Ferritin nanoparticle-based pTau antigen compound, and vaccine, preparation method and application thereof
By covalently linking phosphorylated Tau antigen epitope peptides with ferritin nanoparticles, a highly immunogenic and safe pTau antigen complex is formed, overcoming the shortcomings of existing AD vaccine vector selection, achieving effective AD vaccine design, and demonstrating significant therapeutic effects.
Patent Information
- Application Number
- CN202410450993.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-15
- Publication Date
- 2025-10-21
AI Technical Summary
In existing AD vaccine designs, phosphorylated Tau peptides, as haptens, cannot elicit an effective immune response on their own and need to be conjugated with a suitable vector to improve the efficacy of immunotherapy. However, the selection of existing vectors raises safety and immunogenicity concerns.
Ferritin nanoparticles were used as a carrier and covalently linked with phosphorylated Tau antigen epitope peptides through the SpyCatcher-SpyTag bioconjugate system to form a stable pTau antigen complex. The ferritin nanoparticles were then used to self-assemble into 24-mer spherical structures to display the antigen epitope.
It enhances the immunogenicity of pTau antigen, induces high-titer antibody responses, and reduces T-cell responses, demonstrating high safety and therapeutic efficacy, and showing significant therapeutic potential against AD-related neurological disorders.
Smart Images

Figure BDA0004795528590000041 
Figure BDA0004795528590000051 
Figure BDA0004795528590000061
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological vaccine technology, and in particular to a pTau antigen complex based on a ferritin nanoparticle carrier, a vaccine containing the same, and a preparation method and use thereof. Background Art
[0002] Alzheimer's disease (AD) is a progressive neurodegenerative disorder and the leading cause of dementia. It is characterized by cognitive impairment and memory loss, affecting short-term memory in the early stages and subsequently impairing long-term memory. As the disease progresses, patients develop neuropsychiatric symptoms such as behavioral and personality changes. The main pathological features of AD are the deposition of extracellular amyloid-β, the accumulation of intracellular neurofibrillary tangles (NFTs), and neuronal loss. Aβ is derived from the amyloid precursor protein (APP). APP is an integral membrane protein expressed in various cells, particularly neurons. Under normal conditions, APP is subsequently metabolized by α-secretase and γ-secretase. In pathological conditions, APP is metabolized by the proteases β-secretase and γ-secretase to form Aβ, which is then released into the extracellular space. Furthermore, hyperphosphorylated microtubule-associated protein tau forms NFTs.
[0003] Tau protein is encoded by the MAPT gene, which is located on chromosome 17 and consists of 16 exons. Gene transcription forms six different isoforms of nuclear RNA. Among them, the selective splicing of exons 2, 3 and 10 of the MAPT gene is key to the formation of Tau isoforms. Exon 10 expresses a microtubule binding region, producing Tau protein with four microtubule (tubulin) binding regions, commonly known as 4R Tau. Other isoforms lacking exon 10 form 3R Tau. The phosphorylation of Tau protein is also affected by the selective splicing of exons. In AD brains, Tau protein exists in an insoluble, hyperphosphorylated form that cannot interact with other microtubules. Instead, it aggregates with other Tau proteins to form neurofibrillary tangles (NFTs), which accumulate in axons and dendrites, leading to neuronal loss. The longest human tau isoform, consisting of 441 amino acids, has a total of 85 phosphorylation sites. The ten most prominent hyperphosphorylated sites are Ser198, Ser199, Ser202, Thr231, Ser235, Ser396, Ser404, Ser409, Ser413, and Ser422, with Ser404 being the most phosphorylated. In AD brains, tau hyperphosphorylation triggers a vicious cycle, promoting the spread of tau pathology in the brain and accumulation in human cerebrospinal fluid (CSF). Sites with elevated phosphorylation levels in the early stages of AD include Thr181, Ser199, Thr205, Ser404, Thr217, Ser262, Thr231, Ser396, and Thr212. Ser199 is abnormally hyperphosphorylated in both the early and late stages of AD, while phosphorylation of Thr231 decreases with AD progression. Increased phosphorylation of Ser202, Thr205, Ser409, and Ser422 occurs in the late stages of neurofibrillary tangles. Hyperphosphorylation reduces Tau's ability to bind to and stabilize microtubules, making it more likely to dissociate from them and aggregate in the cytoplasm, forming insoluble paired helical filaments, the primary components of neurofibrillary tangles (NFTs). Phosphorylated Tau disrupts the neuronal cytoskeleton, leading to cell death and disrupting axonal transport and neural connections. Tau hyperphosphorylation and aggregation are associated with impaired synaptic plasticity and may contribute to cognitive impairment.
[0004] As one of the important pathological mechanisms of AD, Tau protein has attracted widespread attention and has become an important direction for the development of new AD drugs. At present, the research and development of new AD drugs based on Tau protein mainly include the following categories: (1) Tau protein post-translational modification regulators: targeting the phosphorylation, glycosylation and acetylation of Tau protein, reducing the aggregation ability and neurotoxicity of Tau protein; (2) Tau protein aggregation inhibitors: this type of drug directly targets Tau protein, and after interacting with Tau protein, it affects the aggregation of Tau protein by modifying the key areas of Tau protein aggregation or changing the spatial conformation of Tau protein, thereby reducing its neurotoxicity; (3) Microtubule stabilizers: once Tau protein loses its role in maintaining the normal structure and function of microtubules, it will lead to the degeneration and loss of nerve cells. Microtubule stabilizers can compensate for the function of Tau protein, thereby protecting microtubules and preventing the degeneration of nerve cells; (4) Tau protein scavengers or Tau protein expression inhibitors: this type of drug reduces neurotoxicity and improves neurodegeneration by reducing the expression of Tau protein or accelerating the clearance of abnormally aggregated Tau protein; (5) Tau protein-based immunotherapy: active or passive immunotherapy targeting pathological Tau protein is currently a research hotspot in this field.
