SNP-c645g associated with thousand kernel weight of wheat and application thereof

By using molecular marker-assisted selection breeding with SNP-C645G locus, and employing PCR amplification and enzyme digestion techniques to identify the thousand-grain weight trait in wheat, this method solves the problem of poor reproducibility of QTLs across different environments in existing technologies, achieving efficient breeding screening and improving breeding efficiency.

CN120776033BActive Publication Date: 2026-04-21INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
Filing Date
2025-07-11
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

The wheat thousand-grain weight QTLs located in the existing technology have poor repeatability in different environments, making them difficult to apply to the genetic improvement of wheat thousand-grain weight.

Method used

Molecular marker-assisted selection breeding was carried out using the SNP-C645G site. The wheat genotype was detected by PCR amplification and restriction endonuclease Hpy188I digestion to identify the thousand-grain weight trait. Specific primer combinations were designed to screen wheat with high thousand-grain weight.

Benefits of technology

It provides a method for accurately identifying the thousand-grain weight trait in the early stages of breeding, improving the efficiency and effectiveness of wheat breeding, discovering superior genotypes that increase thousand-grain weight, and expanding the tools for wheat genetic resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120776033B_ABST
    Figure CN120776033B_ABST
Patent Text Reader

Abstract

The application discloses a SNP-C645G related to a thousand-grain weight of wheat and an application thereof. The SNP site corresponds to the 645th base from the 5' end of a sequence shown in SEQ ID NO. 1. When the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; and the size of the thousand-grain weight is: the wheat with the genotype A homozygous is less than or less than the wheat with the genotype B homozygous. The SNP has high effectiveness and potential application value. The wheat with a higher thousand-grain weight can be found by detecting the SNP, and the application has important value in the research or application of cultivating a high-yield wheat variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biotechnology, and in particular to SNP-C645G related to the thousand-grain weight of wheat and its applications. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the world's major cultivated species and one of the most important food crops. In my country, the annual planting area of ​​wheat is 26.6667 million hectares, with a total output exceeding 100 million tons, making it the second largest food crop after rice. Since the 1990s, my country has become the world's largest producer and consumer of wheat. With the continuous growth of the population and the continuous improvement of agricultural product processing, the demand for wheat in my country is also constantly increasing. High-yield breeding has always been one of the main goals of wheat breeding in my country.

[0003] The number of spikes, the number of grains per spike, and the thousand-grain weight are the three key factors constituting wheat yield. High-yield breeding aims to gradually improve the levels of these three factors and coordinate their relationship to achieve an optimal combination effect under specific ecological conditions. Among them, thousand-grain weight is one of the important indicators for measuring wheat grain size. A higher thousand-grain weight indicates fuller wheat grains, greater dry matter accumulation, higher starch content, and better flour quality. Therefore, exploring and regulating the thousand-grain weight QTL (quantitative trait loci) is of crucial significance for high-yield and high-quality wheat breeding.

[0004] Currently, researchers have identified a large number of QTLs regulating thousand-grain weight. Wang Ruixia et al. used a constructed genetic map containing 170 SSR markers and 2 EST markers to perform QTL mapping analysis. A total of 35 QTLs were detected, which can explain 4.36% to 16.80% of phenotypic variation. The QTLs involved wheat chromosomes 1A, 1B, 2A, 2D, 3A, 3B, 4A, 4D, 5A, 5B, 6D, and 7D, especially those on chromosomes 1B, 2A, and 3B (Xwmc269, Xgwm33, Xwmc419, Xbarc124, Xgwm636, Xgwm359, Xgwm533, Xwmc307, Xwmc418), can be stably expressed under multiple environments, laying the foundation for fine mapping of thousand-grain weight QTLs and marker-assisted selection. Kim et al. used F2-F5 hybrids of soft and hard wheat to map grain traits and found five QTL loci controlling 1000-grain weight, located at 3B, 1AS / 1AL, 1BS / 1BL, 3DL, and 2AS, with each QTL contributing 5.0%–12.2%. Ammiraju et al. used 113 lines from a RIL population to analyze 1000-grain weight QTLs and found three ISSR markers linked to low grain weight, with contribution rates of 14.8%, 9.5%, and 6%, respectively; and four ISSR markers linked to high grain weight, with contribution rates of 8%, 4.66%, 2.92%, and 2.61%, respectively. They located the three low grain weight QTLs at 6BL, 2DL, and 1DS. Li Wenfu et al. used 168 lines obtained by hybridization of Huapei 3 and Yumai 57 to form a DH population and an IF2 population constructed from the DH population to detect a total of 8 additive effect sites and 5 pairs of epistatic sites controlling thousand-grain weight. Among them, Qtkw6A, located at 6A and controlling thousand-grain weight, was detected in both the DH population and the IF2 population, with contribution rates of 9.39% and 11.75%, respectively. Zhang Zeyuan et al. detected a total of 9 thousand-grain weight QTLs in the RIL population of Heshangtou / Longchun 23, which explained 3.84%–13.26% of phenotypic variation per site, with LOD values ​​of 3.16–11.89. Among them, Qtkw.nwafu-2D.1 (additive effect from Longchun 23) and Qtkw.nwafu-7D (additive effect from Heshangtou) could be detected in more than 3 environments, with contribution rates of 7.19%–12.92% and 7.53%–13.26%, respectively, and LOD values ​​of 4.33–11.89 and 4.63–10.71, respectively.

