Engineering bacterium of recombinant soluble TRAIL protein, expression and purification method and application thereof

By constructing recombinant soluble TRAIL protein engineering bacteria and optimizing the expression and purification methods, the stability and activity problems of TRAIL protein expression in Escherichia coli were solved, and the preparation of high-purity and high-activity recombinant protein was achieved, thereby improving its application effect in anti-tumor drugs and 4T1 cell inhibitors.

CN120648635APending Publication Date: 2025-09-16QIANXINAN BUYEI & MIAO AUTONOMOUS PREFECTURE PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510797896.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

In the existing technology, natural TRAIL protein has a short half-life and poor stability, and needs to be in a polymeric form to exert its activity. When expressed in Escherichia coli, it often faces problems such as inclusion body formation, misfolding and low solubility, which limits its clinical application.

Method used

The recombinant soluble TRAIL protein was constructed using the pET-32a(+) vector and Escherichia coli BL21(DE3). The expression was induced by IPTG and purified using a Ni-NTA affinity column. The induction conditions and purification process were optimized to ensure high yield and high purity of the recombinant soluble TRAIL protein.

Benefits of technology

A high-purity, high-bioactive recombinant soluble TRAIL protein was obtained, which significantly improved its application effect in the preparation of anti-tumor drugs and 4T1 cell in vitro growth inhibitors, and its anti-tumor activity was significantly higher than that of commercially available proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648635A_ABST
    Figure CN120648635A_ABST
Patent Text Reader

Abstract

The invention provides an engineering bacterium of a recombinant soluble TRAIL protein, an expression and purification method and application thereof, and belongs to the technical field of gene engineering. The method comprises the following steps: inserting a TRAIL gene between Nde I and Xho I restriction enzyme cutting sites of a pET-32a (+) vector to construct a recombinant plasmid; and transferring the recombinant plasmid into escherichia coli BL21 (DE3) to obtain an engineering bacterium for expressing the recombinant soluble TRAIL protein. The invention further provides an expression and purification method of the recombinant soluble TRAIL protein based on the engineering bacterium, the yield of the recombinant soluble TRAIL protein is improved by optimizing induction conditions, the recombinant soluble TRAIL protein with high purity and high biological activity is obtained by optimizing purification conditions, and support is provided for clinical application of the recombinant soluble TRAIL protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to an engineering bacterium for recombinant soluble TRAIL protein, an expression and purification method and an application thereof. Background Art

[0002] Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL), a member of the tumor necrosis factor superfamily, selectively induces apoptosis in cancer cells by binding to death receptors DR4 / DR5 and activating the extrinsic apoptosis pathway. This gives TRAIL significant anti-tumor potential, particularly against drug-resistant tumors, and has become a hot topic in anti-tumor research. However, native TRAIL exists as a type II transmembrane protein. Its soluble form (sTRAIL) relies on protease cleavage or genetic recombination to release the extracellular domain. The trimeric conformation of sTRAIL is essential for receptor binding and triggering apoptotic signaling, and the native protein is easily depolymerized and inactivated in vivo. Consequently, limitations of native TRAIL, such as its short half-life, poor stability, and requirement for a multimeric form for activity, have limited its clinical application. Therefore, the construction of recombinant sTRAIL through genetic engineering techniques and the optimization of its expression and purification processes have become key approaches to overcome this bottleneck. sTRAIL is a complex multimeric protein, and its expression in E. coli often faces problems such as inclusion body formation, misfolding, and low solubility. Therefore, how to enhance its stability and bioactivity through molecular design has become a core issue in the development of recombinant sTRAIL. Summary of the Invention

[0003] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide an engineered bacterium for expressing recombinant soluble TRAIL protein, which can be used to express recombinant soluble TRAIL protein.

[0004] The present invention also aims to provide a method for expressing and purifying a recombinant soluble TRAIL protein, which can obtain a recombinant soluble TRAIL protein with high purity and high biological activity.

[0005] The present invention also aims to provide the use of the above-mentioned engineered bacteria or the above-mentioned expression and purification method of the recombinant soluble TRAIL protein in the preparation of recombinant soluble TRAIL protein, the preparation of anti-tumor drugs or the preparation of 4T1 cell in vitro growth inhibitors.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides an engineered bacterium for expressing a recombinant soluble TRAIL protein. The construction method of the engineered bacterium comprises: inserting a TRAIL gene between the Nde I and Xho I restriction sites of a pET-32a(+) vector to construct a recombinant plasmid; and transforming the recombinant plasmid into Escherichia coli BL21(DE3) to obtain the engineered bacterium.

[0008] Preferably, the nucleotide sequence of the TRAIL gene is shown as SEQ ID No.1.

[0009] The present invention also provides a method for expressing and purifying a recombinant soluble TRAIL protein, comprising the following steps: inducing the above-mentioned engineering bacteria to express the protein using IPTG; and obtaining a crude protein sample and purifying it using a Ni-NTA affinity column.

[0010] Preferably, the induction concentration of IPTG is 1.2-1.8 mM, the induction time is 8-12 h, and the induction temperature is 15-17°C.

[0011] Preferably, the method for obtaining the crude protein sample comprises: adding a lysis solution to the engineered bacterial cells after IPTG induction, ultrasonically disrupting the cells in an ice bath, and centrifuging to obtain the crude protein sample.

[0012] Preferably, the Ni-NTA affinity column purification method comprises: washing the affinity column with 20 mM, 50 mM and 100 mM imidazole washing buffers in sequence, collecting the eluate of 100 mM fraction, and dialyzing the eluate to remove salts.