[0005] Tau-targeted immunotherapies include active and passive immunization. Initially, researchers expressed full-length recombinant Tau protein in a prokaryotic system, which contained T cell epitopes, and induced brain inflammation in mice. Subsequently, Asuni et al. demonstrated that immunization with a phosphopeptide derived from Tau protein in a Tau transgenic AD mouse model reduced neurofibrillary tangles and improved cognitive function without inducing brain inflammation, suggesting that phosphopeptides are potential antigenic epitopes for AD vaccines. Given that AD patients have multiple phosphopeptide sites in their brains, and that the timing and abundance of different phosphorylation sites vary during the AD process, immunization studies targeting different phosphopeptide epitopes may yield different therapeutic effects and safety issues. Currently, the only active vaccine targeting phosphopeptide in clinical trials is ACI-35, which fuses the phosphorylated pTau393-408 [P396 / P404] peptide to liposomes to form a pTau vaccine. The vaccine is currently in Phase II clinical trials. In summary, in the field of AD vaccine research and development, phosphorylated Tau short peptides are very important antigen epitope candidate molecules in vaccine design.
[0006] It is worth noting that while the safe short peptide molecules used in AD vaccine design can interact with antibodies produced by the immune response, they are called "haptens" because they cannot trigger an immune response on their own. They can only be prepared into peptide epitope vaccines with strong immunogenicity by coupling them with suitable carriers. Therefore, selecting an appropriate vaccine carrier can effectively enhance the immunotherapeutic efficacy of AD vaccines using pTau peptides as antigenic epitopes. Summary of the Invention
[0007] Object of the Invention
[0008] In response to the problems or needs in the prior art, the object of the present invention is to provide a pTau antigen complex with high immunogenicity and safety, a vaccine composition based on the pTau antigen complex, and its preparation method and use.
[0009] Solution
[0010] In order to achieve the above object, the present invention provides the following technical solutions:
[0011] In a first aspect, the present invention provides a pTau antigen complex, comprising:
[0012] (1) a pTau epitope peptide with a first tag, and
[0013] (2) ferritin nanoparticles composed of ferritin recombinant protein expressed in fusion with a second tag;
[0014] Wherein, an isopeptide bond is spontaneously formed between the second tag and the first tag, thereby covalently linking the pTau antigen epitope peptide to the ferritin nanoparticle.
[0015] Preferably, the pTau antigen epitope peptide comprises at least one polypeptide fragment from human full-length Tau protein, and the polypeptide fragment comprises at least one phosphorylation site.
[0016] The polypeptide fragment is preferably selected from a region of the human full-length Tau protein that is rich in phosphorylation sites; more preferably, the polypeptide fragment is from the following region of the human full-length Tau protein: amino acids 177-266 and / or amino acids 392-408 of the human full-length Tau protein. The phosphorylation sites are preferably located on serine and / or threonine in the polypeptide fragment.
[0017] The length of the polypeptide fragment is preferably 7 to 11 amino acids. In a feasible embodiment, the length of the polypeptide fragment is 9 amino acids.
[0018] In the present invention, the full-length Tau protein preferably comprises the amino acid sequence shown in SEQ ID NO: 10. In a feasible embodiment, the amino acid sequence of the full-length Tau protein is shown in SEQ ID NO: 10.
[0019] In the present invention, the position of the phosphorylation site is preferably selected from the group consisting of Thr181, Ser199, Ser202, Thr205, Thr217, Thr231, Ser262, Ser396 and Ser404, wherein the amino acid sites correspond to the full-length Tau protein.
[0020] In a feasible embodiment of the present invention, the pTau antigen epitope peptide comprises two phosphorylation sites. More specifically, the pTau antigen epitope peptide comprises, preferably from N-terminus to C-terminus, the following phosphorylation sites: 181 (P-Thr181) and 199 (P-Ser199); 181 (P-Thr181) and 202 (P-Ser202); 181 (P-Thr181) and 205 (P-Thr205); 181 (P-Thr181) and 217 (P-Thr217); 181 (P-Thr181) and 231 (P-Thr231); 181 (P-Thr181) and 262 (P-Ser262); 181 (P-Thr181) and 396 (P-Ser396); 181 (P -Thr181) and 404 (P-Ser404); 199 (P-Ser199) and 202 (P-Ser202); 199 (P-Ser199) and 205 (P-Thr205); 199 (P-Ser199) and 217 (P-Thr217); 199 (P-Ser199) and 231 (P-Thr231); 199 (P-Ser199) and 262 (P-Ser262); 199 (P-Ser199) and 396 (P-Ser396); 199 (P-Ser199) and 404 (P-Ser404); 202 (P-Ser202) and 205 (P-Thr r205); 202 (P-Ser202) and 217 (P-Thr217); 202 (P-Ser202) and 231 (P-Thr231); 202 (P-Ser202) and 262 (P-Ser262); 202 (P-Ser202) and 396 (P-Ser396); 202 (P-Ser202) and 404 (P-Ser404); 205 (P-Thr205) and 217 (P-Thr217); 205 (P-Thr205) and 231 (P-Thr231); 205 (P-Thr205) and 262 (P-Ser262); 205 (P-Thr20 5) and 396 (P-Ser396); 205 (P-Thr205) and 404 (P-Ser404); 217 (P-Thr217) and 231 (P-Thr231); 217 (P-Thr217) and 262 (P-Ser262); 217 (P-Thr217) and 396 (P-Ser396); 217 (P-Thr217) and 404 (P-Ser404); 231 (P-Thr231) and 262 (P-Ser262); 231 (P-Thr231) and 396 (P-Ser396); 231 (P-Thr231) and 404 (P-Ser404);262 (P-Ser262) and 396 (P-Ser396); 262 (P-Ser262) and 404 (P-Ser404); or, 396 (P-Ser396) and 404 (P-Ser404). Preferably, the polypeptide fragment is selected from the group consisting of Tau177-185 (positions 177-185 of the full-length Tau protein), Tau195-203, Tau198-206, Tau201-209, Tau213-221, Tau227-235, Tau258-266, Tau392-400, and Tau400-408.
