4 strain was deposited on May 17, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 30666; the suggested classification name is Pichia sp., and the test result shows that it is viable; the deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; the nucleotide sequence of its ITS is described in the molecular biological identification section of the specific implementation method.

[0008] This application also provides a fermentation agent comprising the aforementioned Pichia pastoris strain.

[0009] This application also provides an application of a Pichia sp. strain, which is classified as Pichia sp. WJL-M4 and has the accession number CGMCC No. 30666. The Pichia sp. strain is used to prepare sea buckthorn juice.

[0010] Optionally, the Pichia pastoris strain is tolerant to quinic acid and can degrade malic acid.

[0011] Optionally, the *Pichia pastoris* strain is tolerant to at least 60 g / L of quinic acid. The *Pichia pastoris* strain WJL-M4 grows normally at quinic acid concentrations ≤60 g / L. Normal growth is defined as, under the same conditions, compared to an environment without quinic acid, the OD of *Pichia pastoris* strain WJL-M4 being higher. 600 The value did not decrease significantly.

[0012] Optionally, the Pichia pastoris strain has the following ability to degrade malic acid:

[0013] When the concentration of quinic acid is 0-10 g / L, the acid reduction rate of malic acid at a concentration of 0-20 g / L reaches more than 90%.

[0014] When the concentration of quinic acid is 0-10 g / L, the acid reduction rate of malic acid at a concentration of 20-40 g / L reaches more than 83%.

[0015] When the concentration of quinic acid is 10-20 g / L, the acid reduction rate of malic acid at a concentration of 0-20 g / L reaches more than 85%.

[0016] Optionally, the Pichia pastoris strain is inoculated during the preparation of sea buckthorn juice.

[0017] Optionally, in the preparation of sea buckthorn juice, the Pichia pastoris strain is inoculated into the deoiled sea buckthorn juice in the form of a seed liquid, wherein the viable cell count in the seed liquid is 5–10 × 10⁻⁶. 7 CFU / mL.

[0018] Optionally, after inoculation with the Pichia pastoris strain, fermentation is carried out for at least 24 hours.

[0019] Optionally, after inoculation with the Pichia pastoris strain, fermentation is carried out at 22–31°C.

[0020] This application also provides a method for preparing sea buckthorn juice, comprising:

[0021] Step 1, provide sea buckthorn oil-free juice;

[0022] Step 2: Inoculate the sea buckthorn oil-depleted juice with Pichia pastoris WJL-M4 for fermentation. The preservation number of Pichia pastoris WJL-M4 is CGMCC No.30666.

[0023] Step 3: The sea buckthorn juice is obtained through post-processing.

[0024] The Pichia sp. WJL-M4 strain is resistant to quinic acid and can efficiently degrade malic acid. When Pichia sp. WJL-M4 is used to ferment sea buckthorn deoiled juice, the quinic acid content of the sea buckthorn juice remains unchanged, the malic acid content decreases significantly, and the total flavonoid content increases significantly.

[0025] Optionally, in step 2, Pichia pastoris WJL-M4 is added to the sea buckthorn deoiled juice in the form of a seed culture, and the viable cell count of Pichia pastoris WJL-M4 seed culture is 5 to 10 × 10⁻⁶. 7 CFU / mL.

[0026] Optionally, in step 2, the fermentation inoculum size is 1-9%, where the fermentation inoculum size is the ratio of the volume of Pichia pastoris WJL-M4 seed liquid to the volume of sea buckthorn deoiled juice. Preferably, in step 2, the fermentation inoculum size is 3%-7%.

[0027] Optionally, in step 2, the fermentation time is 12–60 hours. More preferably, in step 2, the fermentation time is 12–36 hours. Even more preferably, in step 2, the fermentation time is 12–24 hours.

[0028] Optionally, in step 2, the fermentation temperature is 22–31°C.

[0029] Optionally, in step 2, the fermentation liquid volume is 4% to 36%, where the fermentation liquid volume is the ratio of the volume of the de-oiled sea buckthorn juice in the fermentation container to the volume of the fermentation container. More preferably, in step 2, the fermentation liquid volume is 4% to 20%.

[0030] Optionally, the fermentation in step 2 is carried out under shaking conditions, with the shaking speed being 120 rpm to 240 rpm. More preferably, the shaking speed is 150 rpm to 210 rpm.

[0031] The remaining steps in making sea buckthorn juice, excluding fermentation, are carried out using existing technologies.

[0032] This application also provides a sea buckthorn juice, which is prepared using the sea buckthorn juice preparation method described above.

[0033] Pichia sp. WJL-M4 was applied to reduce the acidity of sea buckthorn, exhibiting high efficiency, stable effect, increased total flavonoid content, improved taste, and richer aroma, showing broad application prospects. Under optimized conditions and cultured for 24 hours, the malic acid degradation rate in sea buckthorn juice reached over 90%, the total flavonoid content increased by over 32%, and the overall sensory score improved by 51.25%.

[0034] The quinic acid content in the sea buckthorn juice remains unchanged compared to the unfermented sea buckthorn deoiled juice, while the malic acid content in the sea buckthorn juice is reduced by at least 90% compared to the unfermented sea buckthorn deoiled juice. The total flavonoid content in the sea buckthorn juice is increased by at least 32% compared to the unfermented sea buckthorn deoiled juice.

[0035] Compared with the prior art, this application has the following beneficial effects:

[0036] This application uses Pichia pastoris (Pichiasp.) WJL-M4, which is tolerant to quinic acid and can efficiently degrade malic acid, to treat sea buckthorn deoiled juice, thereby reducing its malic acid content. It has advantages such as high acid reduction efficiency, stable acid reduction effect, increased total flavonoid content, and improved taste. Attached Figure Description

[0037] Figure 1a This is a photograph of the colony morphology of Pichia sp. WJL-M4 on a solid quinic acid agar plate, as per this application.

[0038] Figure 1b This is a photograph of the colony morphology of Pichia sp. WJL-M4 on a solid screening medium plate, as per this application.

[0039] Figure 2a This is a photograph of the cell morphology of Pichia sp. WJL-M4 under an optical microscope at 1000x magnification.

[0040] Figure 2b This is a photograph of the morphological observation of Pichia sp. WJL-M4 cells stained with methylene blue under an optical microscope at 1000x magnification.

