Nucleic acid sequence molecules and methods for detecting DNA methylation

Abstract

The present application relates to the field of DNA methylation modification detection, and particularly relates to nucleic acid sequence molecules and DNA methylation detection methods. The nucleic acid sequence molecules comprise at least a probe sequence, the probe sequence comprises at least one CpG site, at least one of which is a to-be-detected CpG site; the probe sequence comprises a methylation probe sequence and a non-methylation probe sequence, and the two probe sequences are modified with different fluorescent groups; and the probe sequence at least meets one of the following conditions: i) within the region of the to-be-detected CpG site and the 2 nt upstream and downstream of the to-be-detected CpG site, the overall GC content of the methylation probe is not more than 50%; ii) within the region of the to-be-detected CpG site and the 2 nt upstream and downstream of the to-be-detected CpG site, the overall GC content of the methylation probe is more than 50%, and the to-be-detected CpG site in the probe sequence is modified with LNA. The method of the present application can significantly improve the specificity and sensitivity of CpG site methylation detection.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of DNA methylation detection, and in particular to nucleic acid sequence molecules and methods of DNA methylation detection using the same. BACKGROUND

[0002] DNA methylation modification in mammals mainly refers to the methylation modification of the 5' carbon atom of cytosine (C) to form 5-methylcytosine (5-mC), and this modification mainly occurs on CpG dinucleotides. Detecting the methylation state of cytosine in CpG dinucleotides is of great significance in early diagnosis, prognosis and epigenetic research.

[0003] In methylation detection, a chemical reagent or an enzyme (for example, bisulfite, APOBEC enzyme) is first used to convert unmethylated cytosine into uracil, so that DNA sequences with different methylation states produce sequence differences in subsequent detection. However, after conversion, the base complexity of the DNA sequence is also greatly reduced (the number of base types is reduced to 3), which is a great challenge to the specificity of the detection method.

[0004] Existing methods usually incorporate multiple CpG sites in primers or probes to improve the specificity of the detection method. Even so, it cannot be ensured that good specificity is achieved. Moreover, in some regions where the distribution of CpG sites of some genes is relatively loose (for example, the distance between two adjacent sites is significantly longer than the applicable length of the primer or probe), it is not possible to incorporate multiple CpG sites in the primer or probe. In addition, in specific application scenarios, the methylation state of a single CpG site is more valuable for detection (for example, compared to the average methylation of the promoter or gene, the methylation state of a single CpG can more accurately predict the expression of the gene), and the existing method requires the incorporation of multiple CpG sites in the primer or probe, which obviously cannot meet the needs of these specific application scenarios. SUMMARY

[0005] The present application provides nucleic acid sequence molecules and methods of DNA methylation detection using the same.

[0006] In one aspect, the present application provides a nucleic acid sequence molecule comprising at least a probe sequence,

[0007] The probe sequence comprises at least one (for example, at least one, two, three, or a sub-range consisting of any value in these ranges) CpG site or its complementary strand, wherein at least one (for example, at least one, two, three, or a sub-range consisting of any value in these ranges) is a CpG site to be detected or its complementary strand, and the rest are non-CpG sites to be detected or their complementary strands.

[0008] The probe sequence comprises a methylated probe sequence and a non-methylated probe sequence, both of which are modified with different fluorescent groups;

[0009] and the probe sequence at least meets one of the following conditions:

[0010] i) within the region of 6 nt, including the CpG site to be detected or its complementary strand and 2 nt upstream and downstream thereof, the overall GC content for the methylated probe sequence is no more than 50%, for example, 50%, 34% (i.e., the number of G and C is no more than 3 nt, for example, can be 3, 2 or 1 nt);

[0011] ii) within the region of 6 nt, including the CpG site to be detected or its complementary strand and 2 nt upstream and downstream thereof, the overall GC content for the methylated probe sequence is more than 50% (i.e., the number of G and C is more than 3 nt, for example, can be 4, 5 or 6 nt), and the CpG site to be detected or its complementary strand in the methylated probe sequence and the non-methylated probe sequence is modified with LNA (Locked Nucleic Acid).

[0012] In an embodiment, the methylated probe sequence comprises the CpG site to be detected or its complementary strand, and the dinucleotide of the methylated probe sequence at the CpG site to be detected or its complementary strand is 5'-CG-3'; and the non-methylated probe sequence comprises the CpG site to be detected or its complementary strand, and the dinucleotide of the non-methylated probe sequence at the CpG site to be detected or its complementary strand is 5'-CA-3'.

