A gene regulating flower senescence RhNADP-LIKE

Abstract

The application discloses a kind of genes RhNADP-LIKE for regulating the aging of Chinese rose flower, and specifically relates to the technical field of molecular biology and horticultural plant physiology.The application filters the bottle insertion life phenotype data of 358 tetraploid Chinese rose core germplasm by whole genome association analysis (GWAS), and identifies the gene RhNADP-LIKE significantly associated with aging.The gene accelerates the petal aging process by regulating the accumulation of reactive oxygen species (ROS).After inhibiting the expression of RhNADP-LIKE using virus-induced gene silencing (VIGS) technology, the opening period of Chinese rose flower is extended by about 2 days, and the ROS level is significantly reduced.The application provides a molecular target for extending the bottle insertion life of Chinese rose, which can be applied to gene editing breeding or the development of environmentally friendly preservatives, reducing the dependence on chemical agents, and improving the economic benefits and sustainable development potential of cut flower industry.

Description

RhNADP-LIKE, a gene that regulates flower senescence Technical Field

[0001] This invention relates to the fields of molecular biology, bioinformatics and plant physiology, specifically to a gene that regulates flower senescence, RhNADP-LIKE. Background Technology

[0002] Genome-wide association study (GWAS) is a statistical method that scans the entire genome for genetic variations (such as single nucleotide polymorphisms, SNPs) to identify significant associations with specific phenotypes (such as diseases, agronomic traits, etc.). It is widely used in medicine, botany, and zoology to reveal the genetic basis of complex traits. In horticultural plants, GWAS has successfully elucidated the genetic basis of complex traits such as fruit quality, disease resistance, and flowering time. Previous studies have sequenced the whole genomes of 336 peaches and conducted association studies with 26 agronomic traits, identifying many candidate causal variations. Based on the comprehensive walnut genome variation map obtained from the whole-genome resequencing of 815 walnut germplasms, genome association studies revealed 27 genomic loci responsible for 18 important agronomic traits. Pears are a major fruit crop distributed worldwide, but their breeding process is very time-consuming. To advance molecular breeding and gene identification, previous researchers used genome-wide association studies (GWAS) to identify 37 loci associated with 8 fruit quality traits and 5 loci associated with 3 fruit phenological traits. However, as an important ornamental horticultural crop, GWAS research on roses has been relatively limited. Until 2018, Hibrand et al. published genomic data on diploid roses, using GWAS to identify candidate genes RcKSN, RcAP2, and RcTTG2 on chromosome 3 of the 'Old Blush' rose, which are associated with flowering, petal type, self-incompatibility, and thorn density.

[0003] Roses, as an important ornamental flower, possess significant economic value, accounting for more than one-third of the global cut flower industry. Factors such as flower shape, color, and fragrance determine the quality of cut roses, with flower shape being the most fundamental element. Post-harvest preservation of cut roses directly affects flower shape, and the rate of senescence directly impacts economic value and ecological benefits. Therefore, breeding varieties with strong preservation capabilities is of paramount importance. Senescence is crucial for the growth and development of plant organs and the entire plant. In rose production, methods such as spraying preservatives and regulating temperature can delay or slow down petal senescence, thereby extending the flowering period. Therefore, studying the senescence of cut roses is not only vital for improving the industry's economic benefits and promoting green agriculture, but also provides a window into understanding the molecular mechanisms of plant senescence, offering theoretical support for post-harvest biology and stress-resistance breeding in horticultural crops.

[0004] Reactive oxygen species (ROS) are considered byproducts of aerobic metabolism in plants, such as cellular respiration and photosynthesis. Oxygen (O2) is the source of all ROS; while oxygen itself is inactive in plants, ROS are unstable and possess more reactive chemical activity. In plants, ROS exist primarily in two forms: ionic and molecular. Ionic ROS include hydroxyl radicals (OH−) and superoxide anions (O2−). − Molecular states include hydrogen peroxide (H2O2) and singlet oxygen (…). 1 O2). ROS has a dual role in vivo, depending on the different ROS levels. When ROS is maintained at low concentrations, it usually acts as a signaling molecule and participates extensively in a series of physiological and biochemical reactions to maintain the plant's development under normal conditions and adverse environments, such as signal transduction, immune responses, and autophagy. When ROS accumulates excessively, high concentrations of ROS cause irreversible oxidative damage to cells, are toxic to tissues, and in severe cases, lead to death.