[0021] The pTau antigen epitope peptide comprises multiple polypeptide fragments derived from the full-length human Tau protein, wherein the different polypeptide fragments are operably linked to each other, for example, via peptide bonds or linkers. Preferably, the linker is a (GSG)n linker, wherein n is an integer from 1 to 3; preferably, the pTau antigen epitope peptide comprises one or two polypeptide fragments, for example, comprising two polypeptide fragments sequentially from the N-terminus to the C-terminus:
[0022] Tau177-185 and Tau195-203, Tau177-185 and Tau198-206, Tau177-185 and Tau201-209, Tau177-185 and Tau213-221, Tau177-185 and Tau227-235, Tau177-185 and Tau258-266, Tau177-185 and Tau392-400, Tau177-185 and Tau400-408, Tau195-206, Tau Tau195-209, Tau195-203 and Tau213-221, Tau195-203 and Tau227-235, Tau195-203 and Tau258-266, Tau195-203 and Tau392-400, Tau195-203 and Tau400-408, Tau198-209, Tau198-206 and Tau213-221, Tau198-206 and Tau227-235, Tau198-206 and Ta u258-266, Tau198-206 and Tau392-400, Tau198-206 and Tau400-408, Tau201-209 and Tau213-221, Tau201-209 and Tau227-235, Tau201-209 and Tau258-266, Tau201-209 and Tau392-400, Tau201-209 and Tau400-408, Tau213-221 and Tau227-235, Tau 213-221 and Tau258-266, Tau213-221 and Tau392-400, Tau213-221 and Tau400-408, Tau227-235 and Tau258-266, Tau227-235 and Tau392-400, Tau227-235 and Tau400-408, Tau258-266 and Tau392-400, Tau258-266 and Tau400-408; or only Tau392-408;
[0023] In a feasible embodiment of the present invention, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 11-46. The corresponding phosphorylation sites in the sequence are specifically shown in the following table:
[0024]
[0025]
[0026]
[0027] Note: The above amino acid sites correspond to the full-length Tau protein (SEQ ID NO: 10).
[0028] In a preferred embodiment of the present invention, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 12-18 and 26-46.
[0029] Preferably, the pTau antigen epitope peptide is connected to the first tag via a linker; preferably, the linker is a (G3S)n linker, wherein n is an integer of 1-3, preferably 1.
[0030] In a feasible embodiment, the first tag can be at the amino terminus or the carboxyl terminus of the antigenic epitope peptide. Preferably, the pTau antigenic epitope peptide is located at the carboxyl terminus of the first tag.
[0031] Preferably, the first tag is a SpyTag tag. In one feasible embodiment, the SpyTag tag comprises the amino acid sequence shown in SEQ ID NO: 6, for example, the amino acid sequence of the SpyTag tag is shown in SEQ ID NO: 6. In one feasible embodiment, the pTau antigen epitope peptide with the first tag comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 47-82.
[0032] Preferably, the ferritin and the second tag are connected via a linker. In a feasible embodiment, the linker is a (GGGGS)n linker, wherein n is an integer of 1-3, preferably 1.
[0033] Preferably, the ferritin is located at the carboxyl end of the second tag.
[0034] Preferably, the second tag is a SpyCatcher tag; further preferably, the SpyCatcher tag is a full-length SpyCatcher tag with an amino acid sequence as shown in SEQ ID NO: 7, or a truncated SpyCatcher tag with an amino acid sequence as shown in SEQ ID NO: 8, preferably a truncated SpyCatcher tag with an amino acid sequence as shown in SEQ ID NO: 8.
[0035] Preferably, the ferritin is selected from the group consisting of Helicobacter pylori ferritin, bullfrog ferritin and ferritin secreted by the insect Trichoplusia ni.
[0036] In a feasible embodiment, the Helicobacter pylori ferritin comprises the amino acid sequence shown in SEQ ID NO: 1; the bullfrog ferritin comprises the amino acid sequence shown in SEQ ID NO: 2 (i.e., bullfrog ferritin L chain) or SEQ ID NO: 3 (i.e., bullfrog ferritin M chain); the insect cabbage looper secreted ferritin comprises the amino acid sequence shown in SEQ ID NO: 4 (i.e., insect cabbage looper secreted ferritin H chain) or SEQ ID NO: 5 (i.e., insect cabbage looper secreted ferritin L chain);
[0037] In a feasible embodiment, the fusion protein of SpyCatcher and ferritin comprises the amino acid sequence shown in SEQ ID NO:9.
