Target segment and double-stranded RNA for preventing and treating tomato brown crinkled fruit virus in tobacco and application of target segment and double-stranded RNA

Abstract

The invention discloses a target segment for preventing and treating tomato brown fruit wrinkling virus in tobacco, double-stranded RNA (Ribonucleic Acid) and application of the target segment and the double-stranded RNA. Wherein the nucleotide sequence of the target segment is as shown in SEQ ID NO.3, or a sequence which is as shown in SEQ ID NO.3, has at least 90% of homology and has coded amino acid as shown in SEQ ID NO.4 is substituted. The invention also discloses a double-stranded RNA of a targeted interference target section, and the double-stranded RNA can significantly inhibit the proliferation of the tomato brown crinkled fruit virus in tobacco by injecting or smearing tobacco leaves, so that the double-stranded RNA can be effectively applied to prevention and control of tobacco diseases caused by the tomato brown crinkled fruit virus. The method for preventing and controlling the tomato brown crinkled fruit virus in the tobacco by using the double-stranded RNA is safe, harmless and efficient, and provides a new path for preventing and controlling plant virus diseases by using RNAi (Ribonucleic Acid Interference).

Description

Technical Field

[0001] The present invention belongs to the field of biological control, and specifically relates to a target segment, double-stranded RNA for controlling Tomato brown rugose fruit virus in tobacco, and their applications. Background Art

[0002] Tomato brown rugose fruit virus (ToBRFV) belongs to the family Virgaviridae, genus Tobamovirus.

[0003] The main natural hosts of this virus in the field are tomato and pepper. Under laboratory conditions, through artificial mechanical friction inoculation, ToBRFV can infect more than 40 plant species in multiple families such as Amaranthaceae, Apocynaceae, Asteraceae, and Solanaceae. Once a plant is infected with ToBRFV, the incidence rate will be extremely high, which will seriously affect the quality and yield of crops, causing serious economic losses.

[0004] RNA interference (RNAi), abbreviated as RNAi, refers to the process in which mRNA homologous to double-stranded RNA (dsRNA) is specifically degraded under the action of double-stranded RNA, and it is a gene silencing mechanism at the post-transcriptional level. Precise disease control based on the RNAi mechanism of plants is considered a plant protection strategy with important and great application prospects. Currently, the applications in this area are mainly in the form of constructing transgenic plants and host-induced gene silencing (HIGS). And activating the immune mechanism of plants by exogenous application of dsRNA to target and inhibit virus infection is considered to be more environmentally friendly, sustainable and acceptable to the public compared with transgenic technology. Therefore, developing a double-stranded RNA for targeted control of ToBRFV is beneficial to establishing a new effective method for controlling ToBRFV and has great application prospects. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a target segment, double-stranded RNA for controlling Tomato brown rugose fruit virus in tobacco, and their applications. The present invention uses RNAi technology to target the coding segment at the C-terminus of the P126 protein of Tomato brown rugose fruit virus by exogenous use of double-stranded RNA, so as to inhibit the proliferation level of the virus in tobacco, reduce the content of the virus, and alleviate the pathogenic symptoms. This method is safe, harmless and efficient, and can provide a new path for using RNAi to control plant virus diseases.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, a target segment for controlling tomato brown rugose fruit virus in tobacco is provided. The nucleotide sequence of the target segment is as shown in SEQ ID NO.3, or a sequence with at least 90% homology to the sequence shown in SEQ ID NO.3 after substitution and encoding amino acids as shown in SEQ ID NO.4.

[0008] In the second aspect of the present invention, a double-stranded RNA for controlling tomato brown rugose fruit virus in tobacco is provided. The double-stranded RNA is a double-stranded RNA that targets and interferes with the above-mentioned target segment.

[0009] Preferably, the double-stranded RNA is synthesized by using SEQ ID NO.5 and SEQ ID NO.6 as primers, amplifying with the target segment as a template, and then using an in vitro transcription method.

[0010] Preferably, the double-stranded RNA is composed of the nucleotide sequence shown in SEQ ID NO.7 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.7.

[0011] In the third aspect of the present invention, an application of the above double-stranded RNA in inhibiting the proliferation of tomato brown rugose fruit virus in tobacco is provided.