[0013] Preferably, the eluate dialysis desalination method includes: the eluate and the dialysate are dialyzed at a volume ratio of 1:(50-1000), the molecular weight of the dialysis bag is 14000Da; the dialysate is a PBS solution, the dialysis time is 48-72h; and the dialysis temperature is 0-5°C.

[0014] The present invention also provides the use of the above-mentioned engineering bacteria or the above-mentioned expression and purification method of the recombinant soluble TRAIL protein in the preparation of the recombinant soluble TRAIL protein.

[0015] The present invention also provides the use of the above-mentioned engineering bacteria or the above-mentioned expression and purification method of the recombinant soluble TRAIL protein in the preparation of anti-tumor drugs.

[0016] The present invention also provides the use of the above-mentioned engineering bacteria or the above-mentioned expression and purification method of the recombinant soluble TRAIL protein in the preparation of a 4T1 cell in vitro growth inhibitor.

[0017] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0018] This invention uses pET-32a(+) as a vector and Escherichia coli BL21(DE3) as an expression host. A His tag is fused to the C-terminus of the target protein to construct an engineered bacterium that stably expresses recombinant soluble TRAIL protein. The selection of the expression vector and host cell line directly influences the yield, cost, and activity of the recombinant soluble TRAIL protein. The recombinant soluble TRAIL protein obtained through induced expression exhibits integrity and high functional activity.

[0019] The present invention further optimizes the expression and purification methods of recombinant soluble TRAIL protein, increases the yield of recombinant soluble TRAIL protein by optimizing induction conditions, and obtains recombinant soluble TRAIL protein with high purity and high biological activity by optimizing purification conditions, providing support for the clinical application of recombinant soluble TRAIL protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Plasmid map constructed with pET-32a(+) as vector;

[0021] Figure 2 : Gel electrophoresis of the target gene obtained after PCR amplification;

[0022] Figure 3 : Colony PCR identification results;

[0023] Figure 4 : Gel electrophoresis of positive plasmid after double enzyme digestion;

[0024] Figure 5 : Monoclonal colonies by plate streak method;

[0025] Figure 6 :The effect of different IPTG concentrations on the expression level of recombinant protein;

[0026] Figure 7 :The effect of different induction times on the expression level of recombinant protein;

[0027] Figure 8 : Recombinant protein expression levels at different IPTG concentrations;

[0028] Figure 9 : Recombinant protein expression levels at different induction times;

[0029] Figure 10 : Gel electrophoresis of recombinant protein purified by eluents of different concentrations;

[0030] Figure 11 : WB verification results of the recombinant protein prepared by the present invention and the commercially available protein;

[0031] Figure 12: DEC-HPLC profiles of BSA and sTRAIL;

[0032] Figure 13 : The inhibitory effect of the recombinant protein prepared by the present invention on 4T1 cells. DETAILED DESCRIPTION

[0033] The present invention provides an engineered bacterium that expresses a recombinant soluble TRAIL protein. The construction method of the engineered bacterium comprises: inserting a TRAIL gene between the Nde I (CATATG) and Xho I (CTCGAG) restriction sites of a pET-32a(+) vector to construct a recombinant plasmid; and transforming the recombinant plasmid into Escherichia coli BL21(DE3) to produce the engineered bacterium. The nucleotide sequence of the TRAIL gene of the present invention is shown in SEQ ID No. 1.

[0034] The present invention uses a pET-32a (+) vector with multiple cloning sites to construct a recombinant plasmid. As an optional embodiment, the present invention uses Nde I and Xho I restriction endonucleases to perform double digestion of the vector and the target gene (TRAIL gene), and separates the digestion products by agarose gel electrophoresis. Subsequently, a gel recovery kit is used for purification and recovery to obtain a highly purified digestion vector and target gene fragment, effectively eliminating the interference of impurities on subsequent experiments. The present invention uses DNA ligase to carry out a ligation reaction between the purified and recovered vector and target gene fragment to obtain a ligation product. The ligation product is transformed into Escherichia coli TOP 10 competent cells by heat shock transformation and evenly coated on LB solid culture medium plates containing ampicillin for screening. Single colonies grown on the plates are cultured in liquid, and the plasmid in the transformant is extracted by alkaline lysis. The digestion product bands are analyzed by agarose gel electrophoresis to determine whether the recombinant plasmid construction is successful.

[0035] The present invention uses Escherichia coli BL21 (DE3) as the expression host, and the successfully constructed recombinant plasmid is transformed into E. coli BL21 (DE3) competent cells via heat shock transformation. As an optional embodiment, the present invention prepares E. coli BL21 (DE3) competent cells, transforms the recombinant plasmid into the E. coli BL21 (DE3) competent cells via heat shock transformation, and cultured in antibiotic-free LB liquid medium. The cultured bacterial liquid is then spread onto LB solid medium plates containing ampicillin for screening to obtain single colonies of the engineered bacteria.

[0036] The present invention also provides a method for expressing and purifying a recombinant soluble TRAIL protein, comprising the following steps: inducing the above-mentioned engineering bacteria to express the protein using IPTG; and obtaining a crude protein sample and purifying it using a Ni-NTA affinity column.

[0037] As an optional embodiment, the present invention inoculates a single colony of the engineered bacteria into an LB liquid culture medium containing ampicillin and cultures it to the logarithmic growth phase, and then adds IPTG to induce the engineered bacteria to express protein.

