A molecular marker located on chromosome 5 and related to alfalfa yield and its application

Abstract

The present invention belongs to the technical field of molecular markers, and discloses a molecular marker located on chromosome 5 and related to alfalfa yield and its application. The upstream primer sequence of the primer pair for amplifying the molecular marker is shown as SEQ ID NO.1, and the downstream primer sequence is shown as SEQ ID NO.2. The molecular marker is located on chromosome 5 of alfalfa, and the nucleotide sequence of its insertion or deletion fragment is shown as SEQ ID NO.3 in the sequence table. The InDel molecular marker and primer pair provided by the present invention can predict, identify or assist in identifying the yield trait of alfalfa. At the same time, the present invention also provides a method for identifying alfalfa yield using the InDel molecular marker, which is simple and fast, has accurate identification results, and has good prospects for promotion and application.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker located on chromosome 5 and related to alfalfa yield and an application thereof. Technical Background

[0002] Alfalfa (Medicago sativa, 2n=4x=32) is a perennial herbaceous plant of the genus Medicago in the Leguminosae family. It has excellent drought and salt resistance and is very suitable for cultivation in most areas of northern my country. Alfalfa is rich in protein, has a good taste, and has extremely high feeding value and nutritional value, so it is known as the "king of forage". With the increasing demand for meat, eggs and dairy products, animal husbandry is facing higher development requirements. Alfalfa, as a plant with extremely high protein content, is crucial to the development of animal husbandry. Therefore, cultivating high-yield and high-quality new alfalfa varieties is of great significance to increasing the yield of alfalfa and promoting the development of forage and animal husbandry. However, due to the characteristics of alfalfa such as cross-pollination and self-incompatibility, forage breeding is still dominated by traditional hybrid breeding, which not only has a slow and complex breeding process, but also has trait separation in the offspring. Molecular marker-assisted breeding has attracted much attention due to its short breeding cycle, high efficiency, strong accuracy and simple operation, and has gradually become a hot spot in breeding research.

[0003] As one of the efficient methods for analyzing quantitative traits, whole-genome association analysis searches for genetic information related to complex traits by typing large-scale population DNA samples with high-density genetic markers throughout the genome. This method can quickly identify key genetic variation sites, making great contributions to the genetic analysis of complex quantitative traits, and has become one of the important hot spots and competitive areas in the current breeding field. Fresh weight is a typical quantitative trait that best reflects the yield of plants. Screening with fresh weight as a yield-related trait is crucial for cultivating high-yield plants, ensuring my country's food security, and improving the ecological environment. However, due to the late start of alfalfa breeding, the development and positioning of yield-related markers combined with whole-genome association analysis are relatively limited. Therefore, the study of alfalfa yield-related molecular markers provides theoretical support and genetic resources for high-yield molecular genetic improvement and new variety breeding of alfalfa. Summary of the invention

[0004] One of the purposes of the present invention is to provide a molecular marker located on chromosome 5 and related to alfalfa yield.

[0005] The second object of the present invention is to provide the application of the molecular marker located on chromosome 5 and related to alfalfa yield.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention discloses a molecular marker related to alfalfa yield, which is located on chromosome 5 of alfalfa and is named Ms_Chr5_95602500.

[0008] The primer pair for amplifying the above molecular markers has the following sequence:

[0009] Ms_Chr5_95602500-F: (shown in SEQ ID NO.1);

[0010] Ms_Chr5_95602500-R: (shown in SEQ ID NO.2);

[0011] The present invention also discloses the application of the molecular marker primer pair in alfalfa yield-assisted breeding. That is to say, the molecular marker of the present invention can be used in future molecular marker-assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the yield-related traits of alfalfa varieties. The detection can use a PCR detection method, specifically the molecular marker primer pair, and the detection can also be performed by a sequencing method.