[0012] In the fourth aspect of the present invention, an application of the above double-stranded RNA in controlling tobacco diseases caused by tomato brown rugose fruit virus is provided.

[0013] In the fifth aspect of the present invention, a biological drug for controlling tobacco diseases caused by tomato brown rugose fruit virus is provided. The active ingredient of the biological drug contains at least the above double-stranded RNA.

[0014] In the sixth aspect of the present invention, a method for controlling tobacco diseases caused by tomato brown rugose fruit virus is provided. By targeting and interfering with the above-mentioned target segment, the proliferation of tomato brown rugose fruit virus in tobacco is inhibited.

[0015] Preferably, the method is to inject a solution containing the above double-stranded RNA or the above biological drug into the veins of tobacco leaves and / or directly apply it to the surface of tobacco leaves.

[0016] The beneficial effects of the present invention are as follows:

[0017] (1) The present invention provides a target segment that can effectively control tomato brown rugose fruit virus in tobacco and a double-stranded RNA of the target segment. The double-stranded RNA can effectively inhibit the proliferation of the virus, reduce the content of the virus in tobacco, and is beneficial to reducing the pathological damage of the virus to the host. It has good application prospects in the prevention and control of tomato brown rugose fruit virus.

[0018] (2) The method of using double-stranded RNA in the present invention to control Tomato brown rugose fruit virus in tobacco is highly specific and safe for humans or animals. While effectively controlling the diseases caused by Tomato brown rugose fruit virus, it helps to reduce the usage amount of chemical pesticides. It neither has the problem of drug resistance nor pollutes the environment, being safe, harmless and highly efficient, providing a new path for the prevention and control of plant virus diseases using RNAi. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a schematic structural diagram of the position of the target segment in the ToBRFV genome in Example 1 of the present invention;

[0020] Figure 2 It is an agarose gel electrophoresis detection diagram of the double-stranded RNA synthesized in Example 1 of the present invention;

[0021] Figure 3 It is a schematic diagram of the detection of Tomato brown rugose fruit virus content after injecting double-stranded RNA into infected tobacco leaves in Example 2 of the present invention, where CK is the control group and ds126 is the double-stranded RNA injection group;

[0022] Figure 4 It is a schematic diagram of plant symptoms after injecting double-stranded RNA into infected tobacco leaves in Example 2 of the present invention, where Control is the control group and ds126 is the double-stranded RNA injection group;

[0023] Figure 5 It is a schematic diagram of the detection of Tomato brown rugose fruit virus content after smearing double-stranded RNA on infected tobacco leaves in Example 3 of the present invention, where CK is the control group and ds126 is the double-stranded RNA smearing group. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] In order to make the objectives and technical solutions of the present invention clearer and more complete, the following further describes the present invention in detail with reference to the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. It should be understood that the specific embodiments described herein are only used to explain the present invention, and are not used to limit the present invention. Those skilled in the art make modifications or equivalent replacements based on the understanding of the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all belong to the scope of protection of the present invention.

[0025] Unless otherwise specified, the reagents and materials involved in the embodiments of the present invention are commercially available products and can all be obtained through commercial channels. The various processes and methods not described in detail in the embodiments of the present invention are conventional methods well known in the art.

[0026] TERM EXPLANATION:

[0027] European and Mediterranean Plant Protection Organization (EPPO) PM 7 / 146(1): It is the diagnostic protocol standard for Tomato brown rugose fruit virus issued by the European and Mediterranean Plant Protection Organization (EPPO);

[0028] CaTa28 method: A specific primer combination recommended by European and Mediterranean Plant Protection Organization (EPPO) PM 7 / 146(1) for the detection of Tomato brown rugose fruit virus (ToBRFV). This method uses TaqMan fluorescence quantitative RT-qPCR technology, designs primers and probes for specific gene sequences of ToBRFV, and is used for the rapid and sensitive detection of the virus.