[0013] In an embodiment, the probe sequence at least meets one of the following conditions:

[0014] i) within the region of 6 nt, including the CpG site to be detected or its complementary strand and 2 nt upstream and downstream thereof, the overall GC content for the non-methylated probe sequence is no more than 34% (i.e., the number of G and C is no more than 2 nt, for example, can be 2 or 1 nt);

[0015] ii) within the region of 6 nt, including the CpG site to be detected or its complementary strand and 2 nt upstream and downstream thereof, the overall GC content for the non-methylated probe sequence is more than 34% (i.e., the number of G and C is more than 2 nt, for example, can be 3, 4, 5 or 6 nt), and the CpG site to be detected or its complementary strand in the methylated probe sequence and the non-methylated probe sequence is modified with LNA (Locked Nucleic Acid).

[0016] In an embodiment, the number of non-CpG sites or their complementary strands comprised in the probe sequence is at least 0, for example, at least 0, 1, 2, 3, or a sub-range consisting of any value in these ranges.

[0017] In one embodiment, the nucleic acid sequence molecule comprises at least a probe sequence,

[0018] The probe sequence comprises at least one CpG site, wherein at least one is the CpG site to be detected;

[0019] The probe sequence comprises a methylated probe sequence and a non-methylated probe sequence, both of which are modified with different fluorescent groups;

[0020] And the probe sequence at least meets one of the following conditions:

[0021] i) Within the region of 6 nt including the CpG site to be detected and 2 nt upstream and downstream thereof, the overall GC content for the methylated probe is no more than 50%;

[0022] ii) Within the region of 6 nt including the CpG site to be detected and 2 nt upstream and downstream thereof, the overall GC content for the methylated probe is more than 50%, and the CpG site to be detected in the methylated probe sequence and the non-methylated probe sequence is modified with LNA.

[0023] In one embodiment, the nucleic acid sequence molecule comprises at least a probe sequence,

[0024] The probe sequence comprises at least one complementary strand of CpG site, wherein at least one is the complementary strand of the CpG site to be detected;

[0025] The probe sequence comprises a methylated probe sequence and a non-methylated probe sequence, both of which are modified with different fluorescent groups;

[0026] And the probe sequence at least meets one of the following conditions:

[0027] i) Within the region of 6 nt including the complementary strand of the CpG site to be detected and 2 nt upstream and downstream thereof, the overall GC content for the methylated probe is no more than 50%;

[0028] ii) Within the region of 6 nt including the complementary strand of the CpG site to be detected and 2 nt upstream and downstream thereof, the overall GC content for the methylated probe is more than 50%, and the complementary strand of the CpG site to be detected in the methylated probe sequence and the non-methylated probe sequence is modified with LNA.

[0029] In one embodiment, for the methylated probe sequence, LNA modification is introduced at the differential base; and for the non-methylated probe sequence, LNA modification is introduced at the differential base and the bases 1 nt upstream and downstream thereof.

[0030] In one embodiment, the probe sequence further comprises at least 1 (e.g., at least 1, 2, 3, or a sub-range consisting of any value in these ranges) non-test CpG site or its complementary strand, wherein G of the complementary strand of the non-test CpG site is replaced by a degenerate base R (adenine A and guanine G).

[0031] In one embodiment, the probe sequence is with MGB (Minor Groove Binder) modification.

[0032] In one embodiment, the probe sequence has a Tm value greater than or equal to 42°C (e.g., greater than or equal to 42, 43, 44, 45, 50, or 60°C, or a sub-range consisting of any value in these ranges), preferably a Tm value greater than or equal to 45°C, without considering the effect of MGB. m m

[0033] In one embodiment, the probe sequence contains no more than 3 (e.g., 3 or 2, preferably no more than 2) consecutive bases.

[0034] In one embodiment, the probe sequence has a length of 13-25 nt (e.g., 13, 14, 15, 16, 17, 18, 19, 20, or 25 nt, or a sub-range consisting of any value in these ranges), preferably a length of 15-18 nt.

[0035] In one embodiment, the methylated probe and the unmethylated probe can have the same or different lengths.

[0036] In one embodiment, the probe sequence contains a test CpG site downstream of which has a length of 3-6 nt (e.g., 3, 4, 5, 6 nt), preferably 4-5 nt, most preferably 4 nt.

[0037] In one embodiment, the nucleic acid sequence molecule further comprises a primer sequence, which comprises an upstream primer sequence and a downstream primer sequence, wherein the upstream primer sequence and the downstream primer sequence contain 1-2 CH sites in the 5 bases closest to the 3' end thereof.