[0005] ROS is primarily synthesized in chloroplasts, mitochondria, and peroxisomes, with some production also occurring in subcellular organelles such as the cell wall, plasma membrane, and endoplasmic reticulum. In the petals of most species, few active chloroplasts are retained during the fully flowering stage; most are converted into chromatin. Therefore, the main sources of ROS production in petals are likely the redox systems of peroxisomes, mitochondria, and ectoplasts. Mitochondrial ROS synthesis mainly relies on the electron transport chain (mETC) of the inner mitochondrial membrane. During electron transport, when electrons are not properly transferred to terminal oxidases and react directly with oxygen, oxygen is reduced to O2. − This is a precursor to various ROS. When electron leakage occurs in the respiratory chain, superoxide zymocytes catalyze O2. − Disproportionation reactions occur to produce OH− and H2O2, which is also the main way mitochondria synthesize ROS. In the photosynthetic organ, leaves, the chloroplast photosynthetic pathway produces more ROS than the mitochondrial pathway.

[0006] Electron transport systems are not only present in mitochondria; the plasma membrane contains NADPH oxidase, which can transfer electrons to oxygen in the ectoplastons during electron leakage, thereby catalyzing the production of O2. − O2 −H2O2 is further produced through the catalysis of other enzymes such as spontaneous superoxide dismutase. Additionally, the cell wall can produce H2O2 upon external stimulation, such as through peroxidase. Studies have shown that isocitrate dehydrogenase (IDH) catalyzes the conversion of isocitrate to α-ketoglutarate in the tricarboxylic acid cycle (TCA), reducing NADP+ to NADPH. NAD and NADP in organisms participate in at least 300 different redox reactions. NADH and NAD, along with NADP, are key oxidants in cytosols; changes in their levels not only alter the redox state of cells but also change cell signal transduction pathways. NAD mainly participates in glycolysis (EMP) and the TCA cycle, while NADP mainly participates in the pentose phosphate pathway (PPP). Under oxidative stress, NADPH plays a crucial role in balancing redox activity in plant cells. Both NADP and NADPH produce O2 during electron transport. −− H2O2 promotes membrane oxidation. Studies have observed that when NADPH levels decrease, the antioxidant mechanisms of cells are disrupted, leading to gradual cell death or apoptosis.

[0007] NADPH oxidase in plants, also known as respiratory burst oxidase homologue (Rboh), shares structural similarities with mammals, including six conserved transmembrane domains, an NADPH-binding domain, and a FAD-binding domain. Additionally, plant Rboh proteins contain a phosphorylation site at the N-terminus and two EF-hand motifs. The apoplast ROS produced by the NADPH oxidase encoded by the Rboh gene plays an increasingly important role in plant growth and development, such as axillary bud growth in pollen tubes, seed germination and maturation, and lateral root germination. In tomato pathogen-induced ROS accumulation by RbohD directly stimulates autophagosome formation and inhibits cell death.

[0008] Currently, there are few reports on the regulatory mechanisms of rose flower senescence through forward genetics. There is a lack of a gene RhNADP-LIKE that is related to the senescence of rose flower organs, obtained through GWAS screening, to explore its biological function in depth. This aims to lay the foundation for extending the vase life of roses and elucidating the mechanism of flower senescence. Summary of the Invention

[0009] To address the problems of existing technologies, the purpose of this invention is to provide a method for regulating the flower senescence gene RhNADP-LIKE.

[0010] To achieve the above objectives, the present invention adopts the following technical solution:

[0011] Firstly, this application provides a gene that regulates flower senescence, RhNADP-LIKE.

[0012] Secondly, this application provides a protein encoded by the flower senescence gene RhNADP-LIKE.

[0013] Thirdly, this application provides a specific primer pair for regulating the rose flower senescence gene RhNADP-LIKE.

[0014] Fourthly, this application provides a method for extending the vase life of roses.

[0015] Fifthly, this application provides a screening method for RhNADP-LIKE, a gene regulating flower senescence, based on genome-wide association analysis.

[0016] In a sixth aspect, this application provides a VIGS vector for silencing the flower senescence gene RhNADP-LIKE, comprising a specific fragment that regulates the flower senescence gene RhNADP-LIKE, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0017] Seventhly, this application provides a rose plant obtained by a method.

[0018] Eighthly, this application provides an application of the flower senescence regulating gene RhNADP-LIKE in the breeding of rose varieties with extended flowering periods.

[0019] Ninthly, this application provides the application of the flower senescence regulating gene RhNADP-LIKE in the development of a preservative to extend the shelf life of cut roses.

[0020] Tenthly, this application provides an application of the gene RhNADP-LIKE, which regulates flower senescence, in regulating flower senescence and vase life in Rosaceae plants, where the Rosaceae plant is the rose.