[0038] Preferably, the induction concentration of IPTG of the present invention is 1.2-1.8 mM, more preferably 1.3 mM, 1.4 mM, 1.5 mM, 1.6 mM or 1.7 mM; the induction time of IPTG of the present invention is 8-12 hours, more preferably 9 hours, 10 hours or 11 hours; the induction temperature of IPTG of the present invention is 15-17°C, preferably 16°C. The present invention improves the yield of sTRAIL protein by optimizing the induction expression conditions, and low-temperature induction at 15-17°C obtains a higher proportion of soluble protein.

[0039] The present invention collects and lyses the bacteria after the induction is completed, and separates the soluble part of the engineered bacteria by ultrasonic disruption to obtain a crude protein sample. Preferably, the method for obtaining the crude protein sample of the present invention comprises: adding a lysis solution to the engineered bacteria cells after IPTG induction, ultrasonically disrupting them in an ice bath, and centrifuging to obtain a crude protein sample. The lysis solution is a buffer solution containing protease inhibitors and lysozyme. The conditions for the ultrasonic disruption are preferably: power 200W, working cycle of ultrasonic 1 second / interval 2 seconds, and total ultrasonic duration of 30 minutes (actual effective ultrasonic time 10 minutes). The conditions for the centrifugation are preferably: 4°C, 12000×g centrifugation for 30 minutes.

[0040] The crude protein sample obtained in the present invention is then purified using a Ni-NTA affinity column. Preferably, the Ni-NTA affinity column purification method of the present invention comprises: washing the affinity column with 20mM, 50mM, and 100mM imidazole wash buffers in sequence, collecting the 100mM eluate, and dialyzing the eluate to remove salts. As an optional embodiment, the crude protein sample and eluate described in the present invention are loaded into an affinity column through a peristaltic pump; the crude protein sample is circulated and loaded under an ice bath, and the peristaltic pump is operated at 20 rpm during loading, so that the His tag of the target protein is bound to the nickel ions on the Ni-NTA resin; the peristaltic pump is operated at 60 rpm when loading the 20mM and 50mM eluates, and 30 times the column volume of eluate is added for each concentration to remove non-specifically bound miscellaneous proteins; the peristaltic pump is operated at 30 rpm when loading the 100mM eluate, and 20 times the column volume of eluate is added for each concentration, and the recombinant soluble TRAIL protein is present in the obtained eluate, and the purity of the obtained recombinant soluble TRAIL protein is greater than 95%, ensuring the high purity and high activity of the recombinant soluble TRAIL protein.

[0041] Preferably, the eluate dialysis desalination method comprises: dialyzing the eluate and dialysate at a volume ratio of 1:(50-1000), with the molecular weight of the dialysis bag being 14,000 Da; the dialysate being a PBS solution; the dialysis time being 48-72 hours; and the dialysis temperature being 0-5°C. The volume ratio of the present invention is preferably 1:(100-800) or 1:(200-600) or 1:(300-500); the PBS solution is preferably a 1 mM PBS solution; the dialysis temperature is preferably 3-4°C; and the dialysate is preferably replaced every 6-12 hours. The present invention gradually reduces the salt concentration by using a low-concentration buffer solution to avoid the precipitation of macromolecules. The present invention performs dialysis at 0-5°C to prevent and control protein degradation. The present invention preferably centrifuges the dialyzed protein solution (10,000 rpm, 10 minutes) to remove any remaining precipitates or impurities, or concentrates the protein by ultracentrifugation.

[0042] The present invention also provides the use of the above-mentioned engineered bacteria or the above-mentioned expression and purification method of the recombinant soluble TRAIL protein in the preparation of recombinant soluble TRAIL protein. The prepared recombinant soluble TRAIL protein has high purity (purity greater than 95%), complete structural characteristics and high biological activity.

[0043] The present invention also provides the use of the aforementioned engineered bacteria or the aforementioned expression and purification methods of the recombinant soluble TRAIL protein in the preparation of an anti-tumor drug, wherein the anti-tumor drug comprises the recombinant soluble TRAIL protein prepared by the present invention as an active ingredient. The recombinant soluble TRAIL protein prepared by the present invention retains the activity of inducing apoptosis in tumor cells and exhibits significantly higher anti-tumor activity than existing commercially available recombinant soluble TRAIL proteins, targeting tumors including, but not limited to, breast cancer.

[0044] The present invention also provides the use of the above-mentioned engineered bacteria or the above-mentioned expression and purification method of the recombinant soluble TRAIL protein in the preparation of a 4T1 cell in vitro growth inhibitor, wherein the 4T1 cell in vitro growth inhibitor uses the recombinant soluble TRAIL protein prepared by the present invention as an active ingredient. The recombinant soluble TRAIL protein prepared by the present invention has obvious inhibitory activity on 4T1 cells, and its IC 50 The total amount of TRAIL protein was 77.6 ng, which was significantly better than the existing commercially available recombinant soluble TRAIL protein.

[0045] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0046] The culture medium and main reagents in the embodiment of the present invention are prepared as follows:

[0047] LB liquid medium: Weigh 5 g yeast extract, 10 g sodium chloride, and 10 g tryptone into 800 mL of deionized water and dissolve by sonication. Once completely dissolved, adjust the volume to 1 L. Sterilize by high-temperature steam sterilization at 121°C for 30 min. After returning to room temperature, add ampicillin to a final concentration of 50 μg / mL and mix thoroughly.

[0048] LB solid medium: Weigh 1.5 g agar powder into 100 mL LB liquid medium and mix thoroughly. Autoclave at 121°C for 30 min. Once the temperature returns to approximately 40°C, add ampicillin to a final concentration of 50 μg / mL, mix thoroughly, and transfer to a culture dish.