[0041] Figure 3This is an agarose gel electrophoresis image of the PCR product of Pichia sp. WJL-M4 in this application. The band labeled WJL-M4 is the ITS band of Pichia sp. WJL-M4.

[0042] Figure 4a and Figure 4b The figures are schematic diagrams showing the tolerance and degradation effects of Pichia sp. WJL-M4 to different malic acid concentrations. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0043] Figure 5a and Figure 5b The figures show the effects of different inorganic salts on the cell growth and acid reduction rate of Pichia sp. WJL-M4 in this application. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0044] Figure 6a and Figure 6b The figures show the effects of disodium hydrogen phosphate addition on the cell growth and acid reduction rate of Pichia sp. WJL-M4 in this application. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0045] Figure 7a and Figure 7b The figures show the effects of different nitrogen sources on the cell growth and acid reduction rate of Pichia sp. WJL-M4 in this application. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0046] Figure 8a and Figure 8b The figures show the effects of yeast extract addition on the cell growth and acid reduction rate of Pichia sp. WJL-M4 in this application. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0047] Figure 9 This is a schematic diagram showing the changes in malic acid and total flavonoids of Pichia sp. WJL-M4 under different time conditions for reducing the acidity of sea buckthorn. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0048] Figure 10 This is a schematic diagram showing the changes in malic acid and total flavonoids of Pichia sp. WJL-M4 under different temperature conditions for reducing the acidity of sea buckthorn. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0049] Figure 11 This is a schematic diagram showing the changes in malic acid and total flavonoids of Pichia sp. WJL-M4 under different inoculation conditions for reducing citric acid in sea buckthorn. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0050] Figure 12 This is a schematic diagram showing the changes in malic acid and total flavonoids of Pichia sp. WJL-M4 under different liquid volume conditions for reducing the acidity of sea buckthorn. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0051] Figure 13 This is a schematic diagram showing the changes in malic acid and total flavonoids of Pichia sp. WJL-M4 under different rotation speeds for reducing the acidity of sea buckthorn. Different lowercase letters for the same indicator represent significant differences (p<0.05).

[0052] Figure 14 This is a flowchart of a method for preparing sea buckthorn juice in one embodiment of this application.

[0053] Figure 15 A schematic diagram of sensory evaluation of sea buckthorn without acid reduction and Pichia sp. WJL-M4 of this application for acid reduction. Detailed Implementation

[0054] The technical solutions in the embodiments of this application will be described more clearly and in detail below with reference to specific embodiments and accompanying drawings. However, the embodiments described are only a part of all embodiments. All other embodiments based on the embodiments of this application that do not exceed the scope of innovation of this application are within the scope of protection of this application.

[0055] Unless otherwise specified, the following specific embodiments are all conventional methods.

[0056] Screening of Pichia sp. WJL-M4

[0057] The process of obtaining Pichia sp. WJL-M4 involves the following steps:

[0058] (1) Pre-treat fresh sea buckthorn fruit to obtain a treatment solution containing candidate strains;

[0059] (2) The treatment solution was added to a quinic acid medium with quinic acid as the sole carbon source and cultured to screen out strains tolerant to quinic acid.

[0060] Quinic acid culture medium with quinic acid as the sole carbon source includes liquid quinic acid medium and solid quinic acid medium. Acid-resistant strains that can tolerate at least 20 g / L quinic acid are obtained by culturing in liquid quinic acid medium. After the acid-resistant strains are continuously transferred and cultured at least 10 times, they are streaked and cultured on solid quinic acid medium to obtain quinic acid-resistant strains.

[0061] (3) The strain that is tolerant to quinic acid is inoculated into a screening medium with malic acid as the sole carbon source and cultured. The strain that can degrade malic acid is selected to obtain the Pichia pastoris WJL-M4.

[0062] Screening media using malic acid as the sole carbon source include liquid and solid screening media. Quinic acid-tolerant strains were prepared as seed culture and inoculated into liquid screening medium. OD (Oxygen Optimum) samples were screened in liquid screening medium with a malic acid concentration of 20 g / L. 600 Strains with a growth rate greater than 1.80 were then subjected to multiple purification cultures on solid selection medium to obtain the Pichia pastoris strain WJL-M4. The specific screening process is as follows:

[0063] S1, strain enrichment

[0064] Add an appropriate amount of fresh sea buckthorn fruit to a 250mL Erlenmeyer flask containing 100mL of sterile physiological saline, and add 4-6 sterile glass beads. Shake at 180rpm for 60min at room temperature, and then let stand to obtain the supernatant. Take 5mL of the supernatant and add it to sterilized liquid quinic acid medium with quinic acid as the sole carbon source. Shake and incubate for 24h at 28℃ and 180rpm under the following conditions: 100mL / 250mL Erlenmeyer flask (unless otherwise specified, the liquid volume is expressed as AmL / BmL, where A refers to the volume of liquid in the Erlenmeyer flask and B refers to the volume of the Erlenmeyer flask). Under the same culture conditions, the cultured bacterial suspensions were successively transferred, with the concentration of quinic acid in the liquid quinic acid medium gradually increasing from 2 g / L, 4 g / L, 8 g / L, 12 g / L, 16 g / L to 20 g / L. The strains were continuously transferred and cultured in liquid quinic acid medium containing 20 g / L quinic acid 10 times to obtain strains tolerant to high concentrations of quinic acid and high acid environments. The cell growth of the strains in liquid quinic acid medium with a quinic acid concentration of 20 g / L was measured, and it was found that the cell growth increased with the extension of the culture time, proving that the strains can survive in a high quinic acid environment and therefore have the ability to tolerate quinic acid. Strains tolerant to high concentrations of quinic acid and high acid environments, which were continuously transferred and cultured 10 times, were streaked onto solid quinic acid medium for pure culture. Single colonies were picked and streaked onto solid quinic acid medium for purification culture. After purification culture, they were numbered to obtain 3 strains, which were numbered WJL-M4, WJL-T5, and WJL-W12. They were stored in preservation slant medium for later use.

[0065] Quinic acid culture medium includes liquid quinic acid culture medium and solid quinic acid culture medium.

[0066] The liquid quinic acid medium is composed of the following per liter of distilled water: 10g yeast extract, 20g peptone, and 2-20g quinic acid.

