A molecular marker related to yield of alfalfa on chromosome 2 and application thereof

Abstract

This invention belongs to the field of molecular marker technology and discloses an InDel molecular marker located on chromosome 2 that is associated with alfalfa yield and its application. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.5, and the upstream primer sequence of the primer pair for amplifying the molecular marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2. The molecular marker is located on alfalfa chromosome 2, and the nucleotide sequence of its inserted or deleted fragment is shown in the sequence listing SEQ ID NO.3. The InDel molecular marker and primer pair provided by this invention can predict, identify, or assist in the identification of alfalfa yield traits. This invention also provides a method for identifying alfalfa yield traits using the InDel molecular marker; this method is simple, rapid, and provides accurate identification results, with good prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel molecular marker located on chromosome 2 that is associated with alfalfa yield and its application. Technical Background

[0002] The rapid development of my country's animal husbandry industry and the increasing demand have led to a supply shortage of high-quality forage. Meeting the livestock industry's demand for high-quality forage is a pressing issue. Alfalfa (Medicago sativa L.), due to its long cultivation history and strong adaptability, is widely cultivated across Eurasia and around the world, becoming one of the most widely planted forage crops globally and earning the title of "King of Forage," with high economic benefits. With the continuous improvement of national living standards, the demand for ruminant animal products such as meat and milk is expected to increase significantly in the future, leading to a substantial increase in the demand for high-quality forage, especially alfalfa. Therefore, cultivating high-yield and high-quality alfalfa varieties is of great significance for increasing alfalfa production and promoting the development of the forage and animal husbandry industries.

[0003] Most alfalfa species have complex genetic backgrounds, making the development of new varieties using traditional breeding methods slow. With the continuous development and improvement of modern biogenetic technology, researchers are increasingly emphasizing the use of molecular marker technology to assist genetic breeding, thereby improving breeding efficiency and eliminating blind spots in the breeding process. Genome-wide association studies (GWAS) can simultaneously detect genetic variation within a large population across the entire genome and associate these variations with specific phenotypic traits. Statistical analysis of genotype and phenotypic data from large-scale samples helps identify genetic markers significantly associated with specific traits, thus revealing the genetic basis of phenotypic variation. This invention constructs a population using 258 alfalfa accessions, resequencing them and performing GWAS in conjunction with dry weight traits to develop an InDel locus associated with yield. This invention provides theoretical support and genetic resources for high-yield molecular genetic improvement of alfalfa and the breeding of new materials. Summary of the Invention

[0004] One of the objectives of this invention is to provide an InDel molecular marker associated with alfalfa yield.

[0005] The second objective of this invention is to provide the application of the InDel molecular marker located on chromosome 2 that is associated with alfalfa yield.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention discloses a molecular marker associated with alfalfa yield, located on alfalfa chromosome 2, named Ms_Chr2_61464064.

[0008] The primer pairs for amplifying the above molecular markers have the following primer pair sequences:

[0009] Ms_Chr2_61464064-F: GTAGTTAAAAAAATACATTAAGTAAAAAAATTTG (as shown in SEQ ID NO.1);

[0010] Ms_Chr2_61464064-R: ATTAGGCATAATTTTTAAAATTGGATT (as shown in SEQ ID NO.2);

[0011] This invention also discloses the application of the above-mentioned molecular marker primer pairs in yield-assisted breeding of alfalfa. That is, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying yield-related traits in alfalfa materials. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0012] This invention also discloses the application of the above-mentioned molecular markers in identifying yield traits in alfalfa, especially in screening and identifying high and low yields of alfalfa. Specifically, the specific steps for identifying whether alfalfa has a high-yield trait are as follows:

[0013] (1) Using the DNA of the tested germplasm as a template for PCR amplification, and Ms_Chr2_61464064-F and Ms_Chr2_61464064-R as primers, the PCR amplification reaction system is shown in Table 1:

[0014] Table 1. Reaction system for PCR amplification

[0015]

[0016] Pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 18 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.