[0021] The first aspect of this application provides a gene for regulating flower senescence, RhNADP-LIKE. The nucleotide sequence of the gene for regulating flower senescence, RhNADP-LIKE, is shown in SEQ ID NO:1. The gene for regulating flower senescence, RhNADP-LIKE, accelerates the senescence process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0022] The second aspect of this application provides a protein encoded by the flower senescence gene RhNADP-LIKE, the amino acid sequence of which is shown in SEQ ID NO:2.

[0023] A third aspect of this application provides a specific primer pair for regulating the rose flower senescence gene RhNADP-LIKE. The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO:4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:5.

[0024] The fourth aspect of this application provides a method for extending the vase life of roses by reducing or blocking the expression of the flower senescence gene RhNADP-LIKE, thereby reducing the accumulation of reactive oxygen species (ROS) and delaying the senescence of rose flowers.

[0025] Furthermore, reducing or blocking gene expression is achieved through virus-induced gene silencing (VIGS) technology.

[0026] The fifth aspect of this application provides a screening method for RhNADP-LIKE genes regulating flower senescence based on genome-wide association analysis, comprising the following steps:

[0027] a) Collect vase life phenotypic data of rose germplasm resources;

[0028] b) Perform whole-genome resequencing on the rose germplasm resources to obtain SNP loci;

[0029] c) Use a mixture linear model (MLM) to perform genome-wide association analysis (GWAS) to screen for SNPs that are significantly associated with bottle life;

[0030] d) Identify the flower senescence-regulating gene RhNADP-LIKE located in the SNP site region and verify its function in regulating the accumulation of reactive oxygen species (ROS).

[0031] The sixth aspect of this application provides a VIGS vector for silencing the flower senescence gene RhNADP-LIKE, comprising a specific fragment regulating the flower senescence gene RhNADP-LIKE, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0032] The seventh aspect of this application provides a method for preparing a rose plant with an extended flowering period, comprising the following steps:

[0033] a) Select tetraploid rose core germplasm resources as starting materials;

[0034] b) Construct a virus-induced gene silencing (VIGS) vector containing a RhNADP-LIKE gene-specific fragment, the nucleotide sequence of which is shown in SEQ ID NO:3;

[0035] c) Transform the VIGS vector from step b) into Agrobacterium GV3101 and mix it with Agrobacterium carrying the pTRV1 vector at a 1:1 ratio to obtain the infection solution.

[0036] d) Inject the infection solution described in step c) into the rooted rose tissue culture seedlings, while using the empty vector pTRV2 to infect the plants as a control.

[0037] e) Infected plants were cultured for 15-20 days under conditions of 21-23℃, 8-hour dark / 16-hour light cycle, and 60% humidity to promote gene silencing.

[0038] f) Plants with significantly reduced RhNADP-LIKE gene expression were screened to obtain rose plants with prolonged flowering period and delayed petal senescence. The rose germplasm resources were core tetraploid rose germplasm, totaling 358 accessions.

[0039] The eighth aspect of this application provides an application of the flower senescence regulating gene RhNADP-LIKE in the breeding of rose varieties with extended flowering periods.

[0040] The ninth aspect of this application provides the application of the flower senescence regulating gene RhNADP-LIKE in the development of a preservative to extend the shelf life of cut roses.

[0041] The tenth aspect of this application provides an application of the gene RhNADP-LIKE, which regulates flower senescence, in regulating flower senescence and vase life in Rosaceae plants, where the Rosaceae plant is the rose.

[0042] The flower senescence gene RhNADP-LIKE accelerates the senescence process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0043] Beneficial effects: This invention provides a molecular target for extending the vase life of roses, which can be applied to gene editing breeding or the development of environmentally friendly preservatives, reducing dependence on chemical agents and improving the economic benefits and sustainable development potential of the cut flower industry.

[0044] Compared with the prior art, the present invention has the following advantages: (1) Precise analysis of the senescence mechanism of rose flowers: Through genome-wide association analysis (GWAS), the gene RhNADP-LIKE, which is highly associated with vase life, was identified in rose for the first time. It revealed the molecular mechanism by which it accelerates petal senescence by regulating the accumulation of reactive oxygen species (ROS), filling the research gap in the molecular regulatory network of rose petal senescence and providing a new direction for subsequent functional gene mining.

[0045] (2) Extending vase life and improving economic benefits: After inhibiting RhNADP-LIKE expression through virus-induced gene silencing (VIGS) technology, the opening period of rose flowers is significantly extended (about 2 days), and the petal senescence process is slowed down. This technology can be directly applied to the preservation of cut roses, reducing losses during transportation and storage, and significantly improving the market competitiveness and economic value of the product.