[0067] The composition of solid quinic acid medium is as follows: per liter of distilled water, add: 10g yeast extract, 20g peptone, 20g quinic acid, and 25g agar powder. The preparation method is as follows: dissolve all the components of the solid quinic acid medium except for quinic acid in 800mL of distilled water, stir well, and sterilize at 121℃ for 20min; dissolve 20g of quinic acid in another 200mL of distilled water and sterilize at 121℃ for 20min; after sterilization, cool to 50-60℃, mix well, and pour into plates to prepare solid quinic acid medium.

[0068] The preservation slant culture medium is prepared by adding the following to every liter of distilled water: 10g yeast extract, 20g peptone, 20g glucose, and 25g agar powder. The preparation method involves dissolving all components of the preservation slant culture medium except glucose in 800mL of distilled water and stirring thoroughly. Then, dissolve 20g of glucose in another 200mL of distilled water. After sterilization, cool to 50–60℃, mix thoroughly, and pour into test tubes to form slant culture media. Pichia sp. WJL-M4 is streaked onto the preservation slant culture medium and incubated at 30℃ for 48 hours, then stored at 4℃.

[0069] S2. Screening of malic acid-degrading yeasts

[0070] The purified strains obtained from S1, numbered WJL-M4, WJL-T5, and WJL-W12, and cultured on the preservation slant medium, were each inoculated with a loopful into liquid YPD medium. After enrichment culture at 28°C and 180 rpm for 24 h with shaking, the seed solutions corresponding to the numbered strains were obtained. These seed solutions were then inoculated at a 2% (v / v) inoculation rate into liquid screening medium containing 5 g / L malic acid as the sole carbon source and cultured at 28°C and 180 rpm for 24 h with a 100 mL / 250 mL Erlenmeyer flask. Under the same culture conditions, the cultured bacterial suspensions were sequentially transferred, with the malic acid concentration in the liquid selection medium gradually increasing from 5 g / L, 10 g / L, 15 g / L, 20 g / L to 20 g / L. This process was repeated 10 times in a liquid selection medium containing 20 g / L malic acid. The bacterial growth (OD) at a malic acid concentration of 20 g / L in the liquid selection medium was then selected. 600Strains with a growth rate greater than 1.80 were purified on solid screening medium using the dilution plating method and cultured at 30°C. Vigorous single colonies were selected from the solid screening medium and streaked again for pure culture. The selection culture was repeated under the condition of 30°C until pure strains were obtained and numbered.

[0071] After the above operations, strain number WJL-M4 was obtained, which met the above conditions. It appeared milky white and opaque on solid selection medium, and was labeled and stored on solid selection medium.

[0072] The liquid YPD culture medium is composed of the following per liter of distilled water: 10g yeast extract, 20g peptone, and 20g glucose.

[0073] Screening media include liquid screening media and solid screening media. The composition of liquid screening media is: 10g yeast extract, 20g peptone, and 5-20g malic acid per liter of distilled water.

[0074] The solid screening medium consists of the following components added per liter of distilled water: 10g yeast extract, 20g peptone, 20g malic acid, and 25g agar powder. The solid screening medium is prepared as follows: dissolve all components except malic acid in 800mL of distilled water and stir well; dissolve 20g of malic acid in another 200mL of distilled water; sterilize each component separately, cool to 50-60℃, mix thoroughly, and pour into plates to prepare the solid screening medium.

[0075] Unless otherwise specified or emphasized, the malic acid content in the screening medium is 20 g / L.

[0076] Physiological and biochemical identification of Pichia sp. WJL-M4

[0077] Physiological and biochemical identification was performed on the isolated and purified strain WJL-M4, including colony morphology observation, methylene blue staining observation, sugar fermentation, carbon source assimilation, and nitrogen source assimilation experiments. The experimental methods adopted were conventional experimental methods in this field.

[0078] The physiological and biochemical test results of strain WJL-M4 are shown in Table 1.

[0079] Table 1. Physiological and biochemical characteristics of strain WJL-M4

[0080]

[0081]

[0082] Note: "+" indicates a positive result, and "-" indicates a negative result.

[0083] Strain WJL-M4 can utilize glucose and sucrose, and can assimilate mesotriose, but cannot utilize other sugar sources such as lactose and galactose. It can assimilate glycerol and ethanol.

[0084] See colony morphology Figure 1a , Figure 1b As shown, the morphology on solid quinic acid medium is as follows Figure 1a As shown, the morphology on the solid screening medium is as follows Figure 1b As shown in the figure, the results show the morphology of the strain after being cultured at 30℃ for 2 days on solid quinic acid medium and solid screening medium. The colonies are milky white, round, 3-5 mm in diameter, with a certain thickness, slightly raised in the middle, relatively uniform in texture, smooth, moist and viscous surface, easy to pick up, with neat edges and opaque.

[0085] The microscopic morphological characteristics of strain WJL-M4 after methylene blue staining were observed as follows: Figure 2a , Figure 2b As shown, the cells change from round to oval, and their reproduction method is budding.

[0086] Molecular biological identification of strains

[0087] The specific steps are as follows: Genomic DNA was extracted from the isolated and purified bacterial strain using DNA-EZ Reagents VAll-DNA-Fast-Out universal one-step DNA extraction buffer. 2 μL of the bacterial culture activated with liquid YPD medium was added to 50 μL of the DNA extraction buffer, and PCR was performed at 80°C for 5 min. The ITS sequences of the primers were amplified using universal primers for ITS4 and ITS5. The PCR amplification conditions were: 94°C pre-denaturation for 4 min; 34 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 48 s; and a final extension at 72°C for 10 min. The agarose gel electrophoresis image of the PCR product is shown below. Figure 3 As shown, after sequencing, the obtained ITS sequence was compared with known sequences in GenBank using the BLAST program on the website http: / / blast.ncbi.nlm.nih.gov / Blast.cgi. In the NCBI (National Center for Biotechnology Information) database, the strain's ITS sequence was analyzed and compared with known sequences in GenBank using the online BLAST (Basic Local Alignment Search Tool) program.

[0088] Based on the morphological characteristics of strain WJL-M4 Figure 1a , Figure 1b , Figure 2a , Figure 2bPhysiological and biochemical characteristics (Table 1) and ITS sequence analysis identified strain WJL-M4 as Pichia sp., and named it Pichia sp. WJL-M4.

