Molecular marker closely linked to pepper fruit shape gene, primer, kit, and use

By developing molecular markers and primers that are tightly linked to pepper fruit shape genes, and combining them with PCR technology and KASP markers, the problem of pepper fruit shape identification has been solved, achieving high efficiency and accuracy in pepper breeding and advancing fruit shape research.

WO2026000325A1PCT designated stage Publication Date: 2026-01-02HUNAN AGRI UNIV

Patent Information

Application Number
PCT/CN2024/102200
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-27
Filing Date
2024-06-28
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively identifying and improving the shape of chili pepper fruits, which affects the efficiency and accuracy of chili pepper breeding.

Method used

Develop molecular markers and primers closely linked to pepper fruit shape genes, use PCR technology for rapid identification of pepper fruit shape, perform genotyping analysis using KASP markers, and provide corresponding kits for assisted breeding.

Benefits of technology

This approach enables rapid identification and selection of chili pepper fruit shapes, improves breeding efficiency, reduces planting scale and post-identification workload, enhances selection accuracy, and lays the foundation for studying the fruit shape formation mechanism.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024102200_02012026_PF_FP_ABST
    Figure CN2024102200_02012026_PF_FP_ABST
Patent Text Reader

Abstract

A molecular marker closely linked to a pepper fruit shape gene. Taking a basic version of Zhangshugang pepper as a reference gene, a single nucleotide polymorphism is present at base 162028839 of the pepper Chr02 chromosome, where a substitution from base C to A occurs. A primer and kit for identifying the molecular marker closely linked to the pepper fruit shape gene, and use thereof in identifying the pepper fruit shape or in molecular-assisted breeding. Early use of the molecular marker, the primer, and the kit in the early stage can quickly screen satisfactory plants, thereby effectively reducing the planting scale, reducing the workload of later identification, and improving the selection efficiency and accuracy. The molecular marker, the primer, and the kit are of great significance in the practice of pepper fruit shape breeding and the research on fruit shape changes and regulation mechanisms.
Need to check novelty before this filing date? Find Prior Art

Description

Molecular marker, primer, kit and application closely linked to pepper fruit shape gene TECHNICAL FIELD

[0001] The present application belongs to the field of pepper breeding, and particularly relates to a molecular marker, primer, kit and application closely linked to a pepper fruit shape gene. BACKGROUND

[0002] Pepper is an important vegetable with rich nutritional value and is widely planted all over the world, and has become the largest vegetable in planting area in China. Pepper fruits have a wide variety of shapes. For pepper fresh edible organs, fruit shape is an important commercial trait, which affects the consumer's consumption preference and market value, and for dry food or industrial pepper, the weight of the fruit affects the yield. Therefore, the current goal of pepper breeders is to improve fruit traits and increase yield by combining conventional breeding with various biological technologies.

[0003] Pepper fruit is a highly complex trait controlled by multiple genes and influenced by environmental and genetic interactions at various stages of plant growth. The fruit formation factors of pepper include pepper fruit length, width and single fruit weight. Among these yield formation factors, the heritability of single fruit weight is the highest, and fruit length is positively and significantly correlated with fruit width, fruit thickness and single fruit weight, directly affecting the yield and quality of pepper. Therefore, understanding the genetic characteristics of pepper fruit-related traits is of great significance for pepper improvement and the cultivation of high-yield and high-quality new pepper varieties.

[0004] SUMMARY

[0005] The technical problem solved by the present application is to overcome the shortcomings of the prior art and provide a molecular marker, primer, kit and application closely linked to a pepper fruit shape gene.

[0006] To solve the above technical problems, the technical solution provided by the present application is as follows:

[0007] A molecular marker closely linked to a pepper fruit shape gene, taking the basic version of pepper Zhangshugang as a reference gene, a single nucleotide polymorphism at the 162028839th base of the pepper Chr02 chromosome, where a base C is replaced by A.

[0008] The molecular marker closely linked to the pepper fruit shape gene, preferably, the nucleotide sequence is (as shown in SEQ ID NO: 1):

[0009] As a general inventive concept, the present application also provides a primer for identifying a molecular marker closely linked to a pepper fruit shape gene, comprising:

[0010] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCCAGTCTTTTCAATTATATGAGGAAAAGC-3';

[0011] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCCAGTCTTTTCAATTATATGAGGAAAAGA-3';

[0012] Reverse primer: 5'-GTGCAGTCTTTTCCCAAATCTGAA-3'.