[0038] In one embodiment, the entire upstream primer sequence contains at least 3 (e.g., at least 3, 4, 5, 6, 7, 8, 9, or 10, or a sub-range consisting of any value in these ranges) CH sites, and the entire downstream primer contains at least 3 (e.g., at least 3, 4, 5, 6, 7, 8, 9, or 10, or a sub-range consisting of any value in these ranges) CH sites.

[0039] ​​In an embodiment, the entire upstream primer sequence comprises at most 1 (e.g., 0 or 1) CpG site or the complement strand of a CpG site, and the entire downstream primer sequence comprises at most 1 (e.g., 0 or 1) CpG site or the complement strand of a CpG site, which is not the CpG site to be tested, and which is not the complement strand of the CpG site to be tested.

[0040] In an embodiment, the G of the complement strand of the CpG site is replaced with a degenerate base R (adenine A and guanine G).

[0041] In an embodiment, the G of the complement strand of the CpG site is replaced with a degenerate base R (adenine A and guanine G).

[0042] In an embodiment, the length of the primer sequence is no more than 30 nt, e.g., no more than 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nt, or a sub-range consisting of any of these values.

[0043] In an embodiment, the upstream primer sequence and the downstream primer sequence can have the same or different lengths.

[0044] In an embodiment, the number of consecutive bases contained in the primer sequence is no more than 6, e.g., 6, 5, 4, 3, or 2, preferably no more than 3.

[0045] In an embodiment, the primer sequence has a Tm value of 58-62 °C (e.g., 58, 59, 60, 61, or 62 °C, or a sub-range consisting of any of these values). m

[0046] In an embodiment, the length of the amplicon amplified via the primer sequence is 80-300 bp, e.g., 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 200, 250, or 300 bp, or a sub-range consisting of any of these values.

[0047] In another aspect, the present application provides a kit comprising the nucleic acid sequence molecule described in the present application.

[0048] In yet another aspect, the present application provides a method for detecting DNA methylation using the nucleic acid sequence molecule or the kit in the present application.

[0049] ​In the present application, the transformed (i.e. non-methylated C transformed into uracil (U)) genomic sense strand is referred to as "OT" (top strand) and the transformed genomic anti-sense strand is referred to as "OB" (bottom strand). Due to the transformation of the bases, "OT" and "OB" are not exactly complementary to each other. The strand that is exactly complementary to "OT" is referred to as "ctOT" and the strand that is exactly complementary to "OB" is referred to as "ctOB".

[0050] In the present application, "DNA template", "template strand" and "DNA template strand" all refer to "OT" or "OB".

[0051] In the present application, the probe sequence (methylated probe sequence or non-methylated probe sequence) is exactly complementary to "OT" or "OB" within its length.

[0052] In the present application, when describing CpG sites, "CpG site or its complementary strand" refers to CpG on the genomic sense strand or the complementary CpG on the genomic anti-sense strand.

[0053] In the present application, when describing CpG sites, unless otherwise specified or can be determined from the context, the CpG site can include CpG site or its complementary strand, especially, the non-test CpG site in the present application usually includes both CpG site or its complementary strand. In the present application, when describing that the probe sequence contains the test CpG site, it means that it contains the dinucleotide complementary to the test CpG site in "OT" or "OB". For example, when the test CpG site in "OT" or "OB" is a methylated site, the dinucleotide in the methylated probe sequence is 5'-CG-3'; when the test CpG site in "OT" or "OB" is a non-methylated site, the dinucleotide in the non-methylated probe sequence is 5'-CA-3'.

[0054] As described above, the methylated probe sequence and the non-methylated probe sequence differ by one base (G / A) at the test CpG site. In the present application, this base is referred to as "difference base". Due to the difference, for the methylated probe sequence, when the overall GC content (in the region of 6 nt including the test CpG site or its complementary strand and 2 nt upstream and downstream, the same below) is not more than 50% (i.e. the number of G and C is not more than 3 nt), for the non-methylated probe, the overall GC content is not more than 34% (i.e. the number of G and C is not more than 2 nt); for the methylated probe sequence, when the overall GC content is more than 50% (i.e. the number of G and C is more than 3 nt), for the non-methylated probe, the overall GC content is more than 34% (i.e. the number of G and C is more than 2 nt).

[0055] In the present application, when describing "GC content" or "overall GC content", if no special instructions are given, it refers to the GC content in the region of 6 nt, including the CpG site or its complementary strand and its upstream and downstream 2 nt.