[0049] Bacterial lysis solution: Weigh 0.24 g Tris and 1.17 g NaCl, add 80 mL deionized water to dissolve, add 5 mL 5% NP40 solution and 2.5 mg PMSF, and adjust the volume to 100 mL.

[0050] Imidazole eluent: Weigh 29.22 g NaCl, 2.42 g Tris, and 34.04 g (or 1.36 g, or 3.40 g, or 6.81 g, or 17.02 g) imidazole, add 800 mL deionized water to dissolve, and after complete dissolution, adjust the volume to 1 L. Filter through a 0.45 μm filter to obtain a 500 mM (or 20 mM, or 50 mM, or 100 mM, or 250 mM) imidazole eluent.

[0051] DMEM complete medium: Add 100 pg / mL streptomycin sulfate and 100 U / mL ampicillin to DMEM culture medium, add fetal bovine serum at a volume ratio of 9:1, filter sterilize with a 0.22 μm disposable syringe filter, and store in a refrigerator at 4°C until use.

[0052] PBS: Accurately weigh 2.90 g Na₂HPO₄·12H₂O, 0.2 g KH₂PO₄, 0.2 g KCl, 8.0 g NaCl, and 0.2 g EDTA. Dissolve in 800 mL of deionized water and then adjust the volume to 1 L. Autoclave at 121°C for 30 min.

[0053] Trypsin digestion solution: Accurately weigh 0.25 g of trypsin, dissolve it in PBS, add 0.1 mol / L EDTA, make up to 100 mL with PBS, filter sterilize with a 0.22 μm filter membrane, and store in a refrigerator at 4°C.

[0054] In the embodiments of the present invention, the reagents and their purchase sources are: His-tag antibody (Bai Ke Sai Si Biotechnology Co., Ltd.); protein marker (Wuhan Sai Weier Biotechnology Co., Ltd.); ampicillin (Nanjing Jingge Chemical Technology Co., Ltd.); tryptone (Shanghai Sangon Biotechnology Co., Ltd.); agar powder (Shanghai Sangon Biotechnology Co., Ltd.); sodium chloride (Shanghai Sangon Biotechnology Co., Ltd.); yeast extract (Anhui Zesheng Technology Co., Ltd.); IPTG (Beijing Inokai Technology Co., Ltd.); imidazole (Shanghai Titan Technology Co., Ltd.); hammer super bacteria solution (Changzhou Boyi Biotechnology Co., Ltd.); rapid protein-free blocking solution (Changzhou Boyi Biotechnology Co., Ltd.); instant SDS-PAGE loading buffer (Affinity Life Technology Co., Ltd.); polyacrylamide protein gel rapid staining solution (Changzhou Boyi Biotechnology Co., Ltd.), ultrasensitive ECL luminescent solution (Affinity Life Technology Co., Ltd.); protein agarose-nickel ion purification resin (Jiangsu Qianzhusong Biotechnology Co., Ltd.).

[0055] In the following examples, unless otherwise specified, all methods are conventional.

[0056] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0057] Example 1

[0058] 1. Plasmid construction (plasmid map such as Figure 1 shown)

[0059] General Biotechnology (Anhui) Co., Ltd. (File No. G0300465) was commissioned to use pET-32a(+) as a vector containing a His tag, and the TRAIL gene (SEQ ID No. 1) was inserted at the Nde I (CATATG) and Xho I (CTCGAG) restriction sites to obtain a recombinant plasmid.

[0060] Design: Based on the target sequence of G0300465-1 (TRAIL gene SEQ ID No. 1), a mixed primer was designed. The G0300465-1 fragment product was first synthesized by PCR amplification, and then the G0300465-1 PCR fragment amplification product was ligated into the Xho I-Nde I site of pET-32a(+) by recombination ligation to obtain the full-length product.

[0061] PCR amplification: Primers were designed and synthesized based on the gene sequence (primer sequence information is shown in Table 3; the primer concentration used for amplification was 20 pmol / μL). PCR amplification was performed using the synthesized primers to obtain the G0300465-1 PCR amplification product. This product was then detected by gel electrophoresis, and the position of the electrophoretic band was compared with the marker. The size of the amplified product was consistent with the theoretical value, confirming that the G0300465-1 gene was correctly amplified.

[0062] Table 1 PCR amplification system and procedure

[0063]

[0064]

[0065] Table 2 PCR amplified fragment sizes

[0066] Clip Name Use primers Size (bp) G0300465-1 G0300465-1_1~G0300465-1_12 594

[0067] Table 3 Primer sequences

[0068]

[0069] The target gene obtained after PCR amplification was detected by gel electrophoresis. Figure 2 The results showed that the target gene obtained after PCR amplification was approximately 594 bp in size, which was consistent with the predicted fragment size.

[0070] Gene assembly and transformation: pET-32a(+) (275 ng / μL) was digested with Nde I and Xho I endonucleases. The mixed solution was placed in a 37°C constant temperature water bath for reaction for 60 min and then removed. The pET-32a(+) linearized vector was recovered using PCR-A solution (see Table 4 for the vector enzyme digestion system). The G0300465-1 PCR amplification product was then ligated to the Xho I-Nde I sites of the pET-32a(+) linearized vector. Finally, the ligation product was transformed into Escherichia coli Top10, plated onto ampicillin-resistant plates, and cultured overnight at 37°C. Bacterial screening was performed the next day.