[0089] Pichia sp. WJL-M4 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 17, 2024, with accession number CGMCC No. 30666. The viability report recommends the classification name *Pichia sp.*, and the test results show it is viable. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The nucleotide sequence of the ITS of Pichia sp. WJL-M4 is as follows:

[0090] CGGAAGGATCATTACTGTGATATACTTTCCACACTGCGTGCCGCTAAC

[0091] AAACCCCTAAACATGAATAACCTAGTCAAGAATCCATAAGAATAAAACTTT

[0092] CAACAACGGATCTCGGGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGC

[0093] GATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCA

[0094] CATTGCGCCCCCTGGTATTCCGGGGAACATGCCTGTTTGAGCGTCGGGGCT

[0095] ATCTCACGCAAGTGGAGCTGGCCCGGCCTTGGGCTTGCCGAAAAGAAACG

[0096] AGGGCGAAGCGAACTATGTTGTGCGCCGACCCCAGCTATCAAGCTCGACC

[0097] TCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATTG.

[0098] Determination of the quinic acid tolerance of Pichia sp. WJL-M4

[0099] The growth of Pichia sp. WJL-M4 at different quinic acid concentrations after 48 hours of culture is shown in Table 2.

[0100] Table 2. Growth of Pichia pastoris WJL-M4 at different quinic acid concentrations.

[0101]

[0102] Note: Data are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences (p<0.05), and the same applies below.

[0103] The identified Pichia sp. WJL-M4 strain was cultured into a seed culture of Pichia sp. WJL-M4, and inoculated into 100 mL / 250 mL Erlenmeyer flasks at a 2% (v / v) inoculation rate. The quinic acid-tolerant liquid medium in the Erlenmeyer flasks used quinic acid as the sole carbon source, with quinic acid concentrations of 10 g / L, 20 g / L, 30 g / L, 40 g / L, 60 g / L, 80 g / L, 100 g / L, and 120 g / L. A control medium without quinic acid and with the same other components was used. The cultures were incubated at 28 °C and 180 rpm in a constant temperature shaker. After 48 h of incubation, cell growth was measured, specifically the OD (exponential growth rate). 600 The results showed that the bacterial growth was normal within the quinic acid concentration range of 0–60 g / L, and the OD... 600 The OD value is not lower than that of the control medium without quinic acid. 600 (0.61±0.03), the presence of quinic acid had no negative impact on bacterial growth; when the concentration of quinic acid was in the range of 60-120 g / L, the OD... 600 OD lower than control medium without quinic acid 600 (0.61±0.03) indicates that the strain can grow normally when the quinic acid concentration is less than or equal to 60 g / L; when the quinic acid concentration is greater than 60 g / L but less than 120 g / L, the bacterial growth is inhibited.

[0104] The specific inoculation procedure is as follows: Cultivation of the Pichia sp. WJL-M4 seed culture: Single colonies of Pichia sp. WJL-M4 are picked from solid screening medium and inoculated into liquid screening medium. After incubation at 28°C and 120 rpm for 24 hours in 100 mL / 250 mL Erlenmeyer flasks, the viable count is adjusted to 8 × 10⁻⁶ cells / mL using a hemocytometer. 7 The Pichia sp. WJL-M4 seed culture at CFU / mL can be used as the fermentation agent for this application, and other culture conditions are the same.

[0105] The control culture medium without quinic acid consists of 5g yeast extract and 0.5g disodium hydrogen phosphate per liter of distilled water; the quinic acid-tolerant liquid culture medium consists of 5g yeast extract, 0.5g disodium hydrogen phosphate, and 10-120g quinic acid per liter of distilled water.

[0106] Determination of malic acid tolerance in Pichia sp. WJL-M4

[0107] First, determine the maximum tolerance range of Pichia sp. WJL-M4 to malic acid, with a viable count of 8 × 10⁻⁶ cells. 7 The *Pichia sp.* WJL-M4 seed culture at CFU / mL was inoculated into malic acid-tolerant liquid medium. The malic acid concentrations used in the liquid medium were 5 g / L, 10 g / L, 20 g / L, 40 g / L, 60 g / L, 80 g / L, 100 g / L, 120 g / L, 160 g / L, and 200 g / L. The medium was cultured at 28℃, 180 rpm, with an inoculum size of 2% (v / v) and a volume of 30 mL / 250 mL Erlenmeyer flask for 48 h. The OD values ​​were then calculated. 600 The malic acid tolerance concentration of Pichia sp. WJL-M4 was determined using cell growth and viable cell count as indicators. The results are as follows: Figure 4a As shown.

[0108] Depend on Figure 4a It is evident that Pichia sp. WJL-M4 can tolerate malic acid concentrations ranging from 0 to 160 g / L. When the malic acid concentration is ≤160 g / L, Pichia sp. WJL-M4 grows well, while its growth is affected when the malic acid concentration is >160 g / L.

[0109] According to the data in Table 3, the pH of the solution corresponding to 160 g / L malic acid is 1.81, indicating that Pichia sp. WJL-M4 can tolerate a high acid environment and can grow well at a pH above 1.81; when the pH of the growth environment is <1.81, it will affect the growth.

[0110] Therefore, the malic acid concentration that Pichia sp. WJL-M4 can tolerate ranges from 0 to 160 g / L, with the lowest pH corresponding to 160 g / L malic acid being 1.81.

[0111] Depend on Figure 4bIt can be seen that the culture was carried out at a temperature of 28℃, a rotation speed of 180 rpm, an inoculum size of 2% (v / v), and a liquid volume of 30 mL / 250 mL Erlenmeyer flask for 48 h. Pichia sp. WJL-M4:

[0112] The acid reduction rate of malic acid at concentrations of 0–20 g / L reached 100%;

[0113] The acid reduction rate of malic acid with a concentration greater than 20 and ≤ 40 g / L reached over 96.31%;

[0114] The acid reduction rate of malic acid with a concentration greater than 40 and ≤ 60 g / L reached over 67.54%;

[0115] The acid reduction rate of malic acid with a concentration greater than 60 and ≤ 80 g / L reached over 49.41%;

[0116] The acid reduction rate of malic acid with a concentration greater than 80 and ≤100 g / L reached more than 38.67%;

[0117] The acid reduction rate of malic acid with a concentration greater than 100 and ≤120 g / L reached more than 32.05%;

[0118] The acid reduction rate of malic acid with a concentration greater than 120 and ≤160 g / L reached over 8.45%;

[0119] The acid reduction rate of malic acid with a concentration greater than 160 and less than or equal to 200 g / L reached over 4.52%.