[0056] In the present application, when describing a base, a nucleoside or a nucleotide, it can refer to the base itself, a nucleoside containing the base, or a nucleotide containing the base or the nucleoside, depending on the specific context, i.e. the three compounds are not strictly distinguished in the present application, but only distinguished by the base part.

[0057] In the present application, unless otherwise specified, the "probe sequence" is intended to cover both "methylated probe sequence" and "unmethylated probe sequence", i.e. the defined technical features apply to both probe sequences respectively.

[0058] In the present application, unless otherwise specified, the "primer sequence" is intended to cover both "upstream primer sequence" and "downstream primer sequence", i.e. the defined technical features apply to both primer sequences respectively.

[0059] In the present application, C in the "CH" site refers to cytosine, and H refers to any one of the three bases A, C or T.

[0060] In the present application, "LNA (Locked Nucleic Acid) modification" refers to introducing a methylene bridge between the 2' oxygen atom and the 4' carbon atom of ribose, locking the sugar ring into a bicyclic molecular pattern, thereby limiting the flexibility of the sugar ring.

[0061] In the present application, when describing the length of the upstream and downstream of a certain site, unless otherwise specified or can be determined otherwise according to the context, the length does not include the base in the site.

[0062] In the present application, the units "bp (base pair)" and "nt (nucleotide)" for describing the length of a DNA sequence can be used interchangeably, which are not intended to distinguish the single- and double-stranded states of DNA.

[0063] In the present application, when describing a nucleic acid sequence molecule, unless otherwise specified or can be determined otherwise according to the context, the direction is from the 5' end to the 3' end.

[0064] In the present application, the degenerate base Y refers to cytosine C and thymine T, and the degenerate base R refers to adenine A and guanine G.

[0065] In the present application, the use of a degenerate base for a specific site means that more than one base can be used at the site in the sequence.

[0066] Specifically, "the C in the CpG site is replaced by degenerate base Y (cytosine C and thymine T)" in the present application means that the dinucleotide at the CpG site is CG and TG, and in one embodiment, the ratio of the amount of CG to TG is about 0.5-2.0, for example, 0.5, 1.0, 1.5, 2.0, preferably, the ratio of the amount of CG to TG is about 1.0.

[0067] "the G in the complementary strand of the CpG site is replaced by degenerate base R (adenine A and guanine G)" in the present application means that the dinucleotide in the complementary strand of the CpG site is CA and CG, and in one embodiment, the ratio of the amount of CA to CG is about 0.5-2.0, for example, 0.5, 1.0, 1.5, 2.0, preferably, the ratio of the amount of CA to CG is about 1.0. "the G in the complementary strand of the non-targeted CpG site is replaced by degenerate base R (adenine A and guanine G)" in the present application means that the complementary strand of the non-targeted CpG site is CA and CG, and in one embodiment, the ratio of the amount of CA to CG is about 0.5-2.0, for example, 0.5, 1.0, 1.5, 2.0, preferably, the ratio of the amount of CA to CG is about 1.0.

[0068] In the present application, "about" means a range of ±10% of the number.

[0069] In the present application, the numerical value can be an approximate value after rounding.

[0070] When the nucleic acid sequence molecule in the present application is used for methylation detection of CpG sites (especially for detection of a single CpG site), the specificity and sensitivity of the detection can be significantly improved. BRIEF DESCRIPTION OF DRAWINGS

[0071] Figure 1 Examples of primer sequences in the present application are shown.

[0072] Figure 2 Examples of probe sequences in the present application are shown.

[0073] Figure 3 Examples of probe sequences in the present application are shown.

[0074] Figure 4 Examples of probe sequences (with LNA modification) in the present application are shown.

[0075] Figure 5 Detection results of capillary electrophoresis of PCR products obtained after PCR amplification with primers in the present application are shown. The abscissa represents the size of the amplified product (unit: bp), and the ordinate represents the fluorescence intensity, the higher the value, the higher the DNA content of the corresponding fragment size.

[0076] Figure 6 Biorad QX200 digital PCR 1D Amplitude plot. Number 1-4 corresponds to the results of group 1-4 in Table 2 respectively. From left to right, it corresponds to the results of methylation probe and unmethylation probe respectively. It shows the influence of the length downstream of the CpG site to be detected contained in the probe sequence on the specificity of the detection results.

[0077] Figure 7 Biorad QX200 digital PCR 1D Amplitude plot. Number 1 and 2 corresponds to the results of group 1 and 2 in Table 3 respectively. From left to right, it corresponds to the results of methylation probe and unmethylation probe respectively. It shows the influence of the overall GC content in the region of 6 nt including the CpG site to be detected and its upstream and downstream 2 nt contained in the probe sequence on the specificity of the detection results.