[0071] Table 4 Ligation transformation system

[0072]

[0073] Positive clone screening: After the plate colonies grow, pick 8 single clones, add culture medium and culture to recover, use SEQ ID No.14 (AATTTTGTTTAACTTTAAGAAGGAGATATACATATGCCCAGAGGTGGAAGACCTCAGAAAGTGG) and SEQ ID No.15 (AGCCGGATCTCAGTGGTGGTGGTGGT GCTCGAGGTTAATTAAAAAGGCTCCAAAGAAG) as primers for colony PCR amplification, screen out the positive single clone G0300465-1, take the amplified product for gel electrophoresis detection, the amplified band size is consistent with the theoretical value, the result is as follows Figure 3 The second clone, numbered MF86261, was selected for sequencing and enzyme digestion analysis.

[0074] Table 5 Colony PCR reaction system and procedure

[0075]

[0076] Plasmid extraction and sequencing verification: The MF86261 clone was inoculated into rich medium and cultured overnight at 37°C. The next day, the cells were harvested and plasmids were extracted using a kit. A sequencing primer (SEQ ID No. 16: TGCTAGTTATTGCTCAGCGG) was used to amplify the plasmid. After magnetic bead precipitation, base analysis was performed on a 3730XL sequencer. The results were exported and aligned with the target gene sequence to confirm that the sequencing results of the MF86261 clone were completely consistent with the theoretical sequence.

[0077] Table 6 Plasmid extraction and amplification reaction conditions

[0078]

[0079] Enzyme digestion identification: The plasmid concentration of the test sample was 256 ng / μL, A 260 / 280 =1.895, restriction enzymes XhoⅠ-ApaⅠ were selected for plasmid digestion according to gene construction information, and the plasmid was detected by gel electrophoresis (the results are shown in FIG. Figure 4 The band size was consistent with the theoretical value (1562 / 4334 bp).

[0080] Table 7 Plasmid enzyme digestion reaction system

[0081]

[0082] 2. Inducible expression of recombinant protein

[0083] 2.1. Transformation of recombinant plasmid into BL21(DE3) competent cells

[0084] First, remove the cryovial containing competent cells from the -80°C freezer and quickly place on ice to slowly thaw for 12 minutes. Once the cells are completely thawed, slowly add the plasmid solution to the cell suspension at a plasmid-to-cell suspension volume ratio of 1:10 and a plasmid concentration of 100 ng / μL. Mix thoroughly by slowly pipetting the tube along the wall 3-5 times. Incubate the mixture on ice for another 30 minutes to allow the plasmid DNA to form a stable complex with the cell membrane. Next, quickly transfer the tube to a 42°C water bath and heat shock for 50 seconds to promote DNA uptake. Immediately after the heat shock, return the tube to the ice bath and let it rest for 2 minutes to stabilize the cell membrane structure. Then, add 600 μL of preheated antibiotic-free LB medium (preheated at 37°C), seal with parafilm, and incubate in a shaker at 37°C, 225 rpm, for 50 minutes.

[0085] 2.2. Optimization of recombinant protein expression conditions

[0086] 2.2.1 Bacterial culture and single colony isolation

[0087] In a sterile operating table, use a micropipette to draw 20 μL of bacterial solution and add it dropwise to A +The surface of the LB agar plate with resistance. The four-zone streak method is used for gradient dilution: first, lightly touch the sterilized inoculation loop to one end of the plate and draw a tight initial area in the same direction (approximately 1 / 4 of the plate area). This process does not require scratching the agar surface. Then place the inoculation loop in the flame of an alcohol lamp to burn and sterilize it. After cooling for about 15 seconds, extend the second area from the end of the first area (covering about 1 / 2 of the plate area). The two intervals retain about 1 / 4 overlapping area to transfer bacteria. After repeated burning, make a third streak from the end of the second area (covering the remaining 3 / 4 area), and finally achieve single cell separation through a sparse fourth zone streak. After streaking, place the plate upside down in a 37°C constant temperature incubator and incubate for 15 hours. Positive transformants are screened by observing the colony morphology.

[0088] Plate streak method monoclonal colonies Figure 5 As shown, the bacteria were viable and able to form dispersed single colonies.

[0089] 2.2.2 Bacterial amplification and induced expression

[0090] Pick a single circular colony with a diameter of 1-2 mm and inoculate it into 5 mL LB liquid medium containing 50 μg / mL ampicillin. Place it in a 37°C constant temperature shaker at 200 rpm for 12 hours to complete the pre-culture. Then transfer it to fresh LB medium at a ratio of 1:100 for expansion culture and continuously monitor the OD 600 When the value reached the logarithmic growth phase, different final concentrations (0.4, 0.8,

[0091] Protein induction was initiated with 1.2, 1.8, and 2.4 mM IPTG solutions. The culture system was transferred to a 16°C low-temperature shaker and cultured at 200 rpm for 4, 8, 12, 18, and 24 h, respectively.

[0092] 2.2.3. Bacteria collection and lysis

[0093] After induction, the bacterial solution was transferred to a pre-cooled centrifuge tube and centrifuged at 4°C and 10,000×g for 10 minutes to collect the bacterial pellet. Gently resuspend and wash twice with pre-cooled PBS buffer (pH 7.4) to thoroughly remove the residual culture medium. Add the bacterial lysis solution to the washed bacteria at a ratio of 1g:10mL and perform ultrasonic disruption under ice bath conditions: use a 5mm diameter metal probe, set the power to 200W, the working cycle is ultrasonic 1 second / interval 2 seconds, and the total duration is 30 minutes (the actual effective ultrasonic time is about 10 minutes). Keep the sample in an ice bath during this period. After the disrupted liquid is centrifuged at 4°C and 12,000×g for 30 minutes, collect the supernatant as a crude protein sample.

[0094] Uninduced bacteria were treated with the same lysis method as a control.