[0013] The two forward primers are respectively connected with different fluorescent linker sequences, and the linker sequence matched with FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the linker sequence matched with HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0014] As a general inventive concept, the application also provides a method for obtaining the above-mentioned molecular marker, comprising the following steps:

[0015] (1) using late-maturing single Capsicum annuum as the female parent and late-maturing sweet pepper as the male parent to obtain F1, self-crossing F1 to obtain F2, and using the single-plant seed collection method to add generations to the F2 separation population, and continuously adding generations for 7 generations, and taking the 7th generation material to construct a RIL population for phenotype investigation and sequencing;

[0016] (2) identifying the fruit shape phenotype and analyzing the genetic law of the RIL population, using the BSA method combined with the chip method to respectively capture the 50K pepper chip of 20 strains with extreme phenotypes, and performing bioinformatics analysis on the sequencing results to obtain the chromosomal region linked to the pepper fruit shape;

[0017] (3) using the chip data to analyze the genotype of each pool individual in the candidate interval to further narrow the interval, find the linked genotype, and according to the variation information, convert it into a KASP marker, and finally obtain a molecular marker closely linked to the fruit shape gene.

[0018] As a general inventive concept, the application also provides a kit for identifying a molecular marker closely linked to a pepper fruit shape gene, comprising the above-mentioned primer.

[0019] The above-mentioned kit, preferably, the concentration ratio of the forward primer 1, the forward primer 2 and the reverse primer in the PCR reaction system is 0.15:0.15:0.4.

[0020] As a general inventive concept, the application also provides the use of the above-mentioned molecular marker or the above-mentioned primer or the above-mentioned kit in identifying the pepper fruit shape or in molecular-assisted breeding.

[0021] In the above applications, preferably, in the process of identifying the shape of pepper fruits or molecular-assisted breeding, using the Zhangshugang genome version of pepper as a reference, when the base at position 162028839 of the pepper Chr02 chromosome is homozygous C, the pepper fruit shape is narrow (≤17mm); when the base at position 162028839 of the pepper Chr02 chromosome is homozygous A (>17mm), the pepper fruit shape is wide; when the base at position 162028839 of the pepper Chr02 chromosome is heterozygous C / A, the pepper fruit shape is wide (>17mm).

[0022] The above-mentioned application, preferably, includes the following specific process for identifying the shape of chili pepper fruits:

[0023] (1) Using the genomic DNA of the sample to be tested as a template

[0024] (2) PCR amplification, fluorescence signal scanning, and genotyping were performed using the molecular markers, primers, or kits described above.

[0025] In the above application, preferably, in step (2), if only the fluorescence of forward primer 1 is detected in the sample, the genotype of the sample is AA, and it is determined to be a homozygous plant with a wide fruit shape; if only the fluorescence of forward primer 2 is detected, the genotype of the sample is CC, and it is determined to be a homozygous plant with a narrow fruit shape; if the fluorescence of both forward primer 1 and forward primer 2 is detected at the same time, the genotype of the sample is CA, and it is determined to be a heterozygous plant with a wide fruit shape.

[0026] Specifically, using the genomic DNA of the sample to be tested as a template, PARMS PCR amplification is performed using molecularly labeled amplification primers with a quantitative PCR device. The amplification procedure includes:

[0027] Preincubation: 94℃ for 900 seconds; 94℃ for 20 seconds, 78℃ for 10 seconds, TD at 62℃, 0 Cyc → 57 (-0℃), 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 35 cycles; Cooling: 37℃ for 30 seconds.

[0028] When a fluorophore and its corresponding fluorescence quencher are close together, the fluorescence emitted by the fluorophore will be absorbed by the quencher, resulting in the emission of fluorescence at a longer wavelength or the release of heat. In this case, the fluorescence signal of the fluorophore cannot be detected within the corresponding wavelength. Once the two are separated, the fluorescence signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers; when the corresponding allele is amplified, a corresponding fluorescence signal will appear.

[0029] Compared with the prior art, the application has the advantages of:

[0030] (1) The molecular marker involved in the application lays a foundation for cloning a major gene for controlling fruit width and studying the regulation mechanism of fruit shape change, and the application develops primers and a kit for the molecular marker, which can be directly used for identification of pepper fruit shape, and then the molecular marker, the primers and the kit can be relied on for rapid identification and breeding of pepper fruit shape.