[0078] Figure 8 Biorad QX200 digital PCR 1D Amplitude plot. Number 1-3 corresponds to the results of probe group 1-3 in Table 4 respectively. From left to right, it corresponds to the results of methylation probe and unmethylation probe respectively. It shows that when the overall GC content in the region of 6 nt including the CpG site to be detected and its upstream and downstream 2 nt contained in the methylation probe sequence is more than 50%, or the overall GC content in the above-mentioned region of the unmethylation probe is more than 34%, the specificity of the detection results can be improved by LNA modification.

[0079] Figures 9-11 Digital PCR 2D Amplitude plot. The horizontal coordinate is the VIC fluorescence intensity (unmethylation probe), and the vertical coordinate is the FAM fluorescence intensity (methylation probe). It successively shows the 2D signal plot of methylation detection using HCT116 gDNA with an average methylation rate of 1% for CLIP4, Septin9 and SDC genes.

[0080] Figure 12 It shows the relationship between the measured methylation rate and the actual methylation rate for CLIP4, Septin9 and SDC genes.

[0081] Figure 13 It shows the T test results of the detection results using HCT116 gDNA with an average methylation rate of 0% and 1% for CLIP4, Septin9 and SDC2 genes. DETAILED DESCRIPTION

[0082] In order to better understand the present application, the following further illustrates the present application with examples, but the present application is not limited to the following examples. The experimental operations described in the following examples are all routine operations unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0083] In order to better understand the present application, the applicant also draws examples of the primer sequences and probe sequences in the present application, i.e., Figures 1-4 .

[0084] Figure 1 Examples of the primer sequences in the present application are shown, wherein the upstream primer sequence and the downstream primer sequence contain 1-2 CH sites in the 5 bases closest to the 3' end thereof; the entire downstream primer contains at least 3 CH sites.

[0085] Figure 2 Examples of the probe sequences in the present application are shown, wherein the probe sequence contains a 4-5 nt length downstream of the to-be-tested CpG site.

[0086] Figure 3 Examples of the probe sequences in the present application are shown. That is, within the region of 6 nt of the to-be-tested CpG site and 2 nt upstream and downstream thereof, the overall GC content is not more than 50% (i.e., the number sum of G and C is not more than 3 nt) for the methylation probe; and the overall GC content is not more than 34% (i.e., the number sum of G and C is not more than 2 nt) for the non-methylation probe.

[0087] Figure 4 Examples of the probe sequences (with LNA modification) in the present application are shown. That is, when the overall GC content is more than 50% (i.e., the number sum of G and C is more than 3 nt) for the methylation probe and the overall GC content is more than 34% (i.e., the number sum of G and C is more than 2 nt) for the non-methylation probe within the region of 6 nt of the to-be-tested CpG site and 2 nt upstream and downstream thereof, LNA modification is introduced on the differential base for the methylation probe sequence; and LNA modification is introduced on the differential base and the 3 nt of the bases upstream and downstream thereof for the non-methylation probe sequence. Examples

[0088] 1. The primer sequence in the present application can amplify amplicon sequence of suitable size

[0089] The human genomic DNA template (from HCT116 cell line (Zymo, D5014)) after transformation was amplified by PCR instrument (Biorad C1000) using three pairs of primers, and the PCR products were purified according to the manufacturer's instructions using magnetic beads (AMPure XP beads, Beckman), and the DNA fragment distribution was detected by capillary electrophoresis (LabChip GX Touch, Revvity) according to the manufacturer's instructions.

[0090] The PCR system used was: 25 μL premix (KAPA HiFi HotStart Uracil+ReadyMix, Roche), 30 ng of the aforementioned human genomic DNA template after bisulfite conversion.

[0091] The PCR cycle conditions were: 98℃ 45s, (98℃ 15s, 60℃ 30s, 72℃ 30s) x33 cycles, 72℃ 1min, 4℃ holding.

[0092] The primers used and the specific amplified gene information are shown in the following table.

[0093] Table 1 Primers and amplified genes

[0094]

[0095] The temperature here refers to the T m of the sequence m .

[0096] The detection results of capillary electrophoresis are shown in Figure 5 .

[0097] From the results in the figure, it can be seen that the three primers have good specificity for Septin9 gene (target fragment 167 bp), SDC2 gene (target fragment 149 bp), and MGMT gene (target fragment 96 bp), respectively, and the amplicon length meets the expectation (capillary electrophoresis error is about ±10 bp).