[0095] 2.2.4 Protein denaturation and electrophoresis analysis

[0096] The crude protein samples were separated by electrophoresis using a 12% separation gel SDS-PAGE system:

[0097] Gel preparation: Mix 30% acrylamide / bisacrylamide stock solution (29:1), 1.5M Tris-HCl (pH 8.8), 10% SDS, and deionized water in the appropriate ratio. Then, add 10% ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) in that order. For example, to prepare 10mL of 12% separating gel: 4mL acrylamide stock solution, 3.8mL Tris-HCl, 150μL SDS, 2mL water, and finally, 100μL APS and 10μL TEMED. Mix quickly and then slowly pour the gel into the mold along the inner wall of the glass plate to a depth of 1.5cm from the top. Immediately cover with 1mL of isopropanol to isolate the gel from oxygen. Let stand at room temperature for 25 minutes until the gel is fully polymerized (clear refractive lines appear at the interface). After the separating gel solidifies, the isopropanol overlay is removed. A stacking gel prepared with 5% acrylamide (1.3 mL acrylamide stock solution, 1 mL 1.0 M Tris-HCl (pH 6.8), 75 μL SDS, 3.5 mL water, 50 μL APS, and 5 μL TEMED) is mixed thoroughly and quickly injected onto the separating gel. A 15-well comb is inserted (to avoid air bubbles). Polymerize at room temperature for 15 minutes. After removing the comb, regular sample wells are formed. Rinse the wells with deionized water to remove any unpolymerized gel.

[0098] Sample Preparation: Mix the protein sample to be tested with 4× reducing loading buffer (containing 2% SDS, 10% glycerol, 0.02% bromophenol blue, 100 mM DTT or 5% β-mercaptoethanol) in a 3:1 ratio. Heat in a boiling water bath for 10 minutes to fully open the protein disulfide bonds and encapsulate the negative charge. A protein marker standard and uninduced bacterial lysate were also prepared as controls.

[0099] Electrophoresis run: Install the gel plate vertically into the electrophoresis tank, ensure that the inner and outer tanks are aligned, add 1× Tris-glycine-SDS running buffer (25mM Tris, 192mM glycine, 0.1% SDS), and the liquid surface of the inner tank must cover the sample loading wells. Use a microinjector to load samples in sequence. The total loading volume of each well is controlled at 10μL according to the protein concentration. Add 4μL of premixed standard to the marker well. When loading, the tip of the gun tip must be deep into the bottom of the well to avoid sample overflow and cross contamination. Set a constant voltage of 80V in the concentrated gel stage until bromophenol blue migrates to the separation gel interface (about 20min). Increase the voltage to 120V in the separation stage and continue until bromophenol blue reaches the bottom of the gel (about 1h).

[0100] Staining and Destaining: After electrophoresis, transfer the gel to a staining solution (0.1% Coomassie Brilliant Blue R-250, 40% methanol, 10% glacial acetic acid) and stain on a shaker at room temperature for 1 hour. The staining solution penetrates the gel matrix and binds to proteins, forming a blue complex. The gel is then transferred to a destaining solution (40% methanol, 10% glacial acetic acid). After the initial destaining, replace the solution with fresh water after 30 minutes, and then every hour thereafter, for a total destaining time of 3-5 hours. Heat can be used to accelerate the destaining process until the gel background becomes light blue or transparent and the target bands are clearly visible.

[0101] Gel imaging: Use a gel imaging system to capture and save images, and adjust the contrast to enhance band identification.

[0102] By comparing the band intensity at the expected molecular weight (20.1 kDa) between the induced and control groups, and using grayscale analysis software, we quantitatively evaluated the effects of varying IPTG concentrations and induction times on recombinant protein expression levels, ultimately determining the optimal induction conditions. Three biological replicates were performed throughout the experiment to ensure the reliability of the results.

[0103] Effects of different IPTG concentrations on the expression level of recombinant protein after 12 h of induction Figure 6 As shown in Figure 2, the effects of different induction times with 1.8 mM IPTG concentration on the expression level of recombinant proteins are shown in Figure 2. Figure 7 The results showed that compared with the uninduced recombinant bacteria, a clear protein band appeared after IPTG induction. The size was consistent with the theoretical size, with a molecular weight of 20.1 KDa.

[0104] The recombinant protein obtained by different IPTG concentrations and induction times was recovered and purified using the mouse TRAIL ELISA kit from Abcam, and the protein yield was calculated. Figures 8 and 9 As shown, Figure 8 is the gray value after 12 hours of induction with different concentrations, Figure 9 Grayscale values ​​after different induction times at 1.8 mM. In the figure, Area is the integral value obtained by multiplying the grayscale value of the band by the band width (pixel range), i.e., Grayscale Area = Average Grayscale Value × Band Pixel Area, which represents protein yield. The results show that protein yield is maximized when the induction condition is 1.8 mM and the induction time is 8 hours.

[0105] 3. Recombinant protein purification

[0106] After loading the Ni-NTA affinity resin into the chromatography column, it was equilibrated with equilibration buffer (50mM Tris-HCl, 300mM NaCl, 20mM imidazole, adjusted to pH 8.0) to prepare it for binding to the target protein. The cell lysate supernatant (crude protein sample) filtered through a 0.45μm filter was slowly loaded onto the affinity column using a peristaltic pump at 20 rpm. The total protein load was approximately 10g. The column was cycled three times in an ice bath to allow the His tag of the target protein to bind to the nickel ions on the Ni-NTA resin. Wash the affinity column sequentially with 20mM, 50mM, 100mM, 250mM, and 500mM imidazole eluents. For the 20mM and 50mM eluents, run the peristaltic pump at 60 rpm, adding 30 column volumes of eluent for each concentration. For the 100mM, 250mM, and 500mM eluents, run the peristaltic pump at 30 rpm, adding 20 column volumes of eluent for each concentration. Collect the eluent in aliquots.