[0046] (3) Reduce reliance on chemical preservatives and promote green agriculture: Traditional preservation methods rely on chemical agents (such as ethylene inhibitors) or physical regulation (low-temperature storage), which are costly and pose environmental risks. This invention reduces ROS levels through targeted gene regulation, providing a theoretical basis for the development of environmentally friendly preservation technologies and contributing to the development of green agriculture.

[0047] (4) Promote molecular breeding innovation: After clarifying the regulatory function of RhNADP-LIKE, new rose varieties with long flowering period and good storage can be quickly bred through gene editing (such as CRISPR / Cas9) or molecular marker-assisted selection, shortening the traditional breeding cycle and improving breeding efficiency.

[0048] (5) Expanding the application potential of other horticultural crops: The ROS regulation mechanism is conserved in plant senescence. The technical route of this invention (GWAS combined with VIGS verification) can be extended to the research on postharvest preservation of ornamental flowers such as roses and carnations, as well as fruits and vegetables, and has broad scientific value and industrial application prospects. Attached Figure Description

[0049] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0050] Figure 1 is a Manhattan plot of the vase life characteristics of roses in 2021 according to the present invention.

[0051] Figure 2 shows the expression characteristics of RhNADP-LIKE in different developmental stages of rose petals according to the present invention. S1-S6 are different opening levels of rose petals.

[0052] Figure 3 shows the RhNADP-LIKE gene expression levels of TRV and TRV-RhNADP-LIKE in this invention; the gene expression level in the TRV control was set to 1, and the internal reference gene was RhUBI. The bar chart represents the mean ± SD, and a total of 5 biological replicates were detected. Independent samples t-test, *P < 0.05, **P < 0.01.

[0053] Figure 4 shows the effect of the silent RhNADP-LIKE of the present invention on the opening and petal senescence process of roses; after the flowers show color, photos are taken and observed at regular intervals every day to record the opening process; TRV: control group plants; TRV2-RhNADP-LIKE: silent RhNADP-LIKE plants; Stage#: opening level.

[0054] Figure 5 shows the statistical data on the opening phenotype of the VIGS rose flower and the opening time from S2 level to senescence according to the present invention.

[0055] Figure 6 shows DAB staining (top) and NBT staining (bottom) of petals of RhNADP-LIKE silent plants of the present invention. Detailed Implementation

[0056] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0057] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0058] In this application, "-one less" means one or more, and "more than" means two or more. "-one less item (item) below" or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "-one less item (item) in a, b, or c", or "-one less item (item) in a, b, and c", can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.

[0059] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0060] The first aspect of this application provides a gene for regulating flower senescence, RhNADP-LIKE. The nucleotide sequence of the gene for regulating flower senescence, RhNADP-LIKE, is shown in SEQ ID NO:1. Regulating the gene for regulating flower senescence, RhNADP-LIKE, accelerates the senescence process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0061] The second aspect of this application provides a protein encoded by the flower senescence gene RhNADP-LIKE, the amino acid sequence of which is shown in SEQ ID NO:2.

[0062] The third aspect of this application provides a specific primer pair for regulating the rose flower senescence gene RhNADP-LIKE. The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO:4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:5.

[0063] The fourth aspect of this application provides a method for extending the vase life of roses by reducing or blocking the expression of the flower senescence gene RhNADP-LIKE, thereby reducing the accumulation of reactive oxygen species (ROS) and delaying the senescence of rose flowers.

[0064] In some embodiments, reducing or blocking gene expression is achieved through virus-induced gene silencing (VIGS) technology.

[0065] The fifth aspect of this application provides a method for screening RhNADP-LIKE genes regulating flower senescence based on genome-wide association analysis, comprising the following steps:

[0066] a) Collect vase life phenotypic data of rose germplasm resources;

[0067] b) Perform whole-genome resequencing on the rose germplasm resources to obtain SNP loci;

[0068] c) Use a mixture linear model (MLM) to perform genome-wide association analysis (GWAS) to screen for SNPs that are significantly associated with bottle life;

[0069] d) Identify the flower senescence-regulating gene RhNADP-LIKE located in the SNP site region and verify its function in regulating the accumulation of reactive oxygen species (ROS).

