Alfalfa yield identification method, molecular marker and application

Abstract

The invention belongs to the technical field of molecular markers, and discloses an alfalfa yield identification method, a molecular marker and application, a nucleotide sequence of the molecular marker is shown as SEQ ID NO.4 or SEQ ID NO.5, an upstream primer sequence of a primer pair for amplifying the molecular marker is shown as SEQ ID NO.1, and a downstream primer sequence of the primer pair is shown as SEQ ID NO.2. The invention further discloses a method for identifying the yield of alfalfa. The molecular marker is located on a chromosome 5 of medicago sativa, and the nucleotide sequence of an insertion or deletion fragment of the molecular marker is shown as SEQ ID NO.3 in a sequence table. The InDel molecular marker and the primer pair provided by the invention can be used for predicting, identifying or assisting in identifying the yield traits of medicago sativa. Meanwhile, the invention further provides a method for identifying the alfalfa yield character by using the InDel molecular marker, and the method is simple, convenient and rapid, accurate in identification result and good in popularization and application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for identifying high and low yields of alfalfa, molecular markers and applications thereof. Technical Background

[0002] Alfalfa (Medicago sativa L.) is a perennial herb of the genus Medicago in the legume family and is one of the most widely distributed forages in the world. Its crude protein content can reach more than 20%, and it has good palatability. It is an excellent source of animal feed and is widely planted in northern China. With the increasing demand for meat, eggs and dairy products, the livestock industry faces higher development requirements. As a plant with extremely high protein content, alfalfa is crucial for the development of the livestock industry. Therefore, cultivating new high-yield and high-quality alfalfa materials is of great significance for increasing the yield of alfalfa and promoting the development of the forage and livestock industries.

[0003] With the continuous development and improvement of modern biological genetic technologies, scholars have increasingly emphasized the use of molecular marker technologies to assist genetic breeding in order to improve breeding efficiency and eliminate blindness in the breeding process. Marker breeding technology selects target trait genes by tracking genetic markers, thereby achieving the goal of new material selection. This technology has advantages such as accuracy, speed, and high efficiency, and has been widely applied in more and more crops. Genome-wide association studies (GWAS) is one of the efficient methods for analyzing quantitative traits. By performing genome-wide high-density genetic marker typing on large-scale population DNA samples, genetic information related to complex traits is sought. The present invention constructs a population using 231 alfalfa materials, performs resequencing on them, and combines fresh weight traits for genome-wide association analysis, and develops an InDel locus related to yield. The present invention provides theoretical support and gene resources for the high-yield molecular genetic improvement and new material selection of alfalfa. Summary of the Invention

[0004] One of the purposes of the present invention is to provide an InDel molecular marker related to alfalfa yield.

[0005] Another purpose of the present invention is to provide the application of the above InDel molecular marker located on chromosome 5 and related to alfalfa yield.

[0006] To achieve the above purposes, the present invention adopts the following technical solutions:

[0007] The present invention discloses a molecular marker related to alfalfa yield, which is located on chromosome 5 of alfalfa, and the molecular marker is named Ms_Chr5_62298092.

[0008] The primer pair for amplifying the above molecular marker, and the primer pair sequences are as follows:

[0009] Ms_Chr5_62298092-F: GAACGAATTGTGTTGCAGCTGATCC (shown in SEQ ID NO.1);

[0010] Ms_Chr5_62298092-R: GAGCCTTGATCATTGTTGCTCCAAG (shown in SEQ ID NO.2);

[0011] The present invention also discloses the application of the above molecular marker primer pair in the yield-assisted breeding of alfalfa. That is to say, the molecular marker of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting whether the molecular marker of the present invention exists, the yield-related traits of alfalfa materials can be identified. The detection can use the PCR detection method, specifically, the above molecular marker primer pair can be used, and the detection can also be carried out by sequencing.

[0012] The present invention also discloses the application of the above molecular marker in the identification of alfalfa yield traits, especially in the screening and identification of high and low alfalfa yields. Specifically, the specific steps for identifying whether alfalfa has high-yield traits are as follows:

[0013] (1) Using the DNA of the test germplasm as the template for PCR amplification, and using the markers Ms_Chr5_62298092-F and Ms_Chr5_62298092-R as primers, the reaction system for PCR amplification is shown in Table 1:

[0014] Table 1 Reaction system for PCR amplification

[0015]

[0016] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 10 min; preservation at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 5 μL and judge the alfalfa yield result according to the band result.

[0018] Use the primer pair Ms_Chr5_62298092-F and Ms_Chr5_62298092-R for PCR amplification. If the PCR amplification product has only one characteristic band with a length of 379 bp as shown in SEQ ID NO.4, then the alfalfa is of the high-yield type; if the PCR amplification product has both a characteristic band with a length of 379 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 358 bp as shown in SEQ ID NO.5, then the alfalfa is of the low-yield type.