[0038] In a feasible embodiment, the pTau antigen epitope peptide connected by the isopeptide bond between the first tag and the second tag self-assembles with the ferritin nanoparticles to form a globular structure, preferably a 24-mer globular structure, and the pTau antigen epitope peptide is located on the surface of the globular structure.
[0039] Preferably, the molar ratio of the pTau antigen epitope peptide with the first tag to the ferritin recombinant protein expressed by fusion with the second tag constituting the ferritin nanoparticles is (2-12):1, preferably (4-8):1, for example 8:1.
[0040] SpyCatcher-SpyTag is derived from the CnaB2 domain of the FbaB protein of Streptococcus pyogenes (S. pyogenes). This domain is bifurcated: the N-terminal segment is called SpyTag (sequence shown in SEQ ID NO:6), and the remainder is called SpyCatcher (sequence shown in SEQ ID NO:7). SpyCatcher is a gene-encoded protein consisting of 138 amino acids (15 kDa) and contains the active lysine K31 and the catalytically active glutamic acid E77. SpyTag is a small 13-amino acid peptide containing the active aspartic acid D117. Upon simple mixing of the two under a wide range of conditions (pH, buffer, and temperature), the lysine K31 and aspartic acid D117 spontaneously form an irreversible isopeptide bond catalyzed by glutamic acid E77. This reaction is highly efficient and does not require additional chemical or enzymatic crosslinking agents, significantly minimizing protein denaturation during surface loading.
[0041] In a preferred embodiment of the present invention, a truncated SpyCatcher (sequence shown in SEQ ID NO: 8) was selected as the second tag for fusion with ferritin. The truncated SpyCatcher retains the biologically active portion without affecting the formation of the isopeptide bond and the ligation efficiency. This ligation system has the advantages of simplicity, stability, and high specificity. It can efficiently couple the pTau peptide to the surface of ferritin nanoparticles, and after ligation, it can still form a stable nanoparticle structure with high immunogenicity.
[0042] In a second aspect, the present invention provides a method for preparing the pTau antigen complex as described in the first aspect, comprising the following steps:
[0043] (1) preparing a pTau antigen epitope peptide with a first tag;
[0044] (2) preparing a fusion protein of the second tag and ferritin, which self-assembles to form ferritin nanoparticles;
[0045] (3) mixing the pTau antigen epitope peptide with the first tag obtained in step (1) with the ferritin nanoparticles obtained in step (2) to perform a coupling reaction to obtain the pTau antigen complex.
[0046] In the above preparation method, preferably, in step (1), the pTau antigen epitope peptide with the first tag is prepared by artificial synthesis;
[0047] Preferably, in step (2), ferritin nanoparticles are prepared by a method comprising the following steps:
[0048] 1) Synthesizing a DNA fragment encoding a fusion protein of the second tag and ferritin;
[0049] 2) constructing the DNA fragment into an expression vector to obtain a recombinant expression vector;
[0050] 3) transferring the recombinant expression vector into a protein expression system for expression to obtain a fusion protein of the second tag and ferritin, which self-assembles to form ferritin nanoparticles;
[0051] Preferably, in step (3), the molar ratio of the pTau antigen epitope peptide with the first tag to the fusion protein of the second tag and ferritin constituting the ferritin nanoparticles is (2-10):1, preferably (4-8):1, for example 8:1.
[0052] Preferably, in step (3), the coupling reaction is carried out in a PBS buffer system. Preferably, the pH of the PBS buffer system is 7.2 to 7.4, preferably 7.4.
[0053] Preferably, in step (3), the reaction temperature of the coupling reaction is 2-8°C, preferably 4°C; and the reaction time is 10-18h, preferably 14h.
[0054] Preferably, step (3) further comprises the step of removing unsuccessfully linked ferritin nanoparticle carriers and / or pTau antigen epitope peptides by centrifugation, dialysis and / or ultrafiltration.
[0055] In a third aspect, the present invention provides a vaccine composition comprising the pTau antigen complex as described in the first aspect above;
[0056] Preferably, the vaccine composition further comprises a pharmaceutically acceptable adjuvant; further preferably, the pharmaceutically acceptable adjuvant is selected from the group consisting of MF59 and CpG, preferably a combination of MF59 and CpG.
[0057] In a fourth aspect, the present invention provides use of the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect in the preparation of a medicament for preventing and / or treating a neurodegenerative disorder in a subject;
[0058] Preferably, the neurodegenerative disorder is selected from the group consisting of Alzheimer's disease, Down syndrome, prion protein cerebral amyloid angiopathy and traumatic brain injury, amyotrophic lateral sclerosis / Parkinson's disease-dementia syndrome, preferably Alzheimer's disease;
[0059] Preferably, the subject is a mammal, preferably a human.
[0060] In a fifth aspect, the present invention provides use of the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect in the preparation of a drug for maintaining or improving, preferably restoring, and more preferably completely restoring cognitive memory in a subject;
[0061] Preferably, the subject is a mammal, preferably a human.
[0062] In a sixth aspect, the present invention provides a method for preventing and / or treating a neurodegenerative disorder, the method comprising: administering to a subject a preventively and / or therapeutically effective amount of the pTau antigen complex as described in the first aspect above or the vaccine composition as described in the third aspect above.
[0063] Preferably, administration is by subcutaneous or intramuscular route.
[0064] Preferably, the subject is a mammal, preferably a human.
[0065] In a twelfth aspect, the present invention provides a method for maintaining or improving, preferably restoring, and more preferably completely restoring a subject's cognitive memory, the method comprising: administering to the subject an effective amount of the pTau antigen complex as described in the first aspect above or the vaccine composition as described in the third aspect above.