[0070] The sixth aspect of this application provides a VIGS vector for silencing the flower senescence gene RhNADP-LIKE, comprising a specific fragment regulating the flower senescence gene RhNADP-LIKE, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0071] The seventh aspect of this application provides a method for preparing a rose plant with an extended flowering period, comprising the following steps:

[0072] a) Select tetraploid rose core germplasm resources as starting materials;

[0073] b) Construct a virus-induced gene silencing (VIGS) vector containing a RhNADP-LIKE gene-specific fragment, the nucleotide sequence of which is shown in SEQ ID NO:3;

[0074] c) Transform the VIGS vector from step b) into Agrobacterium GV3101 and mix it with Agrobacterium carrying the pTRV1 vector at a 1:1 ratio to obtain the infection solution.

[0075] d) Inject the infection solution described in step c) into the rooted rose tissue culture seedlings, while using the empty vector pTRV2 to infect the plants as a control.

[0076] e) Infected plants were cultured for 15-20 days under conditions of 21-23℃, 8-hour dark / 16-hour light cycle, and 60% humidity to promote gene silencing.

[0077] f) Plants with significantly reduced RhNADP-LIKE gene expression were screened to obtain rose plants with prolonged flowering period and delayed petal senescence. The rose germplasm resources were core tetraploid rose germplasm, totaling 358 accessions.

[0078] The eighth aspect of this application provides the application of the flower senescence regulating gene RhNADP-LIKE in the breeding of rose varieties with extended flowering periods.

[0079] The ninth aspect of this application provides the application of the flower senescence gene RhNADP-LIKE in the development of a preservative to extend the shelf life of cut roses.

[0080] The tenth aspect of this application provides an application of the gene RhNADP-LIKE, which regulates flower senescence, in regulating flower senescence and vase life in Rosaceae plants, where the Rosaceae plant is the rose.

[0081] The flower senescence gene RhNADP-LIKE accelerates the senescence process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0082] Example 1

[0083] The present invention discloses a flower senescence regulating gene RhNADP-LIKE, the nucleotide sequence of which is shown in SEQ ID NO:1. The gene accelerates the senescence process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0084] The gene RhNADP-LIKE, which regulates flower senescence, controls flower senescence and vase life in Rosaceae plants, including roses.

[0085] The present invention discloses a protein encoded by the flower senescence gene RhNADP-LIKE, the amino acid sequence of which is shown in SEQ ID NO:2.

[0086] Example 2

[0087] The present invention provides a method for extending the vase life of roses by reducing or blocking the expression of the flower senescence gene RhNADP-LIKE, thereby reducing the accumulation of reactive oxygen species (ROS) and delaying the senescence of rose flowers.

[0088] Reducing or blocking gene expression is achieved through virus-induced gene silencing (VIGS) technology.

[0089] Example 3

[0090] This invention discloses a method for screening RhNADP-LIKE, a gene regulating flower senescence, based on genome-wide association analysis (GWAS), comprising the following steps: a) collecting vase life phenotypic data of rose germplasm resources; b) performing whole-genome resequencing of the rose germplasm resources to obtain SNP loci; c) performing genome-wide association analysis (GWAS) using a mixed linear model (MLM) to screen SNP loci significantly associated with vase life; d) identifying the RhNADP-LIKE gene regulating flower senescence located in the region of the SNP loci and verifying its function in regulating the accumulation of reactive oxygen species (ROS).

[0091] Materials and Methods

[0092] Plant materials and treatment

[0093] 1,358 tetraploid rose germplasm resources were obtained, all of which were grown in greenhouses.

[0094] 2. Subculturing of 'Samantha' Rose (Rosa hybrida 'Samantha'): Insert 2-3 cm long stem segments of 'Samantha' rose with at least one axillary bud into the propagation subculturing medium. When the seedlings grow to about 10-12 cm in height, transfer them to the rooting medium. When the rose seedlings develop roots about 3-5 cm long, remove them from the tissue culture bottle and gently rinse the culture medium from the roots with water, being careful to maintain humidity and prevent rapid drying. Plant the rose seedlings with mature root systems in nutrient pots with a well-mixed mixture of potting soil and vermiculite (2:1), cover with a transparent heat-insulating and humidity-controlled cover, and cultivate for 15-20 days to allow the seedlings to establish themselves. After removing the cover, maintain 8 / 16 hours (dark / light), with an air humidity of about 60% and a temperature of 21-23℃.