[0031] (2) The molecular marker involved in the application and the primers and the kit developed for the molecular marker can quickly screen satisfactory plants through early use, effectively reduce the planting scale, reduce the workload of later identification, improve the selection efficiency and accuracy, and have great significance for studying the formation mechanism of fruit shape, and have important significance in pepper fruit shape breeding practice and fruit shape change and regulation mechanism research. BRIEF DESCRIPTION OF DRAWINGS

[0032] Fig. 1 is a photo of the male parent and the female parent in the embodiment of the application;

[0033] Fig. 2 is a normal distribution diagram of fruit width in RIL in the embodiment of the application;

[0034] Fig. 3 is a data analysis diagram of BSA combined chip in the embodiment of the application;

[0035] Fig. 4 is a result of genotyping of KASP markers in the RIL population in the embodiment of the application. DETAILED DESCRIPTION

[0036] In order to facilitate the understanding of the application, the following will combine the drawings and the preferred embodiments to describe the application more fully and in detail, but the protection scope of the application is not limited to the following specific embodiments.

[0037] Unless otherwise defined, all the professional terms used in the following have the same meaning as generally understood by those skilled in the art. The professional terms used in the present application are only for the purpose of describing the specific embodiments and are not intended to limit the protection scope of the application.

[0038] Unless otherwise specified, the various reagents and raw materials used in the application are commercially available products or products that can be prepared by known methods.

[0039] The application selects 151 F8 generation recombinant inbred lines (RILs) population hybrid constructed by 16L816 and 16L15 as a positioning population. The chromosome region controlling the fruit width trait is identified by using bulked population segregation analysis (BSA) and the analysis method combined with the 50K SNP chip of the pepper. In addition, the molecular marker is developed in the SNP enriched chromosome fragment, the genetic linkage map is constructed, the QTL of the fruit width trait is positioned, and after continuously densifying the map, the major QTL controlling the fruit width of the pepper is identified, the KASP marker is developed, and the beneficial marker selection is provided for the molecular assisted breeding.

[0040] Embodiment:

[0041] I. Obtaining of the molecular marker linked to the major QTL of the pepper fruit shape

[0042] 1. Construction of the genetic population

[0043] The late-maturing single-crowned bell pepper A is used as the female parent, the late-maturing sweet pepper is used as the male parent B, as shown in Figure 1, the F1 is obtained by hybridization, the F2 is obtained by selfing of the F1, the F2 separation population is subjected to single plant seed collection for generation, and the generation is continuously added for 7 generations, 10 plants are sowed for each single plant after the 7th generation, the plant leaf morphology has no difference, and the RIL population is constructed by using the 7th generation material. The phenotype of the female parent A is as follows: late-maturing single-crowned bell pepper, the first flowering node is 19 nodes, the green fruit is dark green, the mature fruit is fresh red, the fruit length is about 7 cm, and the fruit width is about 1 cm. The phenotype of the male parent B is as follows: late-maturing sweet pepper, the first flowering node is 14 nodes, the yellow anther, the green fruit is dark green, the mature fruit is golden yellow, the fruit length is 15.5 cm, and the fruit width is 10.5 cm.

[0044] 2. Phenotypic identification of fruit shape

[0045] The phenotypes of each single plant in the RIL population are identified, three fruits on the “four door” at the green and mature stage of each single plant are collected, a digital camera is used for photographing, a digital vernier caliper is used for measuring the fruit length and width, and the phenotypic identification of the fruit shape trait is completed.

[0046] 3. Analysis of fruit shape BSA combined with chip sequencing

[0047] Plant RIL separation population, select the widest and narrowest 20 single plant, respectively, extract leaf DNA, sample DNA after quality inspection qualified, using 50K chip for capture sequencing. The data obtained according to the phenotype is combined, and the data is constructed into two mixed pools. The mixed pool data pepper Zhangshugang reference gene (http: / / ted.bti.cornell.edu / ftp / pepper / genome / Zhangshugang / ) is mapped by bwa, samtools is used for SNP calling, the number of homozygous difference SNPs in two data mixed pools is counted, the proportion of polymorphic SNPs on each chromosome is analyzed, and the SNP-ratio value is calculated.

[0048] 4. Development of fruit shape linked molecular markers

[0049] Due to the low cost of 50K chip and the high accuracy of genotype identification (sequencing depth is more than 100X), in order to quickly obtain the main effect QTL region of pepper fruit width gene, according to the 40 single plants (20 extremely wide, 20 extremely narrow) of RIL population with extreme fruit width. The single plant data is compared with the pepper reference genome, the SNP variation site is found, the genotype is identified, the LOD value is calculated according to the phenotype data, the candidate interval is determined, and the more convenient KASP marker is developed, as shown in figures 2-4.