[0005] Although many QTLs associated with wheat thousand-grain weight have been identified, most QTLs have a small phenotypic contribution, require additive effects to be expressed, and have poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat thousand-grain weight. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide SNP-C645G related to the thousand-grain weight of wheat and its application.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0008] A SNP site associated with the thousand-grain weight of wheat, wherein the SNP site corresponds to the 645th base from the 5' end of the sequence shown in SEQ ID NO.1. When this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B. The thousand-grain weight is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.

[0009] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in the identification of the thousand-grain weight trait of wheat. The reagent or kit is used for the above-mentioned SNP sites. The reagent or kit contains a PCR amplification specific primer combination and enzyme digestion component corresponding to the SNP sites, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0010] As a preferred embodiment of the present invention, the target DNA fragment for PCR amplification of the reagent or kit is designed to be the 619-723bp 5' end of SEQ ID NO.1.

[0011] As a preferred embodiment of the present invention, the PCR amplification specific primer combination includes: primer pairs 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0012] As a preferred embodiment of the present invention, the enzyme digestion component is the restriction endonuclease Hpy188I.

[0013] On the other hand, the present invention also includes a method for identifying or assisting in the identification of wheat thousand-grain weight in the early stage of breeding. Based on the above-mentioned SNP sites, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP sites in the genomic DNA of the wheat to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat thousand-grain weight phenotype is identified or assisted in the identification based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype A is less than or candidate to be less than that of wheat homozygous for genotype B.

[0014] As a preferred embodiment of the present invention, the DNA fragment amplified by PCR is the 619-723bp from the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease Hpy188I is used for enzyme digestion.

[0015] As a preferred embodiment of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease Hpy188I; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the thousand-grain weight is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.

[0016] On the other hand, the present invention also includes the use of the above-mentioned wheat SNP sites, which is to screen or assist in screening the thousand-grain weight phenotype of wheat in the early stage of molecular marker-assisted selection breeding.

[0017] Finally, the present invention also includes a primer combination comprising primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the above-mentioned SNP sites.

[0018] The beneficial effects of adopting the above technical solution are as follows: The research and development team of this invention, through genetic variation analysis of wheat natural variation populations, discovered a SNP corresponding to position 645 from the 5' end of sequence listing 1. This SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis proved that, in the homozygous types of these two genotypes, the thousand-grain weight is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting this SNP, wheat with a higher thousand-grain weight can be identified. This invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yielding wheat varieties or in research. The SNP site developed in this invention not only expands the genetic resource tools for wheat, but also, through our scientific research experiments and data statistics, has been verified to have good and broad application potential. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the gene structure and a schematic diagram of the SNP sites of this invention.

[0020] Figure 2 The results of electrophoresis detection of the SNP-developed dCAPS-labeled enzyme digestion products of this invention are shown; wherein, lane G is the band cleaved by Hpy188I, and lane C is the band that cannot be cleaved by Hpy188I.

[0021] Figure 3 This is a schematic diagram illustrating the correlation between gene polymorphism sites in a natural population and thousand-grain weight.

[0022] Figure 4 This is a schematic diagram of gene SNP sites and genotypes in the wheat population material of this invention.

[0023] Figure 5 This is a photo of the wheat harvesting site in Example 2.