[0095] Phenotypic data analysis

[0096] Statistical analysis was conducted on the phenotypic characteristics of varieties from different sources. Microsoft Excel 2007 was used to organize and analyze the data, calculating the mean, standard deviation, coefficient of variation, kurtosis, and skewness for each trait. The coefficient of variation is the ratio of the standard deviation of the original data to the mean of the original data. The mean and standard deviation (SD) were used as grading criteria to classify the core rose germplasm into grades, thereby statistically analyzing the distribution frequency Pi of each grade for each trait (Yin et al., 2021). The Shannon-Weaver index of genetic diversity was then used to evaluate the magnitude of trait genetic diversity. A trait diversity index is directly proportional to its trait diversity; a larger index indicates higher diversity of the trait.

[0097] H' = ∑Pi ln Pi

[0098] In the formula, Pi is the distribution frequency of the i-th level, and ln is the natural logarithm.

[0099] This invention mainly focuses on descriptive statistics and diversity analysis of the vase senescence phenotype of 358 tetraploid rose germplasm resources.

[0100] Genome-wide association analysis

[0101] The laboratory has completed the resequencing of 358 core rose germplasms and compared the data with two haplotype genomes. Based on the criteria of minor allele frequency (maf) less than 0.05 and genotype deletion rate more than 10%, we screened a total of 27,206,170 high-quality SNP loci, which will be used for subsequent GWAS analysis.

[0102] This invention utilizes mixture linear model analysis (MLM) in Gemma software for genome-wide association analysis. First, PLINK software (https: / / www.cog-genomics.org / plink2) is used to convert VCF files containing variant sites generated from population variation detection into BED files. This conversion aims to transform files containing variant site information for subsequent analysis. Next, the previously obtained bottled aging phenotype data is organized into a FAM format file, followed by kinship analysis. Finally, the association between variant sites and the target trait is analyzed using an MLM model, calculated as: Y = Xβ + Zu + e (phenotypic value), where X is the fixed-effects design matrix, Z is the random-effects design matrix, β is the estimated coefficient of the fixed effects, u is the coefficient of the random effects, and e is the error term.

[0103] Virus-induced gene silencing (VIGS)

[0104] To construct the VIGS silencing vector, a specific RhNADP-LIKE fragment of approximately 400 bp was constructed into the pTRV2 vector, which was then transformed into Agrobacterium GV3101 and mixed with Agrobacterium carrying pTRV1 at a 1:1 volume ratio to infect rose tissue culture seedlings that had been rooted for half a month. Plants infected with the empty pTRV2 vector served as a control. After one month of growth, RNA was extracted from young leaves to assess the silencing efficiency. The flower opening cycle of the RhNADP-LIKE VIGS transiently transformed lines was further observed.

[0105] Real-time PCR analysis

[0106] Total RNA was extracted from rose petals using the hot borate method, following previous laboratory procedures. First-strand cDNA was synthesized using the HiScript IIQ RT SuperMix for qPCR (Cat. R123-01, Vazyme) reverse transcription kit, with 1 μg of total RNA as a template. qRT-PCR reactions were performed using the StepOne Real-Time PCR System (Applied Biosystems) with the KAPA SYBRFAST Universal qRT-PCR kit (Kapa Biosystems) (20 µL volume containing 1 µL of cDNA template).

[0107] Results and Analysis

[0108] Genome-wide association analysis screens candidate genes for organ senescence in roses.

[0109] This experiment mainly tested the vase senescence of 358 tetraploid rose germplasm resources, and counted the number of days from secondary flowering to the appearance of senescent phenotypic characteristics. The senescence time of most roses was between 5 and 6 days, while a very small number could reach more than 10 days.

[0110] Resequencing data from 358 tetraploid rose germplasm resources and two previously assembled haplotype genomes identified 27,206,170 SNP loci. These loci were then used in genome-wide association analysis (GWAS) using GEMMA software and an MLM model. For the vase life phenotype, the GWAS analysis results are shown in Figure 1. Only one locus in the Manhattan plot was significantly below the threshold; this locus, Chr2B:82316215, is located on the promoter of the SMT2B602100 gene and contains a C-base mutation to an A-base. Within the significant GWAS association region, the gene SMT2B602100, highly associated with rose vase life, was identified as RhNADP-LIKE. It is a key coenzyme involved in cellular energy metabolism and redox reactions, and NADP-LIKE promotes the accumulation of reactive oxygen species (ROS), thus affecting rose bloom time.

[0111] The third aspect of this application provides a specific primer pair for regulating the rose flower senescence gene RhNADP-LIKE. The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO:4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:5.

[0112] Forward primer: 5′-SEQ ID NO:4-3′; GCTTTTGGGCCTCATGACT

[0113] Reverse primer: 5′-SEQ ID NO:5-3′; GCATGCAGCCTCCAACTTTC

[0114] The primer pairs specifically amplify the coding region (CDS) or regulatory region of the RhNADP-LIKE gene, and are used to detect, silence, or quantify the expression of the gene.