[0050] II. Application of pepper fruit shape linked molecular markers

[0051] 1. CTAB method for extracting DNA from 151 single plants in RIL population

[0052] (1) Add dithiothreitol (DTT, 0.2%) to the CTAB extraction solution;

[0053] (2) Add 2.0 mL centrifuge tube cover size fresh leaves 2 pieces, grind into powder with liquid nitrogen, add 900 μL CTAB buffer, mix well;

[0054] (3) 65℃ water bath for 50 min, during the period, gently invert shake 3 times, after water bath, 4℃ cooling to below 15℃;

[0055] (4) Add 500 chloroform / isopentyl alcohol (24:1), mix well up and down for 5 min, ensure that the sample is fully mixed with chloroform;

[0056] (5) 12,000 rpm centrifugation for 10 min, take 500 μL supernatant, add 500 μL isopropanol in 1.5 mL centrifuge tube, mix well by gently inverting up and down; 4℃ refrigerator for 30 min;

[0057] (6) 12,000 rpm centrifugation for 15 min, discard the supernatant; 75% alcohol 500ul wash the precipitate, 12,000 rpm centrifugation for 5 min, discard the supernatant;

[0058] (7) Super-clean dry DNA, let the alcohol evaporate completely, add 100 μL of pure water (containing a final concentration of 1% RNase) to dissolve the DNA;

[0059] (8) 37℃ water bath for 1h to remove RNA; take the DNA for electrophoresis detection. After identifying the complete band, use a microspectrophotometer to measure the DNA concentration, the ratio of 260 / 280 and 260 / 230 is required to be greater than 1.8, dilute the DNA to 100 ng, and place it at -20℃ for standby.

[0060] 2, KASP148 marker typing RIL population single plant

[0061] (1) KASP primer reagent consists of 3 primers, of which 2 are allele-specific forward primers; 1 is a universal reverse primer. The 2 allele-specific forward primers differ only in the 3' end base, corresponding to different alleles respectively.

[0062] KASP839 primer design from SNPWay (http: / / www.snpway.com / ), KASP839 primer synthesis from PAGE biological (PAGE purification), respectively as shown in SEQ ID NO: 2-4:

[0063] 839-F1: 5'-GAAGGTGACCAAGTTCATGCTCCAGTCTTTTCAATTATATGAGGAAAAGC-3';

[0064] 839-F2: 5'-GAAGGTCGGAGTCAACGGATTCCAGTCTTTTCAATTATATGAGGAAAAGA-3';

[0065] 839-R: 5'-GTGCAGTCTTTTCCCAAATCTGAA-3'.

[0066] The allele-specific forward primer will produce different fluorescence signals through competitive PCR reaction, the linker sequence matched with FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the linker sequence matched with HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0067] (2) Typing system

[0068] (3) Amplification program:

[0069] Preincubation 94℃900S; 94℃20S, 78℃10S, TD 62℃, 0Cyc->57(-0℃), 10 cycles; 94℃20S, 57℃60S, 35 cycles; Cooling 37℃30S.

[0070] (4) Genotyping results

[0071] Genotype identification of fruit shape of RIL population single plant using KASP839 marker, genotype was determined according to fluorescence signal, if blue color was shown as FAM, genotype was AA, and the plant was determined as wide fruit pure plant, if green color was shown as HEX, genotype was CC, and the plant was determined as narrow fruit plant, if red color was shown as Heterozygote, genotype was CA, and the plant was determined as wide fruit heterozygous plant.

[0072] Part of the RIL single plant identification results were shown in Figure 2, and the genotype identification results were highly consistent with the phenotype identification.

[0073] Table 1 Fruit width and genotype of 151 single plants in KASP839 marker population

[0074] Three, application of pepper fruit shape linked molecular marker in molecular breeding

[0075] The wide fruit sweet pepper screened by the above method was selected as the recurrent parent and hybridized with the narrow fruit material which needed to be improved, the heterozygous single plant was detected by KASP839 marker in BC1F1, the heterozygous single plant with similar agronomic traits to the recurrent parent was selected as the male parent for further backcross, and the plant line with the background of the recurrent parent was obtained after continuous selfing for 2 generations in BC3F1, and the KASP839 marker was combined with the selection of agronomic traits for assisted selection.

Claims

1. A molecular marker closely linked to a gene for pepper fruit shape, characterized in that, Using the basic version of the chili pepper Zhangshugang as a reference gene, a single nucleotide polymorphism was found at position 162028839 on the chili pepper Chr02 chromosome, where a C-to-A substitution occurred.

