An InDel molecular marker located on chromosome 6 and associated with alfalfa yield and its application
By developing the InDel molecular marker Ms_Chr6_85122344 on chromosome 6 of alfalfa and designing primer pairs, the problem of blindly screening high-yield materials in the breeding process was solved, and efficient and accurate breeding results were achieved.
Patent Information
- Application Number
- CN202411525026.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-30
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2044-10-30
AI Technical Summary
Existing technologies lack efficient molecular marker-assisted methods in alfalfa breeding, leading to blind spots and low efficiency in the breeding process, making it difficult to accurately screen high-yielding materials.
We developed the InDel molecular marker Ms_Chr6_85122344 located on chromosome 6 of alfalfa and designed the corresponding primer pair. Through PCR amplification and electrophoresis detection, we rapidly identified the yield trait of alfalfa.
It enables rapid and accurate screening and identification of high-yielding alfalfa materials, improving breeding efficiency, reducing costs, and simplifying the breeding process.
Smart Images

Figure CN119193907B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel molecular marker located on chromosome 6 that is associated with alfalfa yield and its application. Technical Background
[0002] Alfalfa (Medicago sativa L.) is a perennial herbaceous plant belonging to the genus *Medicago* in the legume family (Fabaceae). It is one of the most widely distributed forage crops in the world. Its crude protein content can reach over 20%, and it has good palatability, making it a high-quality source of animal feed. It is widely cultivated in northern my country. With the increasing demand for meat, eggs, and dairy products, the livestock industry faces higher development requirements. As a plant with extremely high protein content, alfalfa is crucial for the development of the livestock industry. Therefore, cultivating high-yield and high-quality alfalfa new materials is of great significance for increasing alfalfa production and promoting the development of the forage and livestock industries.
[0003] With the continuous development and improvement of modern biogenetic technology, scholars are increasingly emphasizing the use of molecular marker technology to assist genetic breeding, thereby improving breeding efficiency and eliminating blind spots in the breeding process. Marker breeding technology selects genes for target traits by tracking genetic markers, thus achieving the goal of breeding new materials. This technology has advantages such as accuracy, speed, and efficiency, and is widely used in an increasing number of crops. Genome-wide association studies (GWAS) are one of the most efficient methods for analyzing quantitative traits. By performing high-density genetic marker typing on a large-scale population DNA sample, it seeks genetic information related to complex traits. This invention uses 231 alfalfa accessions to construct a population, resequencing them and combining this with GWAS for fresh weight traits, developing an InDel locus associated with yield. This invention provides theoretical support and genetic resources for high-yield molecular genetic improvement of alfalfa and the breeding of new materials. Summary of the Invention
[0004] One of the objectives of this invention is to provide an InDel molecular marker located on chromosome 6 that is associated with alfalfa yield.
[0005] The second objective of this invention is to provide the application of the InDel molecular marker located on chromosome 6 that is associated with alfalfa yield.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] This invention discloses a molecular marker associated with alfalfa yield, located on alfalfa chromosome 6, named Ms_Chr6_85122344.
[0008] The primer pairs for amplifying the above molecular markers have the following primer pair sequences:
[0009] Ms_Chr6_85122344-F: CATGTTGCAGTCACGAGCTATG (as shown in SEQ ID NO.1);
[0010] Ms_Chr6_85122344-R: GCATGATGCTGAGGATGTTGTG (as shown in SEQ ID NO.2);
[0011] This invention also discloses the application of the above-mentioned molecular marker primer pairs in yield-assisted breeding of alfalfa. That is, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying yield-related traits in alfalfa materials. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.
[0012] This invention also discloses the application of the above-mentioned molecular markers in identifying alfalfa yield traits, especially in screening and identifying high and low yield traits in alfalfa. Specifically, the specific steps for identifying whether alfalfa has a high-yield trait are as follows:
[0013] (1) Using the DNA of the tested germplasm as a template for PCR amplification, and Ms_Chr6_85122344-F and Ms_Chr6_85122344-R as primers, the PCR amplification reaction system is shown in Table 1:
[0014] Table 1. Reaction system for PCR amplification
[0015]
[0016] Pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 18 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.
[0017] (2) Detection of PCR products by agarose gel electrophoresis: Take 4 μL and judge the yield of alfalfa based on the band results.
[0018] PCR amplification was performed using primers Ms_Chr6_85122344-F and Ms_Chr6_85122344-R.