[0019] In addition, the present invention also protects a kit for identifying the yield traits of alfalfa. The kit contains the primer pair Ms_Chr5_62298092-F and Ms_Chr5_62298092-R. The other components of the kit are all conventional reagents. Specifically, it also includes PCR Buffer, dNTP, and Taq DNA polymerase. The present invention has no special limitation on the concentration of the primer pair, and the well-known primer concentration in the art can be used. The present invention has no special limitation on the sources of the PCR Buffer, dNTP, and Taq DNA polymerase, and the ordinary reagents for PCR amplification well-known in the art can be used.

[0020] Using the kit of the present invention can quickly identify the yield traits of alfalfa and can also quickly identify the yield genotypes of alfalfa. The specific method refers to the method for identifying whether alfalfa has high-yield traits. The specific steps are as follows: By performing electrophoresis detection and / or sequencing on the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 379 bp as shown in SEQ ID NO.4, then the alfalfa is of the homozygous high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 379 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 358 bp as shown in SEQ ID NO.5, then the alfalfa is of the heterozygous low-yield genotype.

[0021] The present invention has the following advantages:

[0022] (1) Screening with markers linked to yield traits is beneficial to molecular marker-assisted selection breeding. Its method is simple and feasible, which is beneficial to improving efficiency and saving costs.

[0023] (2) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification products, and high specificity, and can be simply, quickly, and high-throughput applied to the high-yield breeding practice and material identification of alfalfa. Description of the Drawings

[0024] Figure 1This is the result of the genome-wide association analysis of alfalfa yield, which is a Manhattan plot obtained by analyzing with the EMMAX software. The positions of the InDels associated with the present invention are indicated by the green dots.

[0025] Figure 2 This is the box plot of the fresh weight corresponding to the genotypes of the Ms_Chr5_62298092 locus in the alfalfa population of the present invention; 0 / 0 means that the genotype of the Ms_Chr5_62298092 locus is a homozygous high-yield genotype, and 0 / 1 means that the Ms_Chr5_62298092 locus is a heterozygous low-yield genotype; the dots are the extreme values of the data, and **** represents P < 0.0001.

[0026] Figure 3 This is the partial sequence alignment result of the high-yield materials and the low-yield materials in the yield-associated region.

[0027] Figure 4 This is the electrophoresis map of the amplified molecular markers of 16 alfalfa germplasm resources, and the concentration of the agarose gel is 2.5%. M in the figure represents the DNA marker. Detailed implementation manners

[0028] The present invention will be further described below in combination with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following embodiments are all conventional methods or are implemented according to the conditions recommended in the manufacturer's instructions unless otherwise specified.

[0029] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The test methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained by purchasing from the market.

[0030] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are for illustrative purposes only.

[0031] Example 1 Development of molecular markers related to alfalfa yield

[0032] The present invention measures the alfalfa yield by the fresh weight at the early flowering stage of alfalfa (unit: kg). The higher this value, the higher the yield of alfalfa; the lower the value, the lower the yield of alfalfa. After measuring the fresh weight of the alfalfa population, through GWAS analysis, an InDel locus was mapped in alfalfa ( Figure 1The green locus), named Ms_Chr5_62298092. This locus is located at the 62298092nd locus on chromosome 5 of the alfalfa reference genome (by downloading the website: https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960, downloading the file "ZhongmuNo.1_genome.fasta.gz" is the Genome sequence of alfalfa). The first allele genotype is 0 / 0 type; the second allele genotype is 0 / 1 type. The box plot of the yield distribution corresponding to the genotype of the Ms_Chr5_62298092 locus in the population Figure 2 ), indicating that the yield of alfalfa lines with the genotype 0 / 0 is significantly higher than that of alfalfa with the genotype 0 / 1. At the 62298092nd locus on chromosome 5 of alfalfa, the insertion / deletion fragment TGTATTTCTAATCAAACTAAA (shown in SEQ ID NO.3) Figure 3 ), has an impact on the yield of alfalfa. Alfalfa with the inserted fragment shown in SEQ ID NO.3 is high-yield alfalfa; alfalfa lacking the fragment shown in SEQ ID NO.3 is low-yield alfalfa.

[0033] According to this InDel variation and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0034] Ms_Chr5_62298092-F: GAACGAATTGTGTTGCAGCTGATCC (shown in SEQ ID NO.1);

[0035] Ms_Chr5_62298092-R: GAGCCTTGATCATTGTTGCTCCAAG (shown in SEQ ID NO.2);

[0036] Then, the PCR amplification was carried out on the test samples using these primers. The results showed that the PCR product of the homozygous high-yield alfalfa sample had only a characteristic band of 379 bp, and the PCR product of the heterozygous low-yield alfalfa sample had both a characteristic band of 379 bp and a characteristic band of 358 bp.