[0017] (2) Detection of PCR products by agarose gel electrophoresis: Take 7 μL and judge the yield of alfalfa based on the band results.

[0018] PCR amplification was performed using primers Ms_Chr2_61464064-F and Ms_Chr2_61464064-R. If the PCR amplification product contained only one characteristic band of 300 bp as shown in SEQ ID NO.4, then the alfalfa was a high-yielding type. If the PCR amplification product contained both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 273 bp as shown in SEQ ID NO.5, then the alfalfa was a low-yielding type.

[0019] In addition, this invention also protects a kit for identifying yield traits in alfalfa, the kit containing primer pairs Ms_Chr2_61464064-F and Ms_Chr2_61464064-R. Other components of the kit are conventional reagents. Specifically, it also includes PCR buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the PCR buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0020] The kit of this invention can rapidly identify the yield trait of alfalfa and its yield genotype. The specific method is the same as for identifying whether alfalfa possesses a high-yield trait. The specific steps are as follows: By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product has only one characteristic band of 300 bp as shown in SEQ ID NO.4, then the alfalfa is a homozygous high-yield genotype; if the PCR amplification product has both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 273 bp as shown in SEQ ID NO.5, then the alfalfa is a heterozygous low-yield genotype.

[0021] The present invention has the following advantages:

[0022] (1) This invention utilizes 258 alfalfa accessions to construct a population, resequencing them and performing genome-wide association analysis based on dry weight traits to develop an InDel locus associated with yield. This invention provides theoretical support and genetic resources for high-yield molecular genetic improvement of alfalfa and the breeding of new materials.

[0023] (2) Using separate markers linked to yield traits to screen alfalfa materials with high yield is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0024] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to alfalfa high-yield breeding practice and material identification in a simple, rapid and high-throughput manner. Attached Figure Description

[0025] Figure 1 The genome-wide association analysis results for alfalfa yield are based on the Manhattan plot obtained from EMMAX software analysis. The green dots indicate the InDel positions associated in this invention.

[0026] Figure 2 This is a box plot showing the dry weight distribution of the genotype at the Ms_Chr2_61464064 locus in the alfalfa population of this invention; 0 / 0 indicates that the genotype at the Ms_Chr2_61464064 locus is a homozygous high-yielding genotype, and 0 / 1 indicates that the Ms_Chr2_61464064 locus is a heterozygous low-yielding genotype; the dots represent extreme values ​​of the data, and **** represents P<0.0001.

[0027] Figure 3 This is a partial sequence alignment result between high-yield and low-yield materials in the yield-related region.

[0028] Figure 4 Electrophoresis images of molecular markers amplified from 16 alfalfa germplasm resources, with an agarose gel concentration of 2%. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0030] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1: Development of molecular markers associated with alfalfa yield

[0033] This invention uses the dry weight (kg) of alfalfa at the initial flowering stage to measure alfalfa yield. A higher value indicates higher yield, and a lower value indicates lower yield. After measuring the dry weight of 258 alfalfa accessions, GWAS analysis located an InDel locus in alfalfa. Figure 1 The green locus, named Ms_Chr2_61464064, is located at locus 61464064 on chromosome 2 of the alfalfa reference genome (downloadable from https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960; the downloaded file "ZhongmuNo.1_genome.fasta.gz" is the alfalfa genome sequence). The first allele type is 0 / 0, and the second allele type is 0 / 1. A box plot showing the yield distribution of the genotypes at the Ms_Chr2_61464064 locus in the population is shown. Figure 2 This indicates that alfalfa lines with genotype 0 / 0 have significantly higher yields than those with genotype 0 / 1. An insertion / deletion fragment, ATCAGCTATCATTATAAACTAACTTT (shown in SEQ ID NO. 3), is present at locus 61464064 on chromosome 2 of alfalfa. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects alfalfa yield. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is high-yielding alfalfa; alfalfa without the fragment shown in SEQ ID NO.3 is low-yielding alfalfa.