[0107] The Ni-NTA affinity column packing method is as follows:

[0108] Adding filler: Gently pour the washed resin suspension into the column. To prevent the formation of bubbles, tilt the column at an angle and slowly pour the suspension along the inner wall. Add the resin slowly and evenly to avoid introducing air into the resin.

[0109] Column packing and sedimentation: Gently vibrate the column while adding resin to facilitate the compaction of the resin. Keep the bottom of the column open to allow the buffer to flow out and ensure that the resin gradually settles and is packed tightly.

[0110] Equilibrate the column bed: Add equilibration buffer, maintaining a slow and even flow rate through the column bed until there are no visible bubbles and the liquid level is level with the top of the resin. Typically, the equilibration volume is 3-5 column volumes, ensuring that the resin is completely immersed in the equilibration buffer and removing any remaining impurities.

[0111] Check the column: ① Check uniformity: Ensure the resin layer is flat and uniform. If there are cracks or obvious unevenness, readjustment is required. ② Check the column for bubbles: Bubbles can affect the purification effect, so try to avoid bubbles during column packing and ensure that there are no bubbles in the packed resin layer.

[0112] 4. Recombinant protein identification

[0113] 4.1. Mix the protein sample with 4× reducing loading buffer in proportion, treat in a boiling water bath for 10 minutes to fully denature the protein, and then separate by SDS-PAGE electrophoresis, using a pre-stained protein marker as a molecular weight reference. After electrophoresis, use Coomassie Brilliant Blue staining to observe the protein bands to assess whether the molecular weight of the target protein meets the expectations, and analyze the band clarity and interference of other proteins. The results are as follows: Figure 10 As shown in Figure 2, a single target protein band appeared when the elution concentration was 100 mM.

[0114] 4.2. The protein concentration was determined by BCA method and the total protein yield was calculated based on the sample volume, which was 85.21%.

[0115] 4.3. Western Blot Verification is used to confirm the specificity of the protein. The protein in the SDS-PAGE gel was electrotransferred to a 0.45 μm PVDF membrane at a constant voltage of 350 V in an ice bath for 30 minutes. Immediately after transfer, the membrane was blocked with 5% skim milk powder at room temperature for 1 hour to block nonspecific binding sites. The blocked membrane was washed three times with TBST solution on a shaker (10-15 minutes each time), followed by the addition of a His-tag specific primary antibody (anti-His antibody, dilution ratio 1:1000) and incubation at 4°C on a shaker for 12 hours. After the primary antibody is bound, the membrane was thoroughly washed again with TBST three times, and an HRP-labeled secondary antibody (HRP goat anti-mouse) was added and incubated at room temperature for 1 hour. Finally, unbound secondary antibody was removed by washing three times with TBST. After the treated PVDF membrane was reacted with ECL chemiluminescent substrate in the dark, the specific signal was captured using a gel imaging system. The position and specificity of the target protein band were confirmed by comparing the molecular weight of the marker with the preset blank / positive control. The commercially available TRAIL protein (manufacturer: GenScript Biotech Co., Ltd., trade name: mouse soluble TRAIL protein (Cat. No: Z03367-10, Lot No: P50031408), construction method: N-terminal modification) was used as a control. Figure 11 The left side of the figure shows the protein prepared by the present invention (denoted as sTRAIL), and the right side shows the commercially available TRAIL protein (denoted as R). After development, the results showed that a specific band appeared at about 20 kDa, indicating that the target protein prepared by the present invention is TRAIL protein.

[0116] Desalt the target protein eluate by dialyzing: Seal one end of a dialysis bag (previously activated by boiling with 1-2 mM EDTA) with a dialysis clamp to ensure a tight seal. Carefully inject the TRAIL protein solution into the dialysis bag, avoiding bubbles. Seal the other end, leaving approximately 20% headroom to prevent expansion and rupture. Completely immerse the dialysis bag in 1 mM PBS dialysate (1:1000 by volume). Store at 4°C to prevent protein degradation. Change the dialysate every 6 hours for the first 24 hours (by which time most of the salt has diffused), and then every 12 hours thereafter (for a total dialysis time of 48 hours). Remove the dialysis bag, wipe dry, cut one end, recover the TRAIL protein solution, and centrifuge (10,000 rpm, 10 minutes) to remove any remaining precipitate or impurities. (If necessary, concentrate the protein by ultracentrifugation.) Prefreeze at -80°C and dry for recovery.

[0117] 4.4. The polymerization state and molecular weight distribution of the prepared protein were analyzed by size exclusion high performance liquid chromatography (SEC-HPLC). The relevant information for the chromatographic analysis is as follows: Liquid chromatography column: TSKgel G3000SWXL, product number: 0008541, specification: 7.8*300 mm, filler name: G3000SWXL, filler particle size: 5 μm, manufacturer: Tosoh Corporation.

[0118] Chromatographic conditions: Mobile phase: 50 mM NaH2PO4, 300 mM NaCl, flow rate: 1.0 mL / min, injection volume: 20 μL, injection concentration: 100 μg / mL. Using BSA (bovine serum albumin) as a control, the molecular weight of the extracted sTRAIL is similar to 66.5 kDa (20 kDa represents the molecular weight of the monomeric form of TRAIL protein, while the pharmacologically active TRAIL protein exists as a trimer. The sample analyzed by HPLC is in its original, uncleaved form, so a molecular weight of 20 kDa x 3 is used as a control).