[0120] The composition of malic acid-tolerant liquid culture medium is as follows: 5g yeast extract, 0.5g disodium hydrogen phosphate, and 5-200g malic acid per liter of distilled water.

[0121] Table 3. pH values ​​corresponding to different malic acid concentrations in malic acid-tolerant liquid culture medium.

[0122]

[0123] Optimization of acid-lowering culture medium for Pichia sp. WJL-M4

[0124] Using a basal medium without inorganic salts as a blank, magnesium sulfate, manganese sulfate, ferric sulfate, zinc sulfate, ferrous sulfate, potassium dihydrogen phosphate, sodium chloride, potassium chloride, and disodium hydrogen phosphate were added to the basal medium without inorganic salts to ensure that the salt content of each inorganic salt was 0.01 mol / L. The optimal inorganic salts were screened based on the growth rate of bacteria, the number of viable bacteria, the acid reduction rate, and the pH. The culture conditions were: inoculum size 2% (v / v), 28℃, 180 rpm shaker culture for 48 h, and the liquid volume was 30 mL / 250 mL Erlenmeyer flask.

[0125] The seed culture method for Pichia sp. WJL-M4 is as follows: A single colony of Pichia sp. WJL-M4 is picked from a solid screening medium and inoculated into a liquid screening medium. The medium is then cultured in 100 mL / 250 mL Erlenmeyer flasks at 28°C and 120 rpm for 24 hours. The viable count is then adjusted to 8 × 10⁻⁶ cells / mL using a hemocytometer. 7 The seed culture of Pichia sp. WJL-M4, CFU / mL.

[0126] The results are as follows Figure 5a , Figure 5b It is evident that, except for ferric sulfate and zinc sulfate, other inorganic salts at an addition level of 0.01 mol / L are all beneficial to the growth of bacteria and the degradation of malic acid. That is, magnesium sulfate, manganese sulfate, ferrous sulfate, potassium dihydrogen phosphate, disodium hydrogen phosphate, potassium chloride, and sodium chloride do not have an adverse effect on the growth and degradation of malic acid by Pichia sp. WJL-M4, indicating that Pichia sp. WJL-M4 can exert a good acid-reducing effect in the presence of a variety of inorganic salts.

[0127] Taking disodium hydrogen phosphate, the inorganic salt with the best acid-lowering effect, as an example, the addition amounts of disodium hydrogen phosphate were 0.1 g / L, 0.2 g / L, 0.3 g / L, 0.4 g / L, and 0.5 g / L. The culture conditions were: inoculum size 2% (v / v), 28℃, 180 rpm shaker culture for 48 h, and liquid volume 30 mL / 250 mL Erlenmeyer flask. The optimal addition amount of disodium hydrogen phosphate was screened based on the acid-lowering rate and cell growth rate. The results are as follows: Figure 6a , Figure 6b It is evident that different amounts of disodium hydrogen phosphate have little effect on the acid reduction rate and cell growth, indicating that Pichia sp. WJL-M4 can exert a good acid reduction effect in the presence of various inorganic salts at different concentrations.

[0128] Using a nitrogen-free basal medium as a blank, yeast extract, beef extract, peptone, ammonium sulfate, urea, and potassium nitrate were added to the nitrogen-free basal medium to make the nitrogen content 1 g / L. The optimal nitrogen source was screened based on cell growth, viable cell count, acid reduction rate, and pH. The culture conditions were: 2% inoculum (v / v), 28℃, 180 rpm shaker culture for 48 h, and 30 mL / 250 mL Erlenmeyer flask. Results are as follows: Figure 7a , Figure 7b As shown, all nitrogen sources other than ammonium sulfate have varying degrees of promoting effect on the growth or acid reduction of Pichia sp. WJL-M4, with yeast extract showing the best effect and an acid reduction rate of 100%.

[0129] The optimal addition amount of yeast extract was screened using yeast extract at addition levels of 1 g / L, 5 g / L, 10 g / L, 15 g / L, and 20 g / L, with cell growth, viable cell count, acid reduction rate, and pH as the criteria. The results are as follows: Figure 8a , Figure 8b As shown, the optimal addition amount of yeast extract is ≥5g / L for better results.

[0130] The seed culture of Pichia sp. WJL-M4 was obtained as follows: Single colonies of Pichia sp. WJL-M4 were picked from solid screening medium and inoculated into liquid screening medium. The medium was then cultured in 100 mL / 250 mL Erlenmeyer flasks at 28°C and 120 rpm for 24 h. The viable count was then adjusted to 8 × 10⁻⁶ cells / mL using a hemocytometer. 7 The seed culture of Pichia sp. WJL-M4, CFU / mL.

[0131] The formula for the basal culture medium without inorganic salts is as follows: add 10g of yeast extract and 20g of malic acid per liter of distilled water.

[0132] The formula for the nitrogen-free basal culture medium is as follows: add 0.5g of disodium hydrogen phosphate and 20g of malic acid per liter of distilled water.

[0133] The results of the optimal acid-lowering culture medium formulation screened by the experiment show that Pichia pastoris (Pichiasp.) WJL-M4 does not have high requirements for inorganic salts when exerting its acid-lowering effect, while yeast extract powder ≥1g / L will better enhance the acid-lowering effect.

[0134] Degradation of malic acid by Pichia sp. WJL-M4 at different concentrations

[0135] The formulation and culture conditions for the acid-lowering medium were as follows: yeast extract 5 g / L, disodium hydrogen phosphate 0.5 g / L, malic acid 5–200 g / L, culture temperature 28℃, liquid volume 12% (v / v), inoculum size 2% (v / v), rotation speed 180 rpm, and culture time 48 h. Different concentrations of malic acid were added to the acid-lowering medium as the starting material, with a malic acid concentration of 5 g / L as the control. After 48 h of acid-lowering culture, the cell growth and acid-lowering rate of Pichia sp. WJL-M4 were measured. The results are shown below. Figure 4a , Figure 4b As shown.

[0136] Depend on Figure 4aIt is evident that, compared to a malic acid concentration of 5 g / L, bacterial growth was good and uninhibited when the malic acid concentration was ≤160 g / L. When the malic acid concentration was greater than 160 g / L, bacterial growth showed a significant decrease (p<0.05). At malic acid concentrations >160 g / L, the number of bacteria showed a significant decreasing trend.