[0066] Preferably, administration is by subcutaneous or intramuscular route.
[0067] Preferably, the subject is a mammal, preferably a human.
[0068] In a feasible embodiment of the above aspects, the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect is administered to the subject subcutaneously or intramuscularly (preferably intramuscularly).
[0069] Advantageous Effects
[0070] The pTau antigen complex based on a ferritin nanoparticle carrier of the present invention utilizes a specific SpyCatcher-SpyTag biocoupling system to efficiently load the pTau antigen epitope peptide onto the ferritin nanoparticle carrier. The ferritin nanoparticles loaded with the pTau antigen epitope peptide can still self-assemble into a 24-mer spherical structure, so that the pTau antigen epitope peptide is displayed on the surface of the spherical structure, forming an ordered and repetitive antigen array, thereby stimulating the body to produce a specific immune response against the pTau protein to the greatest extent and having high immunogenicity. The inventors also conducted animal immunization experiments on vaccines containing the pTau antigen complex. The results showed that the vaccine can induce the body to produce high-titer pTau antibodies, alleviate cognitive impairment in animals, and does not induce T cell responses against pTau, thus having high safety.
[0071] In summary, the vaccine based on the pTau antigen complex of the present invention is an ideal vaccine with high immunogenicity and high safety, and has been confirmed by animal experiments to have good therapeutic effects on neurological disorders, and therefore has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0072] One or more embodiments are exemplarily illustrated by the accompanying figures, and these exemplary illustrations do not limit the embodiments. The word "exemplary" is used herein to mean "serving as an example, example, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.
[0073] Figure 1Schematic diagram of the Ferritin-SpyCatcher-pET30a recombinant plasmid obtained by fusion of SpyCatcher to the amino terminus of Ferritin and ligation into the pET30a vector.
[0074] Figure 2 Figures A to B are schematic diagrams of electrophoresis of the Ferritin-SpyCatcher fusion protein, and Figure C is an electron microscopy image of the Ferritin-SpyCatcher fusion protein.
[0075] Figure 3 Figures A to I in the figure show electron microscopic characterization of the ferritin nanoparticle Tau vaccine of the present invention.
[0076] Figure 4 Figures A to I in the figure show the IgG antibody levels against different antigens produced after mice were immunized with the ferritin nanoparticle Tau vaccine of the present invention combined with the composite adjuvant MF59+CpG.
[0077] Figure 5 Panels A to L show the Elispot results after immunization of mice with the ferritin nanoparticle Tau vaccine A1-A36.
[0078] Figure 6 Figures A to H show the serum ELISA results after immunization of TauP301S transgenic mice with ferritin nanoparticle Tau vaccines A2-A8, A16-A36.
[0079] Figure 7 The nesting results after immunization of TauP301S transgenic mice with ferritin nanoparticle Tau vaccines A2-A8, A16-A36 are shown.
[0080] Figure 8 Figures A to D show the water maze latency after immunization of TauP301S transgenic mice with ferritin nanoparticle Tau vaccines A2-A8, A16-A36.
[0081] Figure 9 The number of platform crossings in the water maze experiment after immunization of TauP301S transgenic mice with ferritin nanoparticle Tau vaccines A2-A8 and A16-A36 is shown. DETAILED DESCRIPTION
[0082] Unless expressly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising", etc., will be understood to include the stated elements or components but not to exclude other elements or other components.
[0083] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.
[0084] Unless otherwise specifically defined elsewhere herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0085] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.
[0086] Example 1 Preparation of pTau polypeptide antigen epitope
[0087] In this example, based on the highly phosphorylated site in the human full-length Tau protein (SEQ ID NO: 10), the inventors designed the following 36 pTau polypeptide antigen epitopes comprising two polypeptide fragments selected from the human full-length Tau protein. For specific sequence information, see Table 1 below.
[0088] Table 1: Sequence information of 36 pTau peptide antigen epitopes
[0089]
[0090]
[0091] Note: Capital letters in the "Sequence" column represent phosphorylation sites.
[0092] 36 pTau peptide antigens were designed to be linked to the carboxyl terminus of the SpyTag sequence. The four amino acids GGGS serve as the linker sequence between SpyTag and the pTau antigen. For specific sequence information, see Table 2 below.