2. The molecular marker closely linked to the pepper fruit shape gene as described in claim 1, characterized in that, Its nucleotide sequence is: TTCAGATAAGTTTTCTTTTTGAATATGGGACATTGCCCTTTTCTTTCATTTCCCTATTC ATTCTTTTTTGTCATTTTATGTCATTTATCAAAAATAAAAGTCACCATCATTTTTTTTACATTTTAAGTCAAGTCTGTGTCAAAACAAGCGAGAAAGGATTTCAAAATTTACTACCAGTCTTTTCAATTATATGAGGAAAAG[C / A]CAAGGAATAGCACAGGAAGAAATATAA TCGTAATTCAACACGAAGCAAAGGAAGTCTATCAACCAACAGGCTATTGGATTCGTAGAAACATTCAGATTTGGGAAAAGACTGCACCTCAGGGGCATGGTAAAATGGAAACCCGTTGTTTGAGTCAGAACTCATTTCTCTCAATCTGGGTCCGGGTCAATGATGTGGCAAGA.

3. A primer for identifying a molecular marker closely linked to a gene for fruit shape in chili peppers, characterized in that, Including: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCCAGTCTTTTCAATTATATGAGGAA AAGC-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCCAGTCTTTTCAATTATATGAGGAA AAGA-3'; Reverse primer: 5'-GTGCAGTCTTTTCCCAAATCTGAA-3'.

4. A kit for identifying molecular markers closely linked to a gene for fruit shape in chili peppers, characterized in that, It contains the primers as described in claim 3.

5. The kit according to claim 4, characterized in that, The concentration ratio of forward primer 1, forward primer 2, and reverse primer in the PCR reaction system was 0.15:0.15:0.

4.

6. The use of a molecular marker as described in claim 1 or 2, a primer as described in claim 3, or a kit as described in any one of claims 4-5 in identifying the shape of pepper fruit or in molecular-assisted breeding.

7. The application as described in claim 6, characterized in that, In the process of identifying the shape of pepper fruits or in molecular-assisted breeding, using the Zhangshugang genome version of pepper as a reference, if the base at position 162028839 of the pepper Chr02 chromosome is a homozygous C, the plant is identified as a homozygous plant with narrow fruit shape; if the base at position 162028839 of the pepper Chr02 chromosome is a homozygous A, the plant is identified as a homozygous plant with broad fruit shape; and if the base at position 162028839 of the pepper Chr02 chromosome is a heterozygous C / A, the plant is identified as a plant with broad fruit shape.

8. The application as described in claim 6, characterized in that, The specific process for identifying the shape of a chili pepper fruit includes: (1) Extract DNA from the peppers to be tested as a template; (2) PCR amplification, fluorescence signal scanning, and genotyping are performed using the molecular markers described in claim 1 or 2, the primers described in claim 3, or the kits described in any one of claims 4-5.

9. The application as described in claim 8, characterized in that, In step (2), if only the fluorescence of the forward primer 1 is detected in the sample, the genotype of the sample is AA, and it is determined to be a homozygous plant with a broad fruit shape in chili peppers. If only the fluorescence of forward primer 2 is detected, the genotype of the sample is CC, and it is identified as a homozygous plant with narrow fruit shape. If the fluorescence of both forward primer 1 and forward primer 2 is detected, the genotype of the sample is CA, and it is identified as a heterozygous plant with wide fruit shape.

10. The application as described in claim 8, characterized in that, In step (1), PARMS PCR amplification was performed using a quantitative PCR device. The amplification program included: Preincubation 94℃ 900S; 94℃ 20S, 78℃ 10S, TD 62℃, 0Cyc→57(-0℃), 10 cycles; 94℃ 20S, 57℃ 60S, 35 cycles; Cooling 37℃ 30S.

Citation Information

Patent Citations

  • Molecular marker linked with capsicum annuum L. fruitlet gene, and application

    CN111394508A

  • Capsicum frutescens fruit shape gene CaFS1, KASP molecular marker linked with capsicum frutescens fruit shape gene CaFS1, primer of molecular marker, obtaining method and application of molecular marker

    CN117248064A

  • KASP molecular marker closely linked with pepper fruit width gene as well as acquisition method, primer, kit and application of KASP molecular marker

    CN117965784A

  • InDel molecular marker closely linked with pepper fruit width gene, primer, kit and application

    CN118028515A

  • Marker for determining spiciness of pepper pericarp, and use thereof

    WO2020004718A1

Cited By

  • KASP molecular marker closely linked with pepper fruit length, primer, kit and application

    CN121653288A

  • KASP molecular marker related to pepper fruit width, primer group, kit and application of KASP molecular marker

    CN122303477A