[0098] 2. The method of the present application has high specificity

[0099] This part explores the influence of the length of the downstream of the detected CpG site in the probe sequence, and the GC content in the region of 6 nt including the detected CpG site and its upstream and downstream 2 nt, on the specificity of the detection results.

[0100] 2.1 The influence of the length of the sequence downstream of the CpG site to be detected contained in the probe sequence

[0101] The methylation status of the CpG site to be detected in the SDC2 gene was detected by a digital PCR system (Biorad QX200) using the same primer sequence combined with different probe sequences.

[0102] PCR system: 10 μL of PCR premix (2x ddPCR supermix for probe (no dUTP), Bio-Rad), 30 ng of human genomic DNA template (from HCT116 cell line (Zymo, D5014)) converted by bisulfite, 900 nM of final concentration of upstream and downstream primer sequences, 250 nM of final concentration of probe sequence, the methylation probe is labeled with FAM, and the non-methylation probe is labeled with VIC, and the probe sequence is modified with MGB.

[0103] The PCR cycle conditions are as follows: 95℃ for 10 min, (94℃ for 30 s, 58℃ for 30 s, 72℃ for 60 s) x 40 cycles, 98℃ for 10 min, and 4℃ for holding the upstream primer (24 nt, 58.3℃): sequence 13: GGGTTTATTTGGGAGTTATATTGT

[0104] Downstream primer (21 nt, 57.5℃): sequence 14: TCTAACTCCCTCCCTCCTAAA

[0105] The sequence of the amplicon converted by bisulfite is: sequence 15: GGGTTTATTTGGGAGTTATATTGTCGTTTTTTTTTTTTAGTCGTTTAGGGGAGTT CG GAGAAGTAGGTTTAGGAGGGAGGGAGTTAGA

[0106] The probe sequence information is shown in the following table.

[0107] Table 2 Probe sequence

[0108]

[0109] Note:

[0110] 1) The underlined bold in the table is the CpG site to be detected contained in the probe sequence;

[0111] 2) For all methylation probe sequences in the table, the overall GC content in the region of 6 nt including the CpG site to be detected and its upstream and downstream 2 nt is equal to 50%; for all non-methylation probe sequences in the table, the overall GC content in the region of 6 nt including the CpG site to be detected and its upstream and downstream 2 nt is approximately equal to 33.3% (i.e., no more than 34%).

[0112] The fluorescence signal results output by the digital PCR system are as shown in Figure 6

[0113] As can be seen from the figure, the probe groups 1-4 can well distinguish the positive signal and the negative signal, that is, the specificity of the detection result is good. Among them, the probe group 3 has no obvious intermediate signal group between the positive signal and the negative background signal, has a better positive signal and background signal distinguishing effect, and has the best specificity.

[0114] 2.2 The influence of the GC content of the probe sequence

[0115] The inventors found that the overall GC content in the region of 6 nt of the to-be-tested CpG site and its upstream and downstream 2 nt has an important influence on the specificity of the detection result. For the methylation probe, controlling the content in the range of not more than 50% can significantly improve the specificity of the detection result, and when the content exceeds 50%, the specificity of the detection result can be significantly improved by LNA modification.

[0116] 2.2.1 For methylation probes, when the overall GC content in the region of 6 nt including the CpG site to be detected and 2 nt upstream and downstream of it is not more than 50%, or for non-methylation probes, when the overall GC content in the above-mentioned region is not more than 34%, the specificity of the detection result is higher Figure 7 2.2.2 For methylation probes, when the overall GC content in the region of 6 nt including the CpG site to be detected and 2 nt upstream and downstream of it is more than 50%, or for non-methylation probes, when the overall GC content in the above-mentioned region is more than 34%, the specificity of the detection result can be improved by LNA modification

[0117] Two groups of primer sequences were combined with probe sequences to detect the methylation state of two to-be-tested CpG sites in the Septin9 gene which are 91 bp apart in the genome by a digital PCR system (Biorad QX200).

[0118] PCR system: 10 μL of PCR premix (2x ddPCR supermix for probe (no dUTP), Bio-Rad), 30 ng of human genomic DNA template (from HCT116 cell line (Zymo, D5014)) converted by bisulfite, 900 nM of final concentration of upstream and downstream primer sequences, 250 nM of final concentration of probe sequence, the methylation probe is labeled with FAM, the non-methylation probe is labeled with VIC, and the probe sequence is modified with MGB.

[0119] The PCR cycle conditions are: 95℃ 10 min, (94℃ 30 s, 58℃ 30 s, 72℃ 60 s) x40 cycles, 98℃ 10 min, 4℃ holding.