[0093] Table 2: Sequence information of 36 SpyTag-pTau peptides
[0094] Serial Number Number Sequence SEQ ID NO:47 b1 AHIVMVDAYKPTKGGGSpapkTppsssgysSpgsp SEQ ID NO:48 b2 AHIVMVDAYKPTKGGGSpapkTppsssspgSpgtp SEQ ID NO:49 b3 AHIVMVDAYKPTKGGGSpapkTppssgspgTpgsr SEQ ID NO:50 b4 AHIVMVDAYKPTKGGGSpapkTppsspslpTpptr SEQ ID NO:51 b5 AHIVMVDAYKPTKGGGSpapkTppssavvrTppks SEQ ID NO:52 b6 AHIVMVDAYKPTKGGGSpapkTppssskigStenl SEQ ID NO:53 b7 AHIVMVDAYKPTKGGGSpapkTppssivykSpvvs SEQ ID NO:54 b8 AHIVMVDAYKPTKGGGSpapkTppsssgdtSprhl SEQ ID NO:55 b9 AHIVMVDAYKPTKGGGSsgysSpgSpgtp SEQ ID NO:56 b10 AHIVMVDAYKPTKGGGSsgysSpgspgTpgsr SEQ ID NO:57 b11 AHIVMVDAYKPTKGGGSsgysSpgsppslpTpptr SEQ ID NO:58 b12 AHIVMVDAYKPTKGGGsgysSpgspavvrTppks SEQ ID NO:59 b13 AHIVMVDAYKPTKGGGSsgysSpgspskigStenl SEQ ID NO:60 b14 AHIVMVDAYKPTKGGGSsgysSpgspivykSpvvs SEQ ID NO:61 b15 AHIVMVDAYKPTKGGGSsgysSpgspsgdtSprhl SEQ ID NO:62 b16 AHIVMVDAYKPTKGGGSsspgSpgTpgsr SEQ ID NO:63 b17 AHIVMVDAYKPTKGGGSsspgSpgtppslpTpptr SEQ ID NO:64 b18 AHIVMVDAYKPTKGGGSsspgSpgtpavvrTppks SEQ ID NO:65 b19 AHIVMVDAYKPTKGGGSsspgSpgtpskigStenl SEQ ID NO:66 b20 AHIVMVDAYKPTKGGGSsspgSpgtpivykSpvvs SEQ ID NO:67 b21 AHIVMVDAYKPTKGGGSsspgSpgtpsgdtSprhl SEQ ID NO:68 b22 AHIVMVDAYKPTKGGGSgspgTpgsrpslpTpptr SEQ ID NO:69 b23 AHIVMVDAYKPTKGGGSgspgTpgsravvrTppks SEQ ID NO:70 b24 AHIVMVDAYKPTKGGGSgspgTpgsrskigStenl SEQ ID NO:71 b25 AHIVMVDAYKPTKGGGSgspgTpgsrivykSpvvs SEQ ID NO:72 b26 AHIVMVDAYKPTKGGGSgspgTpgsrsgdtSprhl SEQ ID NO:73 b27 AHIVMVDAYKPTKGGGSpslpTpptravvrTppks SEQ ID NO:74 b28 AHIVMVDAYKPTKGGGSpslpTpptrskigStenl SEQ ID NO:75 b29 AHIVMVDAYKPTKGGGSpslpTpptrivykSpvvs SEQ ID NO:76 b30 AHIVMVDAYKPTKGGGSpslpTpptrsgdtSprhl SEQ ID NO:77 b31 AHIVMVDAYKPTKGGGSavvrTppksskigStenl SEQ ID NO:78 b32 AHIVMVDAYKPTKGGGSavvrTppksivykSpvvs SEQ ID NO:79 b33 AHIVMVDAYKPTKGGGSavvrTppkssgdtSprhl SEQ ID NO:80 b34 AHIVMVDAYKPTKGGGSskigStenlivykSpvvs SEQ ID NO:81 b35 AHIVMVDAYKPTKGGGSskigStenlsgdtSprhl SEQ ID NO:82 b36 AHIVMVDAYKPTKGGGSivykSpvvssgdtSprhl
[0095] The 36 SpyTag-pTau polypeptide antigens mentioned above were synthesized and prepared by GL biochem (Shanghai) Ltd. and are in a lyophilized form.
[0096] Example 2 Construction of SpyCatcher-Ferritin-pET30a recombinant plasmid
[0097] 1. Construction of SpyCatcher-Ferritin-pET30a recombinant plasmid
[0098] Nde I and Hind III were selected as restriction sites for fusion expression, and the recombinant nucleotide sequences encoding SpyCatcher and Helicobacter pylori Ferritin were connected to the commercial vector pET-30a(+) to obtain the recombinant plasmid (see Figure 1 ).
[0099] The amino acid sequence of the SpyCatcher-Ferritin recombinant protein of the present invention is shown in SEQ ID NO: 9
[0100] Example 3 Expression and purification of SpyCatcher-Ferritin recombinant protein
[0101] 1. Expression of SpyCatcher-Ferritin Recombinant Protein
[0102] Step 1: Take 1 μl of the recombinant expression plasmid solution obtained in Example 2 above (containing 100 ng of the recombinant expression plasmid) and add it to 50 μl of Escherichia coli BL21 competent cells (purchased from TransGen). Incubate on ice for 30 minutes, then heat shock in a 42°C water bath for 90 seconds, and then incubate on ice for 2 minutes.
[0103] Step 2: Add 500 μl of LB medium to the mixture obtained in step 1, and culture at 220 rpm / min and 37°C for 1 h.
[0104] Step 3: The mixture obtained in step 2 is evenly spread on LB solid culture medium containing kanamycin resistance and cultured at 37°C for 24 hours to obtain a strain that stably expresses the recombinant protein.
[0105] Step 4: Pick a growing colony and inoculate it into 200 ml LB medium, culture it at 37°C, 220 rpm, and when the OD value of the culture mixture reaches 0.7-0.9, induce it with isopropylthiogalactoside (IPTG, final concentration 0.5 mM / l) at 18°C, 180 rpm for 16-18 h.
[0106] Step 5: After induction, centrifuge the bacterial solution at 4000 rpm for 30 min, discard the supernatant, resuspend the bacterial pellet with PBS, and centrifuge again at 6000 rpm for 15 min. Discard the supernatant to obtain the bacterial pellet containing the target protein.
[0107] Step 6: Resuspend the resulting bacterial pellet in a 1:10 ratio of protein buffer (PBS pH 7.2-7.4, bacteria:buffer = 1:10). Disrupt the cells by sonication on ice for 45 minutes. Centrifuge the mixture at 16,000 rpm and 4°C for 30 minutes, and collect the supernatant. Filter the supernatant through a 0.45 μm filter to obtain a crude protein extract.