[0024] Figure 6 These are field photos of the wheat thousand-grain weight survey in Example 2. Detailed Implementation

[0025] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0026] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0027] Example 1: Detection of SNPs related to wheat thousand-grain weight and their PCR-enzyme digestion polymorphisms

[0028] 1.1 Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP

[0029] A SNP was found in the intron region of the ER gene in the wheat genome, corresponding to position 645 from the 5' end in sequence listing 1. Two genotypes were found at this site in the naturally occurring wheat population:

[0030] Genotype A: C

[0031] Genotype B: G

[0032] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:

[0033] F1:AAATGGCAACCCTTGGGGGTG (SEQ ID NO: 2)

[0034] R1: ATGGCCATCTTCATGACAA (SEQ ID NO: 3)

[0035] F2: GTATTACACCACAATGATTAAG (SEQ ID NO: 4)

[0036] R2: TTATTACTCTTGGGTGCTTGGT (SEQ ID NO: 5)

[0037] The target sequences for PCR amplification using primer pairs F1 and R1 are shown in Sequence 1 of the sequence listing, positions 489-1740; the target sequences for PCR amplification using primer pairs F2 and R2 are shown in Sequence 1 of the sequence listing, positions 619-723. Enzyme digestion analysis showed that this polymorphism could be recognized by Hpy188I.

[0038] 1.2 Establishment of PCR-restriction polymorphism detection and genotyping methods

[0039] 1) Extract genomic DNA from the wheat to be tested;

[0040] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).

[0041] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min; and storage at 16℃.

[0042] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×TaqMix 10 μL, primer F1 (10 μmol / L) and primer R1 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.

[0043] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 15 s, for 32 cycles; 72℃ for 10 min, and stored at 16℃.

[0044] 4) Digest the PCR product obtained in step 3) with Hpy188I to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified sites according to the following method:

[0045] If the enzyme digestion product is a single or large fragment, then the wheat being tested is homozygous for C at the specified site (represented as C / C). Figure 2 Lane C in the swimming pool;

[0046] If the enzyme digestion product consists of two or smaller fragments, then the wheat being tested is homozygous for G at the specified site (represented as G / G). Figure 2 Lane G in the middle of the swim.

[0047] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:

[0048] I: C / C (i.e., homozygous genotype A);

[0049] II: G / G (i.e., homozygous genotype B);

[0050] The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.

[0051] 1.3. Genotyping of natural populations using dCAPS markers and association analysis with thousand-grain weight trait.

[0052] Each wheat variety in a natural population consisting of 348 hexaploid wheat varieties was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of some wheat varieties were randomly sequenced for verification. The results are shown in Table 1.

[0053] Table 1 shows the polymorphic sites described in the natural wheat population.

[0054]

[0055]

[0056]

[0057]

[0058]

[0059] Example 2: Association Analysis of Gene Polymorphism Sites and Thousand-Grain Weight in Natural Populations

[0060] Our technical team conducted exon capture sequencing on 397 materials and performed specific genotyping on these materials. Genotyping included two cases: homozygous C / C genotype A and homozygous G / G genotype B. For example... Figure 4 Of the 397 materials, 372 materials could be clearly distinguished as homozygous C / C genotype A or homozygous G / G genotype B, while the remaining 25 materials could not be genotyped.

[0061] Furthermore, of these 397 materials, 348 had agronomic trait data from multiple years and locations, while the remaining 49 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 3 As shown, only these 348 data points were used in the association analysis between natural population gene polymorphism sites and thousand-grain weight. However, among these 348 data points, 17 materials did not have genotyping, so the actual number of samples for association analysis was 331.

[0062] In 2019, wheat populations of the above-mentioned natural populations were planted in arid and hot fields, dry fields, and hydrothermal fields at the Third Branch Experimental Station of Hebei Agricultural University (Baoding, Hebei); in 2020, they were planted in arid and hot fields, dry fields, hydrothermal fields, and hydroponic fields at the Hengshui Experimental Site of Hebei Agricultural University (Baoding and Hengshui, Hebei); and in 2021, they were planted in dry fields and arid and hot fields at the Gaocheng Experimental Site of Hebei Agricultural University (Gaocheng Experimental Station). The thousand-grain weight of each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the thousand-grain weight and the polymorphic loci. A mixed linear model + population structure (MLM + (Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 3 As shown.

[0063] Table 2. Association analysis results between gene polymorphism sites in natural populations and thousand-grain weight.