[0120] The specific information of the combination of the two groups of primer sequences and the probe sequence is shown in the following table.

[0121] Table 3 Combination of two groups of primer sequences and probe sequences

[0122]

[0123] The fluorescence signal results output by the digital PCR system are as shown in​Figure 8 As shown in the figure.

[0124] As can be seen from the figure, for the methylation probe, when the overall GC content in the region of 6 nt including the CpG site to be tested and its upstream and downstream 2 nt does not exceed 50%, there is no obvious intermediate signal group between the positive signal and the negative background signal, which has better positive signal and background signal differentiation effect and better specificity; and for the non-methylation probe, when the overall GC content in the region of 6 nt including the CpG site to be tested and its upstream and downstream 2 nt does not exceed 34%, the same result can be observed.

[0125] 3. The method of the present application has high sensitivity, high specificity and accuracy Figures 9-11 Figure 12

[0126] The same pair of primer sequences was used to combine with three groups of probe sequences (the three groups of probe base sequences are the same, and the only difference is whether LNA modification is carried out and the number of LNA modification), and the methylation state of the CpG site to be tested in the Septin9 gene was detected by a digital PCR system (Biorad QX200).

[0127] PCR system: 10 μL of PCR premix (2x ddPCR supermix for probe (no dUTP), Bio-Rad), 30 ng of human genomic DNA template (from HCT116 cell line (Zymo, D5014)) converted by bisulfite, 900 nM of final concentration of upstream and downstream primer sequences, 250 nM of final concentration of probe sequence, and the probe sequence is modified with MGB.

[0128] The PCR cycle conditions are as follows: 95℃ for 10 min, (94℃ for 30 s, 58℃ for 30 s, 72℃ for 60 s) for 40 cycles, 98℃ for 10 min, and 4℃ holding.

[0129] The primer sequences, amplicon sequences and probe sequences without LNA modification are shown in sequences 24-28 in Table 3 above. The probe sequences with LNA modification are shown in Table 4 below:

[0130] Table 4 Probe group

[0131]

[0132] The fluorescence signal results output by the digital PCR system are shown in Figure 13 .

[0133] As can be seen from the figures, for the methylation probe, when the overall GC content in the region of 6 nt of the CpG site to be detected and 2 nt upstream and downstream thereof exceeds 50%, compared with the probe without LNA modification, the detection result of the probe with LNA modification has no obvious intermediate signal group, has better positive signal and background signal differentiation effect, and has better specificity, and especially the detection result of the probe sequence with LNA modification introduced only on the differential base has the best specificity; and for the non-methylation probe, when the overall GC content in the above region exceeds 34%, the probe with LNA modification can observe better specificity, and especially the detection result of the probe sequence with LNA modification introduced on the differential base and 1 nt upstream and downstream thereof has the best specificity.

[0134] Figure 12

[0135] Three groups of primer and probe sequence combinations (as shown in Table 5 below) were used to detect the methylation state of the CpG site to be detected in Septin9, SDC2 and CLIP4 genes by a digital PCR system (Digital LightCycler Roche).

[0136] Table 5 Three groups of primer and probe sequence combinations

[0137]

[0138] PCR system: 17.5 μL of PCR premix (NEPLEX Advanced dPCR Mix (2x with dye), Suzhou Xinhai), 30 ng of bisulfite-converted gDNA template (HCT116 gDNA with an average methylation rate of 1% and 5% prepared by using fully methylated HCT116 gDNA, fully unmethylated HCT116 gDNA, fully methylated HCT116 gDNA and fully unmethylated HCT116 gDNA), 280 nM of final concentration of upstream and downstream primer sequences, 140 nM of final concentration of probe sequence, the methylation probe is labeled with FAM, the non-methylation probe is labeled with VIC, and the probe sequence is modified with MGB.

[0139] The PCR cycle condition is: 95℃ 2min, (95℃ 15s, 59℃ 30s, 72℃ 60s) x 45 cycles.

[0140] The 2D signal diagram output by the digital PCR system is as shown in ​ As can be seen from the figures, the positive signal and the background signal of CLIP4, Septin9 and SDC2 are obviously separated, which indicates that the method has good specificity.

[0141] The methylation rates of gDNA template samples with different methylation rates are shown in the table below. ​ As shown.

[0142] Table 6 Comparison of actual methylation rate and measured methylation rate

[0143]

[0144] Meanwhile, a T-test was performed on the detection results of samples with actual methylation rates of 0% and 1%, and the results are shown in the table below. ​ As shown.