[0137] From Table 3 and Figure 4a , Figure 4b The results, combined with the fermentation effects of different malic acid concentrations, show that Pichia sp. WJL-M4 can achieve a certain acid reduction effect under different malic acid concentrations. For example, when the malic acid concentration reaches 40 g / L, the acid reduction rate after 48 hours of fermentation is 96.31% ± 0.13%; when the malic acid concentration is as high as 120 g / L, the acid reduction rate can still reach more than 30%. This indicates that Pichia sp. WJL-M4 has a very strong malic acid degradation ability, capable of degrading malic acid from 0 to 200 g / L, and can completely degrade malic acid from 0 to 40 g / L within 48 hours; when the malic acid concentration is 80 g / L, the acid reduction rate reaches 49.41% ± 0.55% after 48 hours of fermentation.

[0138] The seed culture method for Pichia sp. WJL-M4 is as follows: A single colony of Pichia sp. WJL-M4 is picked from a solid screening medium and inoculated into a liquid screening medium. The culture is carried out in a 250mL Erlenmeyer flask (100mL volume) at 28℃ and 120rpm for 24 hours. The colonies are then counted using a hemocytometer to adjust the viable count to 8 × 10⁻⁶. 7 The seed culture of Pichia sp. WJL-M4, CFU / mL.

[0139] The malic acid-lowering culture medium of different concentrations consists of the following components added per liter of distilled water: 5.0g yeast extract, 0.5g disodium hydrogen phosphate, and 5.0-200.0g malic acid.

[0140] Application of Pichia sp. WJL-M4 in the degradation of malic acid in sea buckthorn

[0141] S1, obtained from Pichia sp. WJL-M4 seed culture

[0142] The seed culture method for Pichia sp. WJL-M4 was as follows: Single colonies of Pichia sp. WJL-M4 were picked from solid selection medium and inoculated into liquid selection medium. The cultures were then incubated in 250 mL Erlenmeyer flasks (100 mL each) at 28°C and 120 rpm for 24 h. The viable counts were then determined using a hemocytometer to achieve a viable count of 8 × 10⁻⁶ cells / mL.7 The seed culture of Pichia sp. WJL-M4, CFU / mL.

[0143] S2. Effect of fermentation time on the degradation of malic acid in sea buckthorn by Pichia sp. WJL-M4

[0144] In pasteurized, undegraded sea buckthorn oil extract, the number of viable bacteria inoculated with 5% (v / v) was 8 × 10⁸. 7 The seed culture of *Pichia sp.* WJL-M4 (CFU / mL) was fermented at 28℃, 20% (v / v) volume, and 180 rpm for 12 h, 24 h, 36 h, 48 h, and 60 h, respectively. The residual malic acid and total flavonoid content in the sea buckthorn juice were determined to investigate the effect of fermentation time on the reduction of malic acid in *Pichia sp.* WJL-M4* and on changes in flavonoid content. The results are as follows: Figure 9 As shown. By Figure 9 It is evident that the period from 12 to 24 hours is the stage with the fastest rate of acid reduction. At 24 hours, the malic acid content in the sea buckthorn juice decreased from 14.90±0.2 g / L to 2.10±0.04 g / L, representing an acid reduction rate of 85.91%. At this time, the pH of the sea buckthorn juice increased from 2.93±0.01 to 3.30±0.01, and the total flavonoid content increased from 63.12±1.40 mg Rutin / L to 88.63±5.27 mg Rutin / L. The total flavonoid content in the acid-reduced sea buckthorn juice showed significant increases to varying degrees, with an increase rate exceeding 25.98% (after 12 hours of acid reduction fermentation). This indicates the presence of Pichia pastoris. After 24 hours of acid reduction fermentation with Pichia pastoris (sp.) WJL-M4, excellent acid reduction results were achieved. At this time, Pichia pastoris (sp.) WJL-M4 is in a rapid growth stage. In actual production, it has advantages such as high fermentation efficiency, rapid acid reduction, and significantly increased total flavonoid content. In practice, the acid reduction fermentation time can be controlled to end fermentation at different times depending on the purpose of acid reduction and the target product.

[0145] S3. Effect of fermentation temperature on the degradation of malic acid in sea buckthorn juice by Pichia sp. WJL-M4

[0146] In pasteurized, undegraded sea buckthorn oil extract, the number of viable bacteria inoculated with 5% (v / v) was 8 × 10⁸. 7The Pichia sp. WJL-M4 seed culture (CFU / mL) was fermented with shaking at temperatures of 22℃, 25℃, 28℃, 31℃, and 34℃, with a volume of 20% (v / v) and a rotation speed of 180 rpm for 24 h. The residual malic acid and total flavonoid content in the sea buckthorn juice were measured to investigate the effect of fermentation temperature on the reduction of malic acid in Pichia sp. WJL-M4 and on changes in flavonoid content. The results are as follows: Figure 10 As shown. By Figure 10 It is evident that the optimal temperature for acid reduction by Pichia sp. WJL-M4 is 22–31℃. At these temperatures, the acid reduction effect is generally good, with a reduction rate of 84.30–86.04%, and the total flavonoid content significantly increases by 30.26–66.52%. The increase in total flavonoid content is greatest at 25℃, significantly increasing from 63.12±1.40 mg Rutin / L in untreated sea buckthorn oil extract to 105.11±3.65 mg Rutin / L. In practical operation, the appropriate acid reduction fermentation temperature can be selected according to the needs.

[0147] S4. Effect of fermentation inoculum size on the degradation of malic acid in sea buckthorn juice by Pichia sp. WJL-M4

[0148] In pasteurized, undegraded sea buckthorn oil extract, the number of viable bacteria inoculated with 1%, 3%, 5%, 7%, and 9% (v / v) was 8 × 10⁻⁶. 7 The Pichia sp. WJL-M4 seed culture (CFU / mL) was fermented at 28℃ and 180 rpm for 24 h with shaking. The residual malic acid and total flavonoid content in the sea buckthorn juice were measured. The effect of inoculum size on the reduction of malic acid by Pichia sp. WJL-M4 and on changes in flavonoid content was investigated. The results are as follows: Figure 11 As shown. By Figure 11 It is evident that Pichia sp. WJL-M4 exhibits good acid-reducing effects at inoculum levels of 1–9%, with acid reduction rates ranging from 80.54% to 88.52% and a significant increase in total flavonoid content of 16.67%–63.93%. When the inoculum level of Pichia sp. WJL-M4 is 3–7%, the acid reduction rate of Pichia sp. WJL-M4 in degrading malic acid in sea buckthorn oil is 85.83%–87.11%, and the total flavonoid content is significantly increased by 32.59%–63.93%, with an inoculum level of 3% being the optimal value.