[0029] Example 1: Acquisition of target segment and synthesis of double-stranded RNA

[0030] It should be noted that, as Figure 1 shown, the genome of Tomato brown rugose fruit virus ToBRFV contains 4 open reading frames. Among them, ORF1 encodes a 126 kDa protein (P126), which contains methyltransferase and helicase functional domains. The target segment in this example is located in the C-terminal region of the P126 protein. Specifically, total RNA is extracted from frozen diseased tomato leaves infected with ToBRFV. After detecting that the RNA quality and concentration meet the requirements, 1 microgram of RNA is taken for reverse transcription reaction to obtain cDNA, and the reverse transcription system is 10 microliters. The reverse transcription reaction solution is diluted 10 times, that is, 9.8 microliters of the reaction solution is diluted to 89.2 microliters of double-distilled water. The diluted cDNA reaction solution is used as a template, and polymerase chain reaction (PCR) amplification is carried out using the upstream specific primer ToBRFV-P126-F (SEQ ID NO.1) and the downstream specific primer ToBRFV-P126-R (SEQ ID NO.2) of the target segment. The primer sequences are as follows:

[0031] ToBRFV-P126-F: GCGGTGTCGAACCTAGTCAA (SEQ ID NO.1);

[0032] ToBRFV-P126-R: GCAGCGCCTCTTTATCAGAC (SEQ ID NO.2).

[0033] After that, the amplification product is ligated to the pMD-19T vector, screened for replication, sequenced, and the correctly sequenced recombinant plasmid is extracted and stored at -20 °C for later use. Among them, the nucleotide sequence of the target segment is as shown in SEQ ID NO.3, and the encoded amino acid sequence is as shown in SEQ ID NO.4.

[0034] GCGGTGTCGAACCTAGTCAAGATCCTAAAGGATACAGCTGCTATAGATCTCGAAACCCGTCAGAAGTTTGGAGTCTTAGATGTTGCGACCAAAAGATGGTTAATTAAACCTTTAGCCAAGAATCACGCATGGGGCGTTATTGAAACACATGCTAGGAAGTACCACGTTGCACTTTTGGAGTATGATGAGCATGGAGTGGTAACTTGCGACAGTTGGAGAAGGGTGGCCGTGAGTTCTGAGTCAATGGTTTATTCTGATATGGCAAAGCTCAGAACACTGAGGAGATTATTAAGAGATGGTGAGCCTCATGTCAGCAGTGCTAAAGTCGTCCTAGTTGACGGTGTCCCGGGTTGTGGAAAGACAAAAGAGATTCTCTCGAAAGTAAATTTTGAGGAAGATCTAATCTTAGTACCGGGTAAGCAGGCTGCTGAAATGATAAAGAGGCGTGCTAATGCGTCAGGAATAATTCAAGCCACAAGAGATAATGTTCGTACTGTTGATTCATTTATAATGAATTACGGTAAAGGAACACGCTGTCAGTTCAAAAGGTTATTTATCGACGAAGGTCTGATGTTGCACACTGGTTGTGTGAATTTTCTTGTTTCTATGTCTCTGTGCGAAATTGCATATGTTTATGGAGACACACAACAAATTCCATACATCAACAGAGTATCCGGTTTTCCGTACCCTGCACATTTTGCAAAAATAGAGGTTGATGAGGTGGAAACTCGCAGAACTACGCTGCGTTGTCCAGCCGACATTACCCACTATCTTAACAGAAGGTACGAAGGATATGTCATGTGTACATCGTCGGTTAAAAAGTCAGTTTCTCAGGAAATGGTGAGCGGGGCCGCAATGATCAATCCTGTATCTAAGCCATTGAATGGGAAAGTTTTGACTTTCACTCAGTCTGATAAAGAGGCGCTGC(SEQ ID NO.3)

[0035] AVSNLVKILKDTAAIDLETRQKFGVLDVATKRWLIKPLAKNHAWGVIETHARKYHVALLEYDEHGVVTCDSWRRVAVSSESMVYSDMAKLRTLRRLLRDGEPHVSSAKVVLVDGVPGCGKTKEILSKVNFEEDLILVPGKQAAEMIKRRANASGIIQATRDNVRTVDSFIMNYGKGTRCQFKRLFIDEGLMLHTGCVNFLVSMSLCEIAYVYGDTQQIPYINRVSGFPYPAHFAKIEVDEVETRRTTLRCPADITHYLNRRYEGYVMCTSSVKKSVSQEMVSGAAMINPVSKPLNGKVLTFTQSDKEAL(SEQ ID NO.4)