[0115] The primers used and the RhNADP-LIKE gene sequence are shown in Table 1.

[0116] Table 1

[0117]

[0118] Example 4

[0119] The present invention discloses a VIGS vector for silencing the flower senescence gene RhNADP-LIKE, comprising a specific fragment for regulating the flower senescence gene RhNADP-LIKE, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0120] Example 5

[0121] The present invention provides a method for preparing a rose plant with an extended flowering period, comprising the following steps:

[0122] a) Select tetraploid rose core germplasm resources as starting materials;

[0123] b) Construct a virus-induced gene silencing (VIGS) vector containing a RhNADP-LIKE gene-specific fragment, the nucleotide sequence of which is shown in SEQ ID NO:3;

[0124] c) Transform the VIGS vector from step b) into Agrobacterium GV3101 and mix it with Agrobacterium carrying the pTRV1 vector at a 1:1 ratio to obtain the infection solution.

[0125] d) Inject the infection solution described in step c) into the rooted rose tissue culture seedlings, while using the empty vector pTRV2 to infect the plants as a control.

[0126] e) Infected plants were cultured for 15-20 days under conditions of 21-23℃, 8-hour dark / 16-hour light cycle, and 60% humidity to promote gene silencing.

[0127] f) Plants with significantly reduced RhNADP-LIKE gene expression were screened to obtain rose plants with prolonged flowering period and delayed petal senescence. The rose germplasm resources were core tetraploid rose germplasm, totaling 358 accessions.

[0128] Example 6

[0129] The present invention relates to the application of the flower senescence regulating gene RhNADP-LIKE in the breeding of rose varieties with extended flowering period.

[0130] Example 7

[0131] The present invention relates to the application of a gene regulating flower senescence, RhNADP-LIKE, in the development of a preservative to extend the shelf life of cut roses.

[0132] Example 8

[0133] This invention relates to the application of the flower senescence regulating gene RhNADP-LIKE in regulating flower senescence and vase life in Rosaceae plants, specifically the rose.

[0134] Experimental Example 1

[0135] Analysis of RhNADP-LIKE gene expression levels at different stages of rose bloom

[0136] To analyze the spatiotemporal expression specificity of the RhNADP-LIKE gene, the gene expression level of RhNADP-LIKE in rose 'Samantha' at levels 0, 1, 2, 3, 4, 5, and 6 during the opening process was detected by qRT-PCR. The results showed that the gene expression level of RhNADP-LIKE was high at level 0, reaching its highest level in level 1 flowers, and gradually decreased as the flower opened (Figure 2). The significant decrease in RhNADP-LIKE expression during petal senescence suggests that it may be involved in regulating the petal senescence process of roses.

[0137] Experimental Example 2

[0138] The impact of RhNADP-LIKE's silence on rose blooming period

[0139] NADP is a key coenzyme involved in cellular energy metabolism and redox reactions, and NADP-LIKE can promote the accumulation of reactive oxygen species (ROS). Considering that RhNADP-LIKE was screened in the senescence phenotype of rose agronomical traits in GWAS analysis, we hypothesized that it might be involved in regulating the flowering duration and petal senescence process of roses. To further explore the specific function of RhNADP-LIKE in the flowering and senescence process of roses, the TRV2-RhNADP-LIKE vector was constructed, and the RhNADP-LIKE gene in roses was transiently silenced using VIGS technology with 'Samantha' tissue culture seedlings as material. The outermost petals were collected at the fifth flowering stage for subsequent RNA extraction to test the gene silencing efficiency and provide reliability. The results showed that the expression of RhNADP-LIKE was significantly reduced in the silenced plants (Figure 3), indicating that the RhNADP-LIKE gene silencing effect is sufficient to support subsequent conclusions.

[0140] Fifteen silent lines and 15 control lines were selected, and their phenotypic characteristics were observed and the flowering process was recorded. The opening time of rose flowers from S2 (flowers are teardrop-shaped and sepals are fully open) to S6 (petals wither or fall off) was observed and recorded continuously by taking pictures. The results showed that, compared with the TRV control, silencing RhNADP-LIKE prolonged the entire flowering period of roses and delayed flower senescence (Figures 4 and 5).