[0149] S5. Effect of fermentation volume on the degradation of malic acid in sea buckthorn juice by Pichia sp. WJL-M4

[0150] In pasteurized, undegraded sea buckthorn oil extract, the number of viable bacteria inoculated with 5% (v / v) was 8 × 10⁸. 7 The seed culture of *Pichia sp.* WJL-M4 (CFU / mL) was fermented at 28℃ with volume concentrations of 4%, 12%, 20%, 28%, and 36% (v / v) and a rotation speed of 180 rpm for 24 h. The residual malic acid and total flavonoid content in the sea buckthorn juice were measured to investigate the effect of volume concentration on the reduction of malic acid in *Pichia sp.* WJL-M4* and on changes in flavonoid content. The results are as follows: Figure 12 As shown. By Figure 12 It can be seen that when the liquid volume is 4% to 20%, that is, when the liquid volume is 10 mL / 250 mL to 50 mL / 250 mL (the liquid volume is 10 to 50 mL of sea buckthorn deoiled juice per 250 mL conical flask), the malic acid reduction rate is 84.63% to 85.91%, and the total flavonoid content is significantly increased by 19.77% to 45.23%. Therefore, the liquid volume of 4% to 20% is the optimal liquid volume.

[0151] S6. Effect of rotational speed on the degradation of malic acid in sea buckthorn juice by Pichia sp. WJL-M4

[0152] In pasteurized, undegraded sea buckthorn oil extract, the number of viable bacteria inoculated with 5% (v / v) was 8 × 10⁸. 7 The Pichia sp. WJL-M4 seed culture (CFU / mL) was fermented at 28℃ with a volume of 12% (v / v) and at shaking speeds of 120 rpm, 150 rpm, 180 rpm, 210 rpm, and 240 rpm for 24 h. The residual malic acid and total flavonoid content in the sea buckthorn juice were measured. The effect of shaking speed on the reduction of malic acid in Pichia sp. WJL-M4 and on changes in flavonoid content was investigated. The results are as follows: Figure 13 As shown. By Figure 13 It is evident that Pichia sp. WJL-M4 exhibits good acid reduction effects at fermentation speeds of 120–240 rpm, with acid reduction rates ranging from 74.56% to 85.91%, and a significant increase in total flavonoid content of 25.98%–58.71%. This indicates that the malic acid reduction rate is consistently high after 24 hours of fermentation, and the acid reduction rate is 82.42%–85.91% at fermentation speeds of 150–210 rpm.

[0153] Example of sea buckthorn juice preparation

[0154] Combination Figure 14 The flowchart in this embodiment illustrates a method for preparing sea buckthorn juice, comprising:

[0155] Step 1: Providing de-oiled sea buckthorn juice. This step involves juicing the sea buckthorn berries and removing the seeds. The oil can be removed using conventional methods (generally, the oil content is about 27-30% by mass), such as using a horizontal centrifuge to separate the oil from the sea buckthorn juice using centrifugal force. Sea buckthorn juice prepared using this de-oiled juice is more stable, and the optimization process for various test indicators is more consistent.

[0156] Step 2: Using Pichia sp. WJL-M4 and sea buckthorn deoiled juice, ferment for 24 hours at a temperature of 25℃, an inoculum size of 5%, a rotation speed of 180 rpm, and a liquid volume of 12%.

[0157] Step 3: After post-processing, sea buckthorn juice is obtained. Existing processes can be used to further process the fermented sea buckthorn juice to meet the requirements. Post-processing includes, but is not limited to, sterilization, filtration and other operations.

[0158] Sensory evaluation comparison

[0159] Sensory evaluations were conducted on pasteurized, non-degraded sea buckthorn oil and the sea buckthorn juice obtained through the preparation example described above. The evaluations considered appearance, color, flavor, taste, and overall acceptability. The sensory evaluation criteria are shown in Table 4, and the sensory evaluation results are as follows: Figure 15 As shown. By Figure 15 It can be seen that the scores for taste, appearance, color, flavor, and overall acceptability of the un-acidified sea buckthorn de-oiled juice were 8.60±1.17, 16.30±1.49, 15.30±1.16, 5.10±0.87, and 10.30±1.49, respectively. The scores for taste, appearance, color, flavor, and overall acceptability of the de-acidified sea buckthorn juice were 16.00±1.56, 17.50±1.65, 17.10±1.60, 18.20±1.03, and 15.10±1.45, respectively. The total sensory evaluation scores before and after deacidification were 55.60±4.60 and 84.00±6.79, respectively. It is evident that the application of Pichia sp. WJL-M4 in the deacidification fermentation of malic acid in sea buckthorn significantly improves the taste, flavor, and overall acceptability, and also enhances the appearance and color. However, it does not drastically alter the original color and appearance of the sea buckthorn juice. Therefore, the application of Pichia sp. WJL-M4 in the deacidification fermentation of malic acid in sea buckthorn has advantages such as high fermentation efficiency, rapid deacidification speed, good deacidification effect, significantly increased total flavonoid content, significantly improved taste, flavor, and overall acceptability of sea buckthorn juice, and significantly improved sensory scores, demonstrating great market application potential. In practical fermentation applications, fermentation parameters can be appropriately selected according to the situation to achieve better fermentation results.

[0160] Table 4 Sensory evaluation criteria for sterilized, undegraded sea buckthorn oil-free juice and fermented sea buckthorn juice

[0161]

[0162] The determination methods used in this application are as follows:

[0163] (1) OD 600 Determination: The absorbance of the bacterial solution at a wavelength of 600 nm was measured by spectrophotometry to represent the amount of bacterial growth.

[0164] (2) Determination of total acid and pH: Total acid was determined by NaOH titration in GB / T 12456-2008 and expressed as malic acid; pH was determined by pH meter.