[0019] If the PCR amplification product has only one characteristic band of 105 bp as shown in SEQ ID NO.4, then alfalfa is a high-yielding type; if the PCR amplification product has both one characteristic band of 105 bp as shown in SEQ ID NO.4 and one characteristic band of 78 bp as shown in SEQ ID NO.5, then alfalfa is a low-yielding type.
[0020] In addition, this invention also protects a kit for identifying yield traits in alfalfa, the kit containing primer pairs Ms_Chr6_85122344-F and Ms Chr6_85122344-R. Other components of the kit are conventional reagents. Specifically, it also includes PCR buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the PCR buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.
[0021] The kit of this invention can rapidly identify the yield trait of alfalfa and its yield genotype. The specific method is the same as for identifying whether alfalfa possesses a high-yield trait. The specific steps are as follows: By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product has only one characteristic band of 105 bp as shown in SEQ ID NO.4, then the alfalfa is a homozygous high-yield genotype; if the PCR amplification product has both one characteristic band of 105 bp as shown in SEQ ID NO.4 and one characteristic band of 78 bp as shown in SEQ ID NO.5, then the alfalfa is a heterozygous low-yield genotype.
[0022] The present invention has the following advantages:
[0023] (1) Using markers linked to yield traits for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0024] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to alfalfa high-yield breeding practice and material identification in a simple, rapid and high-throughput manner. Attached Figure Description
[0025] Figure 1 The genome-wide association analysis results for alfalfa yield are based on the Manhattan plot obtained from EMMAX software analysis. The red dots indicate the InDel positions associated in this invention.
[0026] Figure 2 This is a box plot showing the fresh weight distribution of the genotype at the Ms_Chr6_85122344 locus in the alfalfa population of this invention; 0 / 0 indicates that the genotype at the Ms_Chr6_85122344 locus is a homozygous high-yielding genotype, and 0 / 1 indicates that the Ms_Chr6_85122344 locus is a heterozygous low-yielding genotype; the dots represent extreme values of the data, and **** represents P<0.0001.
[0027] Figure 3 This is a partial sequence alignment result between high-yield and low-yield materials in the yield-related region.
[0028] Figure 4 Electrophoresis images of amplified molecular markers from 16 alfalfa germplasm resources, using agarose gels with a concentration of 3%. M in the image represents a DNA marker. Detailed Implementation
[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0030] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0032] Example 1: Development of molecular markers associated with alfalfa yield
[0033] This invention uses the fresh weight of alfalfa at the initial flowering stage to measure alfalfa yield. A higher value indicates higher yield, and a lower value indicates lower yield. After measuring the fresh weight of the alfalfa population, GWAS analysis was used to locate an InDel locus in the alfalfa. Figure 1The red locus, named Ms_Chr6_85122344, is located at locus 85122344 on chromosome 6 of the alfalfa reference genome. The first allele is genotype 0 / 0, and the second allele is genotype 0 / 1. A box plot showing the yield distribution of the Ms_Chr6_85122344 locus in the population is shown. Figure 2 This indicates that alfalfa lines with genotype 0 / 0 have significantly higher yields than those with genotype 0 / 1. An insertion / deletion fragment, ACCCTTCAATTCAATATGAGCTACAAT (shown in SEQ ID NO. 3), is located at locus 85122344 on chromosome 6 of alfalfa. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects alfalfa yield. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is high-yielding alfalfa; alfalfa without the fragment shown in SEQ ID NO.3 is low-yielding alfalfa.
[0034] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:
[0035] Ms_Chr6_85122344-F: CATGTTGCAGTCACGAGCTATG (as shown in SEQ ID NO.1);
[0036] Ms_Chr6_85122344-R: GCATGATGCTGAGGATGTTGTG (as shown in SEQ ID NO.2);
[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of homozygous high-yielding alfalfa samples had only a 105bp characteristic band, while the PCR product of heterozygous low-yielding alfalfa samples had both a 105bp characteristic band and a 78bp characteristic band.
[0038] Example 2: Accuracy verification of the molecular markers described in this invention
[0039] The 231 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:
[0040] Table 2. Yield data of 231 germplasm materials and genotypes corresponding to the Ms_Chr6_85122344 locus.
[0041]
[0042]
[0043]
[0044]
[0045]
[0046] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;
[0047] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×SanTaq PCR Mix, and deionized water to a final volume of 20 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 18 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. Separation is performed by electrophoresis on a 3% agarose gel. After loading, the samples are electrophoresed at 120V DC for 60 min, and the PCR banding patterns of each sample are then read.