[0145] Table 7. Results of the T-test

[0146]

[0147] The t-test results showed that there were significant differences in the detection results of CLIP4, Septin9, and SDC2 in both the 0% and 1% samples (p < 0.05). Meanwhile, from Table 6 and... ​ The results also show that the measured methylation rate is very close to the actual methylation rate, indicating that the detection method of the present invention has high accuracy. Furthermore, it can accurately measure methylation rates as low as 1%, indicating that the detection method of the present invention has high sensitivity.

Claims

1. A nucleic acid sequence molecule, which includes at least a probe sequence. The probe sequence contains one CpG site, which is the CpG site to be tested; The probe sequence includes a methylated probe sequence and an unmethylated probe sequence, with the two probe sequences modified by different fluorescent groups. The dinucleotide corresponding to the CpG site to be tested in the methylated probe sequence is 5'-CG-3', and the dinucleotide corresponding to the CpG site to be tested in the unmethylated probe sequence is 5'-CA-3'. The methylated probe sequence contains a 4-nt downstream region of the target CpG site, and the unmethylated probe sequence contains a 4-nt downstream region of the target CpG site. And the probe sequence must satisfy at least one of the following conditions: i) Within the 6nt region (2nt upstream and downstream) of the CpG site to be tested, the overall GC content of the methylated probe sequence does not exceed 50%; or ii) Within the CpG site to be tested and a 2nt region upstream and downstream of it, totaling 6nt, for methylated probe sequences, the overall GC content exceeds 50%. LNA modification is performed on the CpG site to be tested in both methylated and unmethylated probe sequences. For methylated probe sequences, LNA modification is introduced on the differential bases; for unmethylated probe sequences, LNA modification is introduced on the differential bases and a 1nt region upstream and downstream of them, totaling 3nt. The differential bases refer to bases that differ between the methylated and unmethylated probe sequences at the CpG site to be tested.

2. The nucleic acid sequence molecule according to claim 1, wherein the probe sequence is modified with MGB.

3. The nucleic acid sequence molecule according to claim 1 or 2, wherein, Without considering the influence of MGB, the probe sequence has a T value greater than or equal to 42°C. m value.

4. The nucleic acid sequence molecule according to claim 1 or 2, wherein, The probe sequence contains no more than three consecutive bases.

5. The nucleic acid sequence molecule according to claim 1 or 2, wherein, The probe sequence has a length of 13-25 nt.

6. The nucleic acid sequence molecule according to claim 1 or 2, wherein, Methylated probe sequences may have the same or different lengths as unmethylated probe sequences.

7. The nucleic acid sequence molecule according to claim 1 or 2, wherein, The nucleic acid sequence also includes primer sequences, which include an upstream primer sequence and a downstream primer sequence, wherein the upstream primer sequence and the downstream primer sequence contain one or two CH sites in the five bases closest to their 3' ends.

8. The nucleic acid sequence molecule according to claim 7, wherein, The entire upstream primer sequence must contain at least 3 CH sites, and the entire downstream primer must contain at least 3 CH sites.

9. The nucleic acid sequence molecule according to claim 7, wherein, The entire upstream primer sequence contains at most one non-test CpG site, and the entire downstream primer sequence contains at most one non-test CpG site.

10. The nucleic acid sequence molecule according to claim 7, wherein, The primer sequence is no longer than 30 nt.

11. The nucleic acid sequence molecule according to claim 7, wherein, The upstream and downstream primer sequences may have the same or different lengths.

12. The nucleic acid sequence molecule according to claim 7, wherein, The primer sequence contains no more than 6 consecutive bases.

13. The nucleic acid sequence molecule according to claim 7, wherein, The primer sequence has a T0 of 58-62℃. m value.

14. The nucleic acid sequence molecule according to claim 7, wherein, The length of the amplicon amplified by the primer sequence is 80-300 bp.

15. The nucleic acid sequence molecule according to claim 3, wherein, The probe sequence has a T value greater than or equal to 45°C. m value.

16. The nucleic acid sequence molecule according to claim 4, wherein, The probe sequence contains no more than two consecutive bases.

17. The nucleic acid sequence molecule according to claim 5, wherein, The probe sequence has a length of 15-18 nt.

18. The nucleic acid sequence molecule according to claim 12, wherein, The primer sequence contains no more than 3 consecutive bases.

19. A kit comprising a nucleic acid sequence molecule as described in any one of claims 1-18.

20. A method for detecting DNA methylation, using a nucleic acid sequence molecule as described in any one of claims 1-18 or a kit as described in claim 19, wherein the method is not used for the diagnosis of disease.

Images