[0108] 2. Purification of SpyCatcher-Ferritin Recombinant Protein
[0109] Take the crude protein extract and add a certain volume of high-concentration ammonium sulfate solution (4 M ammonium sulfate, 50 mM Tris, pH 7.0 ± 0.2) according to the total volume, so that the final concentration of ammonium sulfate in the sample is 1.3 M (pH 7.0 ± 0.2, conductivity 165 ± 10 mS / cm). Sterile filter using a 0.2 μm filter.
[0110] The protein was further purified using a hydrophobic chromatography column (purchased from GE). The specific operation method is as follows: first, rinse the column with ultrapure water, then rinse the hydrophobic column with a certain volume of buffer A (1.3M ammonium sulfate, 50mM Tris, pH7.0±0.2) until the pH value and conductivity of the effluent are consistent with those of the influent, and the flow rate is 2mL / min. After the column is balanced, the protein sample is injected. After the sample has completely entered the column, the equilibration system is washed with buffer A until the UV detector baseline is stable. Use buffer B (50mM ammonium sulfate, 50mM Tris, pH7.0±0.2) and gradient elution (10%-60%). The elution peaks are collected according to the UV detection spectrum, and the detection wavelength is 280nm. The size of the obtained protein monomer is identified by reducing SDS-PAGE.
[0111] The 24-mer form of the SpyCatcher-Ferritin recombinant protein was then further separated and purified using Superdex 200 molecular sieves (purchased from GE). The operation steps were as follows: the column was rinsed with ultrapure water at a flow rate of 1 mL / min for one column volume, and then the column was rinsed again with approximately 120 mL of PBS buffer at pH 7.0±0.2. Then, 2 mL of protein extract was added to the column, and the column was flushed with PBS buffer at a flow rate of 1 mL / min to harvest the peak protein to obtain the SpyCatcher-Ferritin 24-mer recombinant protein.
[0112] Example 4 Identification of the Monomer and Polymer Sizes of SpyCatcher-Ferritin Recombinant Protein
[0113] The monomer size of the SpyCatcher-Ferritin recombinant protein was determined by reducing polyacrylamide gel electrophoresis (SDS-PAGE). The size of the particle aggregates formed by the SpyCatcher-Ferritin recombinant protein was determined by native-PAGE. Figure 2 As shown in A and 2B, the size of the SpyCatcher-Ferritin monomer is approximately 29.2 KDa, and the band size is correct in SDS-PAGE. In non-denaturing Native-PAGE electrophoresis, the size of SpyCatcher-Ferritin is approximately 700 KDa, and the band size is correct, indicating that the SpyCatcher-Ferritin recombinant protein purified in vitro can form aggregates.
[0114] Example 5 Particle Size and Morphology Detection of SpyCatcher-Ferritin Recombinant Protein Particles
[0115] The particle size was measured using a nanoparticle size analyzer (purchased from Malvern) according to the manufacturer's instructions. The analysis results showed that the diameter of the SpyCatcher-Ferritin recombinant protein particles of the present invention was about 13 nm. Figure 2 As shown, electron microscopy results show that the SpyCatcher-Ferritin recombinant protein is a uniform spherical protein in the form of a multimer. Therefore, the above-mentioned SpyCatcher-Ferritin recombinant protein can self-assemble in vitro to obtain a 24-mer SpyCatcher-Ferritin recombinant protein.
[0116] Example 6: Coupling reaction of SpyCatcher-Ferritin recombinant protein and pTau polypeptide antigen
[0117] The purified SpyCatcher-Ferritin was quantified by BCA assay and the pH was adjusted to 7.2-7.4. SpyTag-pTau polypeptide antigens from SEQ ID NO:47 to SEQ ID NO:82 were dissolved in 1 ml of PBS buffer. The prepared pTau polypeptide antigens b1 to b36 were added to the system at a ratio of SpyCatcher-Ferritin molar amount to pTau polypeptide antigen molar amount of 1:8, and the mixture was gently mixed. The reaction system was slowly shaken at 2-8°C overnight. The unbound polypeptides were concentrated and removed using a 100 kDa ultrafiltration tube (Millipore), resulting in 36 conjugated polypeptide epitope vaccines (i.e., A1 to A36).
[0118] Example 7 Particle Size and Morphology Detection of pTau Peptide Antigen Ligation Products
[0119] The particle size was measured using a nanoparticle size analyzer (purchased from Malvern) according to the manufacturer's instructions. The analysis results showed that the recombinant protein particles formed after the pTau polypeptide antigen was coupled with SpyCatcher-Ferritin had particles with an average diameter of about 15 nm. Figure 3 A to Figure 3 As shown in Table 3, electron microscopy results showed that the ligated recombinant proteins formed a uniform 24-mer globular structure. Therefore, the above-mentioned SpyCatcher-Ferritin recombinant proteins were able to self-assemble in vitro and still form a globular structure after ligation. The monomer protein size and recombinant protein particle size of the 36 ligated recombinant proteins of the present invention are shown in Table 3.