[0012] The present invention also discloses the application of the molecular marker in identifying the yield trait of alfalfa, especially in screening and identifying the high and low yield of alfalfa. Specifically, the specific steps for identifying whether alfalfa has the high-yield trait are as follows:

[0013] (1) The DNA of the test germplasm was used as the template for PCR amplification, and the markers Ms_Chr5_95602500-F and Ms_Chr5_95602500-R were used as primers. The reaction system of PCR amplification was as shown in Table 1:

[0014]

[0015] Pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 58°C for 5s, extension at 72°C for 2s, 35 cycles; extension at 72°C for 5min; storage at 4°C.

[0016] (2) Agarose gel electrophoresis detection of PCR products: Take 3.5 μL and judge the alfalfa yield results based on the band results.

[0017] (3) PCR amplification was performed using primer pairs Ms_Chr5_95602500-F and Ms_Chr5_95602500-R. If the PCR amplification product had only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa was a high-yield type; if the PCR amplification product had both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 280 bp as shown in SEQ ID NO.5, the alfalfa was a low-yield type.

[0018] (4) In addition, the present invention also protects a kit for identifying alfalfa yield traits, wherein the kit comprises primer pairs Ms_Chr5_17258541-F and Ms_Chr5_17258541-R. The other components of the kit are all conventional reagents. Specifically, they also include 10×PCR Buffer, dNTP and Taq DNA polymerase. The present invention has no special restrictions on the concentration of the primer pair, and the primer concentrations well known in the art can be used. The present invention has no special restrictions on the sources of the 10×PCR Buffer, dNTP and Taq DNA polymerase, and ordinary PCR amplification reagents well known in the art can be used.

[0019] (5) The kit of the present invention can be used to quickly identify the yield traits of alfalfa, and can also quickly identify the yield genotype of alfalfa. The specific method refers to identifying whether alfalfa has high-yield traits. The specific steps are: by performing electrophoresis detection and / or sequencing on the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 280 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous low-yield genotype. The present invention has the following advantages:

[0020] (1) Screening with markers linked to yield traits is conducive to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0021] (2) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, quickly and high-throughput applied to alfalfa high-yield breeding practice and variety identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1The whole genome association analysis result of alfalfa drought tolerance is a Manhattan diagram obtained based on MLM model analysis. The green dots indicate the Indel positions associated with the present invention.

[0023] Figure 2 The figure is a box plot of Fresh Weight distribution corresponding to the genotype of the Ms_Chr5_95602500 locus of the alfalfa population of the present invention; 0 / 0 means that the genotype of the Ms_Chr5_95602500 locus is a homozygous high-yield genotype, and 0 / 1 means that the Ms_Chr5_95602500 locus is a heterozygous low-yield genotype; the dots are extreme values ​​of the data, and One way ANOVA tests the differences.

[0024] Figure 3 This is the partial sequence comparison result of high-yield varieties and low-yield varieties in the yield-related region.

[0025] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 15 alfalfa germplasm resources. The concentration of agarose gel is 2%.

[0026] In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0028] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0029] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0030] Example 1 Development of molecular markers related to alfalfa yield

[0031] The present invention uses the fresh weight of alfalfa at the initial flowering stage to measure the yield of alfalfa. The higher the value, the higher the yield of alfalfa; the lower the ratio value, the lower the yield of alfalfa. After measuring the Fresh Weight of the alfalfa population, an InDel site was located in alfalfa through GWAS analysis ( Figure 1 The red locus is named Ms_Chr5_95602500. This locus is located at the 95602500th locus on chromosome 5 of the alfalfa reference genome, where the first allele type is 0 / 0; the second allele type is 0 / 1. The Ms_Chr5_95602500 yield distribution box plot corresponding to the genotype of the population Ms_Chr5_95602500 locus ( Figure 2 ), indicating that the yield of alfalfa strains with genotype 0 / 0 was significantly higher than that of alfalfa strains with genotype 0 / 1. (shown in SEQ ID NO.3) Figure 3 ), which has an impact on the yield of alfalfa. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is a low-yield alfalfa; the alfalfa without the fragment shown in SEQ ID NO.3 is a high-yield alfalfa.

[0032] According to the InDel variation and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0033] Ms_Chr5_95602500-F: (shown in SEQ ID NO.1);

[0034] Ms_Chr5_95602500-R: (shown in SEQ ID NO.2);

[0035] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous high-yield alfalfa sample had only a 250bp characteristic band, and the PCR product of the heterozygous alfalfa sample had both a 250bp characteristic band and a 280bp characteristic band.