[0048] 2) Determine the yield of alfalfa based on the size of the PCR product: If the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is low-yielding alfalfa.
[0049] When the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is a high-yielding alfalfa.
[0050] Specifically, when the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, the band length of the PCR product is 105bp (SEQ ID NO.4), then the alfalfa to be identified is a high-yielding alfalfa.
[0051] The sequence of SEQ ID NO.4 is as follows:
[0052] CATGTTGCAGTCACGAGCTATGCCACCACCAGCGCCGATGCACTACCCTTCAATTCAATATGAGCTACAATCCCAATATCTTTCACAACATCCTCAGCATCATGC.
[0053] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, the band length of the PCR product is 78bp (SEQ ID NO.5), then the alfalfa to be identified is low-yielding alfalfa.
[0054] The sequence of SEQ ID NO.5 is as follows:
[0055] CATGTTGCAGTCACGAGCTATGCCACCACCAGCGCCGATGCACTCCCAATATCTTTCACAACATCCTCAGCATCATGC.
[0056] Furthermore, as shown in Table 2, this study identified 231 alfalfa accessions. Among them, 121 accessions amplified only one 105bp characteristic band, indicating a homozygous high-yielding genotype (0 / 0). The average fresh weight of these 121 accessions was 0.897 kg. 110 accessions amplified both one 105bp and one 78bp characteristic band, indicating a heterozygous low-yielding genotype (0 / 1). The average fresh weight of these 110 accessions was 0.743 kg, lower than the average of the 121 high-yielding accessions. Analysis of variance showed a highly significant difference in fresh weight between the high-yielding and low-yielding genotypes (P < 0.0001).
[0057] Sixteen germplasm accessions were randomly selected to verify the above results. Figure 4 The PCR results of 16 germplasms (CF048304, CF039888, Juneng 601, Longyin BeZa87, Knight 2, Crown, Xinmu 1, SK3010, CF020828, Plato MS, PI641378, CF050057, CF020827, UC-1465, Gongnong 4, and Xinmu 4) were shown, and they corresponded consistently with the actual fresh weight results. The electrophoresis images of the remaining germplasms also corresponded consistently with the actual fresh weight results. Therefore, the InDel molecular marker of this invention can effectively identify the yield trait of alfalfa and can be used for the prediction and screening of high-yielding alfalfa materials.
[0058] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. An InDel molecular marker located on chromosome 6 and associated with alfalfa yield, characterized in that, The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.5, and the nucleotide sequence of its inserted / deleted fragment is shown in SEQ ID NO.
3. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is high-yielding alfalfa; alfalfa with the fragment shown in SEQ ID NO.3 deleted is low-yielding alfalfa. The primer pair sequence for amplifying the InDel molecular marker is as follows: Ms_Chr6_85122344-F: CATGTTGCAGTCACGAGCTATG; Ms_Chr6_85122344-R: GCATGATGCTGAGGATGTTGTG.
2. The application of the primer pair for amplifying the InDel molecular marker described in claim 1 in marker-assisted breeding related to alfalfa yield, characterized in that, The InDel molecular markers are used to predict, identify, or assist in the identification of yield traits in alfalfa.
3. A method for identifying yield traits of alfalfa, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the InDel molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr6_85122344-F and Ms_Chr6_85122344-R. If the PCR amplification product contained only one characteristic band of 105 bp as shown in SEQ ID NO.4, then the alfalfa was a high-yielding type. If the PCR amplification product contained both one characteristic band of 105 bp as shown in SEQ ID NO.4 and one characteristic band of 78 bp as shown in SEQ ID NO.5, then the alfalfa was a low-yielding type.
4. The use of a kit containing primer pairs of the InDel molecular marker as described in claim 1 in the identification of alfalfa yield genotypes.
5. The application according to claim 4, characterized in that, The method for identifying alfalfa yield genotypes using the aforementioned kit includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the InDel molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product has only one characteristic band of 105 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous high-yielding genotype; if the PCR amplification product has both one characteristic band of 105 bp as shown in SEQ ID NO.4 and one characteristic band of 78 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous low-yielding genotype.
Citation Information
Patent Citations
Molecular marker located on chromosome 5 and related to yield of medicago sativa and application of molecular marker
CN118441081A
InDel molecular marker located in chromosome 3 and related to yield of medicago sativa and application of InDel molecular marker
CN118480625A