[0141] Experimental Example 3

[0142] The effect of silencing the RhNADP-LIKE gene on ROS levels

[0143] ROS (Reactive Organisms) are considered the earliest signals affecting the natural aging of organs. This invention detected ROS levels in TRV control plants and TRV2-RhNADP-LIKE silenced plants. NBT and DAB were used to chemically stain the petals of TSA-treated plants to detect O2− and H2O2 content, respectively. After DAB staining, the more H2O2 accumulated, the deeper the brown color; after NBT staining, the more O2− accumulated, the deeper the blue color. The results showed that compared with the TRV control, the DAB and NBT staining intensities of the petals of RhNADP-LIKE silenced plants were lighter (Figure 6), indicating that RhNADP-LIKE silenced plants contained lower O2. − and H2O2 levels.

[0144] Roses, as an important cut flower variety, have high economic value, but their short vase life and tendency to age directly affect sales and consumer experience. Therefore, studying their aging mechanisms and extending their shelf life has always been a hot topic in postharvest rose research. Reverse genetics studies have demonstrated that rose petal senescence is regulated by plant hormones auxin and ethylene; however, the mechanism of rose senescence as elucidated through forward genetics GWAS remains unclear. This invention identified a gene, NADP-LIKE, highly associated with rose vase life (Figure 1), through genome-wide association analysis, indicating that NADP-LIKE may participate in the rose senescence process and play an important role in vase life. To further investigate whether NADP-LIKE participates in regulating petal senescence, a virus-induced gene silencing experiment was conducted. It was found that compared to TRV control plants, plants with silenced RhNADP-LIKE exhibited a prolonged flower opening cycle and extended flowering period. Silencing RhNADP-LIKE significantly prolonged the time from S2 to S6 petal opening, approximately 2 days. Furthermore, the DAB and NBT staining intensities of the petals of RhNADP-LIKE silent plants were lighter (Figure 6), indicating that RhNADP-LIKE silent plants contained lower O2. − and H2O2 levels.

[0145] In summary, the transient silencing of NADP-LIKE in this invention prolongs the opening cycle and flowering period of roses; RhNADP-LIKE affects rose senescence by regulating ROS levels, meaning that RhNADP-LIKE may affect petal senescence by regulating ROS accumulation. The primers used in the experiment and the NADP-LIKE gene sequence are shown in Table 1.

[0146] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope. The scope of protection of the present invention is defined by the appended claims, specification, and their equivalents.

Claims

1. A method for extending the vase life of roses, characterized in that: By reducing or blocking the expression of the flower senescence gene RhNADP-LIKE, the accumulation of reactive oxygen species (ROS) is reduced, thereby delaying the senescence of rose flowers; the nucleotide sequence of the flower senescence gene RhNADP-LIKE is shown in SEQ ID NO:

1.

2. A screening method for RhNADP-LIKE genes regulating flower senescence based on genome-wide association analysis, characterized in that... The method includes the following steps: a) collecting vase life phenotypic data of rose germplasm resources; b) performing whole-genome resequencing on the rose germplasm resources to obtain SNP loci; c) performing genome-wide association analysis (GWAS) using a mixed linear model (MLM) to screen for SNP loci significantly associated with vase life; d) identifying the RhNADP-LIKE gene for regulating flower senescence as described in claim 1, located in the region of the SNP loci, and verifying its function in regulating the accumulation of reactive oxygen species (ROS).

3. A VIGS vector for silencing the flower senescence-regulating gene RhNADP-LIKE as described in claim 1, characterized in that: The specific fragment contains the RhNADP-LIKE gene that regulates flower senescence, and the nucleotide sequence of the specific fragment is shown in SEQ ID NO:

3.

4. A method for preparing a rose plant with an extended flowering period, characterized in that... The procedure includes the following steps: a) Selecting tetraploid rose core germplasm resources as starting material; b) Constructing a virus-induced gene silencing VIGS vector containing a specific fragment of the RhNADP-LIKE gene, the nucleotide sequence of which is shown in SEQ ID NO:3; c) Transforming the VIGS vector from step b) into Agrobacterium GV3101 and mixing it with Agrobacterium carrying the pTRV1 vector at a volume ratio of 1:1 to obtain an infection solution; d) Injecting rooted rose tissue culture seedlings with the infection solution described in step c), while using plants infected with the empty vector pTRV2 as a control; e) Cultivating the infected plants for 15-20 days under conditions of 21-23℃, 8-hour dark / 16-hour light cycle, and 60% humidity to promote gene silencing; f) Screening for plants with significantly reduced RhNADP-LIKE gene expression to obtain rose plants with prolonged flowering and delayed petal senescence.

5. The application of the flower senescence regulating gene RhNADP-LIKE as described in claim 1 in regulating flower senescence and vase life in Rosaceae plants, characterized in that: The plant in question is a rose (Rosa chinensis).

Images