[0064]

[0065] The association analysis results in Table 2 show that the differences in thousand-grain weight between the two types of wheat in the natural population composed of 348 hexaploid wheat accessions shown in Table 1 were statistically significant (P<0.05). Specifically, the thousand-grain weight of wheat in type I was consistently lower than that in type II. In several environments, the thousand-grain weight of wheat materials in type I was 0.698, 1.691, 0.83, 1.624, 1.137, 1.7, 0.891, 0.948, 1.107, and 0.599 grams lower than that in type II, respectively. This study of the natural population indicates that type II is a superior genotype for increasing wheat thousand-grain weight.

[0066] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0067] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. Use of a SNP locus in wheat, wherein the SNP locus corresponds to the 645th base from the 5' end of the sequence shown in SEQ ID NO. 1, and the genotype corresponding to the SNP locus is A when the SNP locus is C / C homozygous, and the genotype corresponding to the SNP locus is B when the SNP locus is G / G homozygous, and the 1000-grain weight of the wheat is smaller in the wheat with genotype A than in the wheat with genotype B. The use is for screening or assisting in screening the 1000-grain weight phenotype of wheat in the early stage of molecular marker-assisted selection breeding.

2. Use of a reagent or kit, wherein the reagent or kit comprises a PCR amplification specific primer combination and a restriction enzyme digestion component corresponding to the SNP locus in claim 1, and a template DNA, a buffer, dNTPs, and other necessary components for gene detection. The use is for identifying or assisting in identifying the 1000-grain weight of wheat by detecting the single nucleotide polymorphism of the SNP locus in the wheat genome, wherein the SNP locus corresponds to the 645th base from the 5' end of the sequence shown in SEQ ID NO. 1, and the genotype corresponding to the SNP locus is A when the SNP locus is C / C homozygous, and the genotype corresponding to the SNP locus is B when the SNP locus is G / G homozygous, and the 1000-grain weight of the wheat is smaller in the wheat with genotype A than in the wheat with genotype B. The PCR amplification specific primer combination includes: The primer pair 1F and 1R consists of SEQ ID NO. 2 and SEQ ID NO. 3, and the primer pair 2F and 2R consists of SEQ ID NO. 4 and SEQ ID NO.

5. The restriction enzyme digestion component is restriction enzyme Hpy188I.

3. A method for identifying or aiding the identification of wheat thousand kernel weight at an early stage of breeding, characterised in that: Based on the SNP locus in claim 1, wherein the SNP locus corresponds to the 645th base from the 5' end of the sequence shown in SEQ ID NO. 1, and the genotype corresponding to the SNP locus is A when the SNP locus is C / C homozygous, and the genotype corresponding to the SNP locus is B when the SNP locus is G / G homozygous; in the early stage of molecular marker-assisted selection breeding, a primer pair is designed to amplify any DNA fragment containing the SNP locus in the wheat genomic DNA by PCR, the genotype of the wheat is identified by restriction enzyme digestion of the PCR amplification product, and the 1000-grain weight phenotype of the wheat is identified or assisted in identifying based on the following correlation between the genotype and the phenotype: the 1000-grain weight of the wheat with genotype A is smaller than that of the wheat with genotype B.

4. The method of claim 3, wherein: The DNA fragment amplified by PCR is 619-723 bp from the 5' end of SEQ ID NO. 1, the specific primer pair for PCR amplification is the primer pair 1F and 1R consisting of SEQ ID NO. 2 and SEQ ID NO. 3, and the primer pair2F and 2R consisting of SEQ ID NO. 4 and SEQ ID NO. 5, and the restriction enzyme digestion uses restriction enzyme Hpy188I.

5. The method of claim 3, wherein: The enzyme digestion comprises the following steps: taking wheat genome DNA as a template, taking primer 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product by 50 times, taking the diluted PCR product as a template, taking primer 2F and 2R as a primer pair to amplify to obtain a PCR product; using a restriction endonuclease Hpy188I to digest the PCR product; if the PCR product cannot be cut, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cut, the nucleotide polymorphism site is G / G, and the genotype is B; and the thousand-grain weight size is: the wheat with genotype A is less than or candidate less than the wheat with genotype B.

Citation Information

Patent Citations

  • Wheat grain weight related SNP-546 site and application thereof

    CN119242842A

  • SNP-C1216T related to thousand seed weight of wheat and application of SNP-C1216T

    CN119799962A