[0036] Further, the upstream specific primer dsP126a-F (SEQ ID NO.5) with a T7 promoter at the N-terminus and the downstream specific primer dsP126a-R (SEQ ID NO.6) with a T7 promoter at the N-terminus were used to perform PCR amplification with the above-mentioned recombinant plasmid with correct sequencing as the template. It should be understood that PCR amplification can also be performed with a DNA sequence that has at least 90% homology with SEQ ID NO.3 after substitution and encodes an amino acid as shown in SEQ ID NO.4 as the template. The primer sequences are as follows:

[0037] dsP126a-F: TAATACGACTCACTATAGGGGAGCCTCATGTCAGCAGTGC(SEQ ID NO.5);

[0038] dsP126a-R: TAATACGACTCACTATAGGGGTGGGTAATGTCGGCTGGAC(SEQ ID NO.6).

[0039] After that, the above-mentioned PCR product with a T7 promoter was used as the template, and double-stranded RNA was synthesized according to the instructions of the MEGAscript T7 in vitro transcription kit. The synthesized double-stranded RNA was composed of the nucleotide sequence shown in SEQ ID NO.7 and the nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.7, with a size of 468 bp. The synthesized double-stranded RNA was detected using 1% agarose gel( Figure 2 ), and it was found that the size was consistent with the expected target fragment, indicating that the double-stranded RNA targeting and interfering with the target segment was successfully synthesized in vitro and stored at -80 °C for later use.

[0040] GAGCCUCAUGUCAGCAGUGCUAAAGUCGUCCUAGUUGACGGUGUCCCGGGUUGUGGAAAGACAAAAGAGAUUCUCUCGAAAGUAAAUUUUGAGGAAGAUCUAAUCUUAGUACCGGGUAAGCAGGCUGCUGAAAUGAUAAAGAGGCGUGCUAAUGCGUCAGGAAUAAUUCAAGCCACAAGAGAUAAUGUUCGUACUGUUGAUUCAUUUAUAAUGAAUUACGGUAAAGGAACACGCUGUCAGUUCAAAAGGUUAUUUAUCGACGAAGGUCUGAUGUUGCACACUGGUUGUGUGAAUUUUCUUGUUUCUAUGUCUCUGUGCGAAAUUGCAUAUGUUUAUGGAGACACACAACAAAUUCCAUACAUCAACAGAGUAUCCGGUUUUCCGUACCCUGCACAUUUUGCAAAAAUAGAGGUUGAUGAGGUGGAAACUCGCAGAACUACGCUGCGUUGUCCAGCCGACAUUACCCAC(SEQ ID NO.7)

[0041] Example 2 Injection of double-stranded RNA into tobacco leaves to inhibit virus proliferation and pathogenesis

[0042] Using typical Nicotiana benthamiana leaves infected with ToBRFV, after grinding and filtering, a crude virus extract was prepared. Healthy Nicotiana benthamiana plants with 4-5 leaves were selected for rubbing inoculation. The specific inoculation method was as follows: select the first and second leaves (inoculation leaves) from the bottom up except for the cotyledons of the plant, sprinkle a thin layer of carborundum on the leaf surface, hold the back of the leaf with the left hand, dip the right index finger in the virus sap, gently rub it 2 times on the leaf surface with carborundum, and immediately rinse the leaf with a wash bottle. 100 μL was inoculated on each leaf.

[0043] At 12 hours after inoculation, select the third and fourth leaves (systemic leaves) from the bottom up except for the cotyledons of the plants, and use a 1-milliliter syringe to inject 0.5 milliliters of double-stranded RNA solution on both sides of the main vein of each leaf. On the 5th day after virus inoculation, collect the systemic leaves and perform virus quantification detection by RT-qPCR (TaqMan method), and take pictures and record the symptoms of Nicotiana benthamiana. The virus quantification detection uses the CaTa28 method recommended by the European Union (EPPO) PM 7 / 146(1), and the specific primers are CaTa28-F (SEQ ID NO.8) and CaTa28-R (SEQ ID NO.9). At the same time, set up a control group. At 12 hours after inoculation, collect the systemic leaves and inject double-distilled water, and also perform virus quantification detection and take pictures and record the symptoms. The primer sequences are as follows:

[0044] CaTa28-F: GGTGGTGTCAGTGTCTGTTT (SEQ ID NO.8);

[0045] CaTa28-R: GCGTCCTTGGTAGTGATGTT (SEQ ID NO.9).