[0036] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0037] 15 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0038] Table 2 Yield and genotypes of 15 germplasm materials

[0039] Germplasm name genotype Fresh Weight Knight T 0 / 0 1.072222 CF005594 0 / 0 1.138889 WL323 0 / 0 1.176667 CF050068 0 / 0 1.194444 CF048291 0 / 0 1.215556 Huaiyang No.4 0 / 0 1.226667 SK3010 0 / 0 1.261111 crown 0 / 0 1.397778 Long Yin BeZa87 0 / 0 1.422222 Ranger 0 / 1 0.585556 Zhongmu No.4 0 / 1 0.248 Thunder 0 / 1 0.256667 P610821619 0 / 1 0.38 WISFAL 0 / 1 0.456667 Apex 0 / 1 0.65

[0040] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0041] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 0.5μL, 10μM reverse primer 0.5μL, 2×Phanta Flash Mix 5μL, deionized water to 10μL; the reaction program of PCR amplification is preferably: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 59℃ annealing for 5s, 72℃ extension for 2s, 35 cycles; 72℃ extension for 5min; 4℃ storage. 2% agarose gel electrophoresis separation, after spotting, electrophoresis at 130V DC voltage for 2h, and then read the PCR band type of each sample.

[0042] 2) judging the yield of alfalfa according to the size of the PCR product: when the PCR product of the alfalfa to be identified lacks the fragment shown in SEQ ID NO.3, the alfalfa to be identified is a high-yield alfalfa;

[0043] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is a low-yield alfalfa;

[0044] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 280 bp, and the alfalfa to be identified is low-yield alfalfa.

[0045] The sequence of SEQ ID NO.4 is as follows:

[0046]

[0047] When the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, and the band length of the PCR product is 250 bp, the alfalfa to be identified is a high-yield alfalfa.

[0048] The sequence of SEQ ID NO.5 is as follows:

[0049]

[0050] And, from Figure 4As can be seen from Table 1, 9 alfalfa materials only amplified a 250bp characteristic band, and the identification result was pure and high-yield genotype (0 / 0). After measurement, the average fresh weight of these 9 alfalfa materials was 1.234g; 6 alfalfa materials amplified both a 250bp characteristic band and a 280bp characteristic band, and the identification result was heterozygous low-yield type (0 / 1). After measurement, the average fresh weight of these 6 alfalfa materials was 0.429g, which was lower than the average value of 9 high-yield alfalfa. Variance analysis showed that the fresh weight of high-yield genotype and low-yield genotype was significantly different (P<0.05).

[0051] The PCR detection result is consistent with the actual fresh weight weighing result, so the InDel molecular marker of the present invention can effectively identify the yield of alfalfa and can be used for the prediction and screening of high-yield alfalfa varieties.

[0052] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 5 and associated with alfalfa yield, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment AACAACATTCTTGTCTTGCTCAAAAAAAAA on chromosome 5 of the alfalfa reference genome. The sequence of the primer pair for amplifying the molecular marker is: Ms_Chr5_95602500-F: CAATTGTTTATTGGTTCGGTTACAGTCAGTC; Ms_Chr5_95602500-R:ATCTACGTAGGTAAAGAATGGTAC.

2. Use of the primer pair of molecular markers described in claim 1 in identifying the yield traits of alfalfa.

3. A method for identifying yield traits of alfalfa, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification was performed using primer pairs Ms_Chr5_95602500-F and Ms_Chr5_95602500-R. If the PCR amplification product had only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa was a high-yield type; if the PCR amplification product had both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 280 bp as shown in SEQ ID NO.5, the alfalfa was a low-yield type.

4. A kit for use in identifying alfalfa yield genotypes, characterized in that: The kit comprises a primer pair for the molecular marker described in claim 1.

5. The use according to claim 4, characterized in that: The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa is a high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 280 bp as shown in SEQ ID NO.5, the alfalfa is a low-yield genotype.

Images