[0165] (3) Determination of organic acids such as quinic acid and malic acid: High performance liquid chromatography (HPLC) was used. HPLC conditions were as follows: column: Agilent ZORBAX Extend-C18 (250 mm × 4.6 mm); mobile phase A: mobile phase B volume ratio: 97:3; mobile phase A was a KH₂PO₄ aqueous solution with pH = 2.5 (KH₂PO₄ to water volume ratio: 0.5 g: 100 mL); mobile phase B was methanol; HPLC conditions: isocratic elution for 10 min; flow rate: 0.7 mL / min; injection volume: 10 μL; column temperature: 35℃; detection wavelength: 210 nm. Standard mixtures and samples were measured sequentially. A standard curve was constructed using the standard concentration versus peak area, and the organic acid content in the samples was calculated using the external standard method.

[0166] Standard curve: Organic acid single standard and mixed standard solutions of different concentrations were prepared by dissolving in pure water, filtered through a 0.22 μm microporous membrane and analyzed by HPLC to obtain the regression equation and correlation coefficient of peak area (x) and organic acid mass concentration (y).

[0167] Sample preparation: Centrifuge the sample (8000 rpm, 5 min), transfer the supernatant to a volumetric flask, dilute to volume with distilled water, mix well, and dilute to the appropriate concentration. Filter through a 0.22 μm filter membrane before analysis. Each sample was tested three times. Organic acids were qualitatively identified using peak elution time, and their content was calculated by substituting peak area into the standard curve.

[0168] (4) Determination of total flavonoids: Rutin standard stock solution (0.2 mg / mL): Accurately weigh 0.01 g of rutin standard (accurate to 0.0001 g), dissolve it in 60% (v / v) ethanol aqueous solution and dilute to 50.0 mL in a brown volumetric flask, shake well and prepare a 0.2 mg / mL standard stock solution.

[0169] Pipettes of 0 mL, 0.5 mL, 1.0 mL, 1.5 mL, 2.0 mL, 2.5 mL, and 3.0 mL of rutin standard stock solution (0.200 mg / mL) into 10.0 mL volumetric flasks, respectively. Then, add 0.5 mL of 50 g / L sodium nitrite solution, mix well, and let stand for 6 min. Next, add 0.5 mL of 100 g / L aluminum nitrate solution, mix well, and let stand for 6 min. Finally, add 5.0 mL of 40 g / L sodium hydroxide solution and shake well. Finally, dilute to volume with 60% (v / v) ethanol aqueous solution, mix thoroughly, and obtain a standard series mixture. Let the mixture stand for 15 min, and measure the absorbance at a wavelength of 508 nm. Plot a standard curve with rutin mass concentration ρ (mg / L) on the x-axis and the corresponding absorbance value A on the y-axis to obtain the standard curve regression equation.

[0170] Take 1 mL of each juice sample before and after fermentation and transfer them to 10 mL centrifuge tubes. Add 4 mL of 60% ethanol (v / v). Place the centrifuge tubes in a constant temperature water bath at 70°C for 4 hours to ensure complete extraction. Centrifuge at 8000 rpm for 5 minutes, then collect 2 mL of the supernatant. Add 0.5 mL of 50 g / L sodium nitrite, mix well, and let stand for 6 minutes. Add 0.5 mL of 100 g / L aluminum nitrate solution, mix well, and let stand for 6 minutes. Add 5.0 mL of 40 g / L sodium hydroxide solution and shake well. Finally, dilute to volume with 60% (v / v) ethanol aqueous solution, mix well, and let the mixture stand for 15 minutes. Measure the absorbance at a wavelength of 508 nm. Substitute the absorbance value into the standard curve for calculation.

[0171] (5) Determination of acid reduction rate:

[0172]

[0173] In the formula, A0 is the mass concentration of total acid or malic acid in the sample before acid reduction; A1 is the mass concentration of total acid or malic acid in the sample after acid reduction.

[0174] (6) Viable cell count determination: The dilution plating method was used. 1 mL of the test solution was diluted 7 times with 9 mL of sterile water. 0.2 mL of the 6th and 7th dilutions were evenly spread onto YPD solid medium plates using a sterile spreader, ensuring uniform distribution of the diluted test solution on each YPD solid medium plate. The spread YPD solid medium plates were inverted and incubated at 30℃ for 48 hours. YPD solid medium plates with colony counts between 30 and 300 were counted, and the viable cell count in the test solution was calculated based on the dilution factor.

[0175] The composition of YPD solid medium is as follows: per liter of distilled water, add: 10g yeast extract, 20g peptone, 20g glucose, and 25g agar powder. The preparation method of YPD solid medium is as follows: dissolve all the components of YPD solid medium except glucose in 800mL of distilled water and stir well; dissolve 20g of glucose in another 200mL of distilled water; sterilize separately, cool to 50-60℃, mix well, and pour into plates to prepare YPD solid medium.

[0176] The above embodiments are some embodiments of this application. In addition to the above embodiments, this application also includes other implementation methods within the range of fermentation culture parameter values. Any adjustments made without departing from the essence and principle of this application are equivalent or equivalent substitution methods, and the resulting technical solutions are still within the protection scope of this application.

Claims

1. A Pichia pastoris strain, characterized in that, The Pichia pastoris strain is Pichia pastoris ( Pichia sp. WJL-M4, with accession number CGMCC No.30666.

2. A fermentation agent, characterized in that, The fermentation agent comprises the Pichia pastoris strain as described in claim 1.

3. The application of a Pichia pastoris strain, characterized in that, The Pichia pastoris strain is Pichia pastoris ( Pichia sp. The Pichia pastoris strain WJL-M4, with accession number CGMCC No.30666, is used to prepare sea buckthorn juice.

4. The application as described in claim 3, characterized in that, The Pichia pastoris strain is tolerant to quinic acid and can degrade malic acid.

5. The application as described in claim 3, characterized in that, The Pichia pastoris strain was inoculated during the preparation of sea buckthorn juice.

6. The application as described in claim 5, characterized in that, In the preparation of sea buckthorn juice, the Pichia pastoris strain is inoculated into the deoiled sea buckthorn juice in the form of seed liquid, wherein the viable cell count in the seed liquid is 5~10×10⁻⁶. 7 CFU / mL.

7. The application as described in claim 5, characterized in that, After inoculation with the Pichia pastoris strain, fermentation should be carried out for at least 24 hours.

8. The application as described in claim 5, characterized in that, After inoculation with the Pichia pastoris strain, fermentation was carried out at 22-31°C.

Images