[0046] As Figure 3 shown, the results of virus quantification of ToBRFV showed that the virus titer on the Nicotiana benthamiana leaves injected with double-stranded RNA was significantly lower than that of the control group. And, as Figure 4 shown, compared with the control group, the diseased symptoms of the Nicotiana benthamiana leaves injected with double-stranded RNA were not obvious.

[0047] Example 3 Suppression of virus proliferation by applying double-stranded RNA on tobacco leaves

[0048] Use the Nicotiana benthamiana leaves infected with typical ToBRFV, after grinding and filtering, make a crude virus extract, select healthy Nicotiana benthamiana plants with 4-5 leaves for rubbing inoculation. The specific inoculation method is as follows: select the first and second leaves (inoculation leaves) from the bottom up except for the cotyledons of the plants, sprinkle a thin layer of carborundum on the leaves, hold the back of the leaves with the left hand, dip the right index finger in the virus juice, and gently rub it 2 times on the leaf surface with carborundum, and immediately rinse the leaves with a wash bottle. Inject 100 microliters into each leaf.

[0049] At the same time as virus inoculation, select the third and fourth leaves (systemic leaves) from the bottom up except for the cotyledons of the plants, and apply 100 microliters of double-stranded RNA solution on each leaf respectively. On the 5th day after virus inoculation, collect the systemic leaves for virus quantitative PCR detection, and the detection method is the same as that in Example 2. At the same time, set up a plant that only applies double-distilled water as a blank control, and also perform virus quantitative PCR detection.

[0050] As Figure 5As shown, the results of virus quantification of ToBRFV showed that the virus titer on Nicotiana benthamiana leaves smeared with double-stranded RNA was significantly lower than that of the control group.

[0051] It should be noted that the double-stranded RNA involved in the embodiments of the present invention includes, but is not limited to, having a significant inhibitory effect on the proliferation and pathogenesis of ToBRFV in tobacco, and also having varying degrees of inhibitory effects in other species that can be infected by the virus, such as tomatoes, peppers, etc.

Claims

1. A target segment for controlling tomato brown wrinkled fruit virus in tobacco, characterized in that: The nucleotide sequence of the target segment is as shown in SEQ ID NO.3, or is substituted with a sequence having at least 90% homology with SEQ ID NO.3 and encoding an amino acid as shown in SEQ ID NO.

4.

2. A double-stranded RNA for preventing and treating tomato brown fruit virus in tobacco, characterized in that: The double-stranded RNA is a double-stranded RNA that targets and interferes with the target segment described in claim 1.

3. The double-stranded RNA for preventing and treating tomato brown fruit virus in tobacco according to claim 2, characterized in that: The double-stranded RNA is synthesized by in vitro transcription using SEQ ID NO.5 and SEQ ID NO.6 as primers and the target segment as a template for amplification.

4. The double-stranded RNA for preventing and treating tomato brown fruit virus in tobacco according to claim 3, characterized in that: The double-stranded RNA consists of the nucleotide sequence shown in SEQ ID NO.7 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.

7.

5. Use of the double-stranded RNA according to any one of claims 2 to 4 in inhibiting the proliferation of tomato brown wrinkle fruit virus in tobacco.

6. Use of the double-stranded RNA according to any one of claims 2 to 4 in preventing and treating tobacco diseases caused by tomato brown wrinkled fruit virus.

7. A biological drug for preventing and controlling tobacco diseases caused by tomato brown wrinkled fruit virus, characterized in that: The active ingredient of the biopharmaceutical contains at least the double-stranded RNA according to any one of claims 2 to 4.

8. A method for preventing and controlling tobacco diseases caused by tomato brown fruit virus, characterized in that: Targeted interference with the target segment described in claim 1, thereby inhibiting the proliferation of tomato brown wrinkled fruit virus in tobacco.

9. The method according to claim 8, characterized in that The solution containing the double-stranded RNA according to any one of claims 2 to 4 or the biological drug according to claim 7 is injected into the veins of tobacco leaves and / or directly applied to the surface of tobacco leaves.

Images