[0037] Example 2 Verification of the accuracy of the molecular marker described in the present invention

[0038] 140 germplasm materials were identified. The specific germplasm materials used are shown in Table 2:

[0039] Yield of 2140 materials and genotypes corresponding to the Ms_Chr5_62298092 locus

[0040]

[0041]

[0042]

[0043] 1) Using the genomic DNA of the alfalfa to be identified as a template, PCR amplification is carried out using the primer pair to obtain a PCR product;

[0044] The reaction system for PCR amplification is as follows: 10 - 100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×SanTaq PCR Mix, and made up to 20 μL with deionized water; The reaction program for the PCR amplification is preferably: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 20 s, 35 cycles; extension at 72 °C for 10 min; preservation at 4 °C. Electrophoresis separation is carried out using 2.5% agarose gel. After loading the samples, electrophoresis is carried out at a direct current voltage of 120 V for 60 min, and then the PCR band patterns of each sample are read.

[0045] 2) Judging the high or low yield of alfalfa according to the size of the PCR product: When the fragment shown in SEQ ID NO.3 is missing in the PCR product of the alfalfa to be identified, then the alfalfa to be identified is a low-yield alfalfa;

[0046] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, then the alfalfa to be identified is a high-yield alfalfa;

[0047] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, and the band length of the PCR product is 379 bp, then the alfalfa to be identified is a high-yield alfalfa.

[0048] The sequence of SEQ ID NO.4 is as follows:

[0049]

[0050] When the fragment shown in SEQ ID NO.3 is missing in the PCR product of the alfalfa to be identified, and the band length of the PCR product is 358 bp, then the alfalfa to be identified is a low-yield alfalfa.

[0051] The sequence of SEQ ID NO.5 is as follows:

[0052]

[0053] Moreover, from Table 2 and Figure 2 it can be seen that 140 alfalfa samples were identified in this study. Among them, 98 alfalfa samples were identified as homozygous high-yield genotypes (0 / 0). After measurement, the average fresh weight of these 98 alfalfa samples was 1.07 kg. 42 alfalfa samples were identified as heterozygous low-yield types (0 / 1). After measurement, the average fresh weight of these 42 alfalfa samples was 0.56 kg, which was lower than the average value of the 98 high-yield alfalfa samples. Analysis of variance showed that there was a highly significant difference in fresh weight between high-yield genotypes and low-yield genotypes (P < 0.0001). Figure 4 The PCR detection results of 16 samples (CF048304, CF039888, Longyin BeZa87, Jueneng 601, Zhongmu No. 1, Qishi 2, CF002724, Arc, PI641378, CF020822, CF005603, PI672741, Aohan, CF039770, Jueneng 201, Wisfal) are shown. In the figure, only one band with a length of 379 bp was amplified from the 0 / 0 type samples, which was the genotype of homozygous high fresh weight and was consistent with the actual high fresh weight measurement results of the first 8 samples. For the 0 / 1 type samples, one band with a length of 379 bp and one band with a length of 358 bp were amplified, which was the genotype of heterozygous low fresh weight and was consistent with the actual low fresh weight results of the last 8 samples. Therefore, the InDel molecular marker of the present invention can effectively identify the high and low yield traits of alfalfa and can be used for the prediction and screening of high-yield alfalfa materials.

[0054] The above embodiments are only preferred embodiments of the present invention, which are only used to explain the present invention and do not limit the scope of the present invention. For those skilled in the art of this technology, of course, other embodiments can be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker related to the yield of alfalfa, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment TGTATTTCTAATCAAACTAAA on chromosome 5 of the alfalfa reference genome. The primer pair sequence corresponding to the molecular marker is as follows: Ms_Chr5_62298092-F: GAACGAATTGTGTTGCAGCTGATCC; Ms_Chr5_62298092-R: GAGCCTTGATCATTGTTGCTCCAAG.

2. Use of the primer pair corresponding to the molecular marker described in claim 1 in alfalfa molecular marker-assisted breeding.

3. The application according to claim 2, characterized in that, The molecular marker is used for predicting, identifying or assisting in the identification of the yield traits of alfalfa.

4. A method for identifying the high or low yield of alfalfa, characterized in that, The method includes the following steps: (1) Extract the genomic DNA of the alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification product; (3) Make a determination according to the electrophoresis band and / or sequencing result of step (2). The specific criteria are as follows: Perform PCR amplification using the primer pair Ms_Chr5_62298092-F and Ms_Chr5_62298092-R. If the PCR amplification product has only one characteristic band with a length of 379 bp as shown in SEQ ID NO.4, then the alfalfa is of high-yield type; if the PCR amplification product has both a characteristic band with a length of 379 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 358 bp as shown in SEQ ID NO.5, then the alfalfa is of low-yield type.

5. Use of a kit in identifying the yield genotype of alfalfa, characterized in that, The kit contains the primer pair corresponding to the molecular marker described in claim 1.

6. The application according to claim 5, wherein The method for identifying the yield genotype of alfalfa using the kit includes the following steps: (1) Extract the genomic DNA of the alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification product; (3) Perform electrophoresis detection and / or sequencing on the PCR amplification product. If the PCR amplification product has only one characteristic band with a length of 379 bp as shown in SEQ ID NO.4, then the alfalfa is of homozygous high-yield genotype; if the PCR amplification product has both a characteristic band with a length of 379 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 358 bp as shown in SEQ ID NO.5, then the alfalfa is of heterozygous low-yield genotype.

Images