[0034] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0035] Ms_Chr2_61464064-F: GTAGTTAAAAAAATACATTAAGTAAAAAAATTTG (as shown in SEQ ID NO.1);

[0036] Ms_Chr2_61464064-R: ATTAGGCATAATTTTTAAAATTGGATT (as shown in SEQ ID NO.2);

[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of homozygous high-yielding alfalfa samples had only a 300bp characteristic band, while the PCR product of heterozygous low-yielding alfalfa samples had both a 300bp characteristic band and a 273bp characteristic band.

[0038] Example 2: Accuracy verification of the molecular markers described in this invention

[0039] Using the aforementioned molecular markers, 150 germplasm accessions were identified. The specific germplasm materials used are shown in Table 2.

[0040] Table 2. Genotypes and yields of 150 materials based on the Ms_Chr2_61464064 locus.

[0041]

[0042]

[0043]

[0044] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0045] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×SanTaq PCR Mix, and deionized water to a final volume of 20 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 18 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. Separation is performed by electrophoresis on a 2% agarose gel. After loading, the samples are electrophoresed at 120V DC for 60 min, and the PCR banding patterns of each sample are then read.

[0046] 2) Determine the yield of alfalfa based on the size of the PCR product: If the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is low-yielding alfalfa.

[0047] When the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is a high-yielding alfalfa.

[0048] Specifically, when the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 300bp, then the alfalfa to be identified is a high-yielding alfalfa.

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, the band length of the PCR product is 273bp, then the alfalfa to be identified is low-yielding alfalfa.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054] Furthermore, Table 2 shows that this study identified 150 alfalfa accessions. Of these, 104 accessions were identified as homozygous high-yielding genotypes (0 / 0), with an average dry weight of 0.28 kg. 46 accessions were identified as heterozygous low-yielding genotypes (0 / 1), with an average dry weight of 0.19 kg, lower than the average of the 104 high-yielding accessions. Analysis of variance showed a highly significant difference in dry weight between the high-yielding and low-yielding genotypes (P < 0.0001). Figure 4 The PCR results of 16 germplasms (Ladakh, CF039770, CF005602, Xinmu 4, CF040664, Nanmu 601, Plato MS, PI641378, CF039784, Longmu 808, CF021077, PI631977, PI631714, Longmu 809, Zhongmu 3, CF039888) are shown. In the figure, the 0 / 0 type material only amplified a 300bp band, which is a homozygous high dry weight genotype, consistent with the actual high dry weight weighing results of the first 8 materials; while the 0 / 1 type material amplified both a 300bp band and a 273bp band, which is a heterozygous low dry weight genotype, consistent with the actual low dry weight results of the last 8 materials. Therefore, the InDel molecular marker of the present invention can effectively identify the yield trait of alfalfa and can be used for the prediction and screening of high-yield alfalfa materials.

[0055] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 2 associated with alfalfa yield, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion fragment ATCAGCTATCATTATAAACTAACTTT on chromosome 2 of the alfalfa reference genome. The primer pair sequences for amplifying the molecular marker are as follows: Ms_Chr2_61464064-F: GTAGTTAAAAAAATACATTAAGTAAAAAAATTTG; Ms_Chr2_61464064-R:ATTAGTAGGCATAATTTTTAAAATTGGATT.

2. The application of the primer pair of the molecular marker described in claim 1 in the auxiliary identification of yield traits of alfalfa.

3. A method for assisting in the identification of high and low yielding alfalfa plants, characterized by, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr2_61464064-F and Ms_Chr2_61464064-R. If the PCR amplification product contained only one characteristic band of 300 bp as shown in SEQ ID NO.4, then the alfalfa was a high-yielding type. If the PCR amplification product contained both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 273 bp as shown in SEQ ID NO.5, then the alfalfa was a low-yielding type.

4. Use of a kit in assisting the identification of alfalfa genotypes with high or low yield, characterized in that, The kit contains primer pairs for the molecular marker described in claim 1. The method for using the kit to assist in identifying high-yield and low-yield genotypes of alfalfa includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product has only one characteristic band of 300 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous high-yielding genotype; if the PCR amplification product has both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 273 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous low-yielding genotype.

Images