[0119] The results are as follows Figure 12 The results show that the sTRAIL protein prepared by the present invention is a stable trimer form (Note: the trimer form is the most stable and effective form to exert apoptosis).

[0120] 5. Anti-tumor activity detection of the prepared sTRAIL

[0121] 5.1 Cell Culture

[0122] The 4T1 cell cryovials stored in liquid nitrogen were quickly placed in a 37°C water bath for rapid thawing, diluted with DMEM medium and centrifuged to remove the cryopreservative solution. The cells were resuspended with DMEM complete medium and placed in a 5% CO2 incubator at 37°C for static culture. The culture medium was changed every 24 hours, and the cells were passaged when they grew to a density of 80-90% after adherence to the wall. During passage, the cells were digested with 0.25% trypsin digestion solution and the digestion status was observed under an inverted microscope. After the digestion was completed (the cells recovered from a spindle shape to a spherical shape), DMEM complete medium was added to terminate the digestion. During this period, care was taken to avoid over-digestion. The cells were blown to form a single cell suspension, then transferred to a centrifuge tube, centrifuged at 2000rpm for 3 minutes, and the cell pellet was resuspended with 3mL of complete medium and transferred to a new culture dish for culture.

[0123] 5.2. Detection of cell viability by CCK-8 assay

[0124] The CCK8 method was used to detect the proliferation inhibitory effect of sTRAIL on mouse breast cancer 4T1 cells. 4T1 cells were cultured in DMEM medium containing 10% fetal bovine serum and cultured in a 37°C cell culture incubator containing 5% CO2. Cells were passaged every 2-3 days, and cells in the logarithmic growth phase were plated on 96-well plates. sTRAIL was dissolved and diluted in DMEM medium, and the concentration gradient was set to 10, 50, 250, 500, 1000, and 1500 ng / mL, with 6 replicates for each concentration. After 24 hours, 10 μL of CCK8 solution was added to each well. After incubation, the absorbance of each well at 492 nm was detected by a microplate reader, and the cell viability value was calculated using the following formula:

[0125]

[0126] The results are as follows Figure 13 The results showed that the TRAIL protein prepared by the present invention has obvious inhibitory activity on 4T1 cells, and its IC 50 The apoptosis efficacy of 4T1 cells was significantly better than that of the commercially available TRAIL protein (manufacturer: GenScript Biotech Co., Ltd., trade name: mouse soluble TRAIL protein (Cat. No: Z03367-10, Lot No: P50031408), construction method: N-terminal modification) (IC 50 =730.8ng).

[0127] In summary, the present invention successfully completed the construction of sTRAIL plasmid and its protein expression and purification. By optimizing the expression and purification conditions, sTRAIL with a purity greater than 95% was obtained, and the high purity and high activity of the protein were ensured.

[0128] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. An engineered bacterium expressing a recombinant soluble TRAIL protein, characterized in that: The construction method of the engineered bacteria comprises: inserting a TRAIL gene between the Nde I and Xho I restriction sites of a pET-32a(+) vector to construct a recombinant plasmid; and transforming the recombinant plasmid into Escherichia coli BL21(DE3) to obtain the engineered bacteria.

2. The engineered bacteria expressing recombinant soluble TRAIL protein according to claim 1, characterized in that: The nucleotide sequence of the TRAIL gene is shown in SEQ ID No.

1.

3. A method for expressing and purifying recombinant soluble TRAIL protein, characterized in that: The steps include: IPTG is used to induce the engineered bacteria according to claim 1 or 2 to express the protein; and a crude protein sample is obtained and purified using a Ni-NTA affinity column.

4. The method for expressing and purifying recombinant soluble TRAIL protein according to claim 3, wherein: The induction concentration of IPTG is 1.2-1.8 mM, the induction time is 8-12 h, and the induction temperature is 15-17°C.

5. The method for expressing and purifying recombinant soluble TRAIL protein according to claim 3, wherein: The method for obtaining the crude protein sample comprises: adding a bacterial lysis solution to the engineered bacterial cells after IPTG induction, performing ultrasonic disruption in an ice bath, and centrifuging to obtain the crude protein sample.

6. The method for expressing and purifying recombinant soluble TRAIL protein according to claim 3, wherein: The Ni-NTA affinity column purification method comprises: washing the affinity column with 20mM, 50mM and 100mM imidazole washing buffers in sequence, collecting the eluate of 100mM, and dialyzing the eluate to remove salt.

7. The method for expressing and purifying recombinant soluble TRAIL protein according to claim 6, wherein: The eluent dialysis desalination method comprises: performing dialysis treatment on the eluent and the dialysate at a volume ratio of 1:(50-1000), the molecular weight of the dialysis bag is 14000Da; the dialysate is a PBS solution, the dialysis time is 48-72h; and the dialysis temperature is 0-5°C.

8. Use of the engineered bacteria according to claim 1 or 2 or the expression and purification method of the recombinant soluble TRAIL protein according to any one of claims 3 to 7 in the preparation of recombinant soluble TRAIL protein.

9. Use of the engineered bacteria according to claim 1 or 2 or the expression and purification method of the recombinant soluble TRAIL protein according to any one of claims 3 to 7 in the preparation of anti-tumor drugs.

10. Use of the engineered bacteria according to claim 1 or 2 or the expression and purification method of the recombinant soluble TRAIL protein according to any one of claims 3 to 7 in the preparation of an in vitro growth inhibitor of 4T1 cells.