[0120] Table 3 Size and particle size of 36 different forms of recombinant proteins of the present invention
[0121]
[0122]
[0123] Example 8 Immunogenicity and Safety Analysis of pTau Vaccine Composition in Wild Mice
[0124] Set up the following experimental and control groups:
[0125] Experimental group: 6-8 week old female C57BL / 6 mice, 5 / group, were injected intramuscularly with 28 vaccine compositions prepared in the above examples (stored in PBS at -20°C after ligation and thawed at room temperature before injection). Each injection dose was 25 μg / mouse, and the immunization volume was 50 μl / mouse. The composite immune adjuvant MF59+CpG (50 μl / mouse, containing 5 μl of CpG, with a final concentration of 5 mg / ml) was used. The composite immune adjuvant MF59+CpG was first mixed with the polypeptide epitope vaccine and then injected. The total immunization volume was 100 μl / mouse. Among them, MF59 adjuvant (preparation method refers to Wei Shi, et al, Vaccine, 2018; specifically, Yamane 85 is dispersed in a buffer containing squalene and Tween 80, followed by high-speed stirring until emulsified, and the emulsion is repeatedly jetted using a microfluidizer (AMH-3 microfluidizer) to form o / w emulsion microparticles (160 nm), which are then filtered and sterilized); CpG was purchased from Takara, and its nucleotide sequence is as follows: TGTCGTCGTCGTTTGTCGTTTGTCGTT, SEQ ID NO: 83).
[0126] Control group: 6-8 week old female C57BL / 6 mice, 5 mice / group, received intramuscular injection of 50 μl / mouse PBS. Immunization was performed every other week for a total of 4 immunizations.
[0127] Mouse serum was collected for ELISA analysis to determine the immune effects of 36 candidate vaccine compositions in wild mice.
[0128] The concentrations of corresponding antibodies in the serum of mice immunized with 36 pTau candidate vaccine compositions were determined by ELISA. Figure 4 As shown in A to 4I. A polypeptide phosphorylated at amino acid position 181 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 84) was used as a coating antigen for detecting the titer of antiserum against phosphorylated T181 site; a polypeptide phosphorylated at amino acid position 199 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 85) was used as a coating antigen for detecting the titer of antiserum against phosphorylated S199 site; a polypeptide phosphorylated at amino acid position 202 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 86) was used as a coating antigen for detecting the titer of antiserum against phosphorylated S202 site; a polypeptide phosphorylated at amino acid position 205 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 87) was used as a coating antigen for detecting the titer of antiserum against phosphorylated T205 site; a polypeptide phosphorylated at amino acid position 217 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: NO:88) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated T217 site; a polypeptide phosphorylated at amino acid position T231 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:89) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated T231 site; a polypeptide phosphorylated at amino acid position S262 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:90) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated T231 site; a polypeptide phosphorylated at amino acid position 396 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:91) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated S396 site; and a polypeptide phosphorylated at amino acid position 404 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:92) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated S404 site.
[0129] The specific steps of ELISA are as follows:
[0130] 1) Dissolve each of the above antigens in PBS (pH 7.2-7.4) to a concentration of 1 μg / mL. Add 100 μL / well of each antigen to an ELISA plate and incubate at 4°C overnight. Discard the plate and wash the 96-well plate three times with 300 μL / well of PBST. Discard the plate. Add 200 μL / well of 3% BSA (PBS) and incubate at 37°C for 1 hour. Discard the plate and wash the 96-well plate three times with 300 μL / well of PBST. Discard the plate.
[0131] 2) Serial dilutions of mouse serum were prepared with 1% BSA (PBS) (gradients: 1:200, 1:800, 1:3200, 1:12800, 1:51200, and 1:204800). 100 μL / well of each dilution was added to the wells and incubated at 37°C for 2 hours. The plate was then discarded and washed three times with 300 μL / well of PBST. The plate was then discarded. 100 μL / well of horseradish peroxide-conjugated biotin secondary antibody (115-035-062, Jackson ImmunoResearch) diluted in 1% BSA (PBS) was added and incubated at 37°C for 1 hour. The plate was then discarded and washed three times with 300 μL / well of PBST. The plate was then discarded. 100 μL / well of TMB was added and incubated at room temperature in the dark for 25 minutes. The reaction was terminated by adding 1 M aqueous sulfuric acid solution and the absorbance at 450 nm was measured using a microplate reader.
[0132] The antibody levels against different antigens in the fourth immunization serum of vaccines A1 to A36 are as follows Figure 4 A to Figure 4 G. The results showed that after immunization, mice in each group of vaccine A1, vaccine A2, vaccine A3, vaccine A4, vaccine A5, vaccine A6, vaccine A7, and vaccine A8 were able to successfully produce antibodies against the pT181 site ( Figure 4 A). After immunization, the mice in the vaccine A1, vaccine A9, vaccine A10, vaccine A11, vaccine A12, vaccine A13, vaccine A14, and vaccine A15 groups produced low levels of antibodies against the pS199 site, and this site could not effectively induce immunogenicity ( Figure 4 B). After immunization, mice in the vaccine A2, vaccine A9, vaccine A16, vaccine A17, vaccine A18, vaccine A19, vaccine A20, and vaccine A21 groups were able to successfully produce antibodies against the pS202 site ( Figure 4 C). After immunization, mice in the vaccine A3, vaccine A10, vaccine A16, vaccine A22, vaccine A23, vaccine A24, vaccine A25, and vaccine A26 groups were able to successfully produce high-concentration antibodies against the pT205 site ( Figure 4D), among which vaccine A4, vaccine A11, vaccine A17, vaccine A22, vaccine A27, vaccine A28, vaccine A29 and vaccine A30 were able to successfully produce high concentrations of antibodies against pT217 ( Figure 4 E); after immunization, mice in the vaccine A5, vaccine A12, vaccine A18, vaccine A23, vaccine A27, vaccine A31, vaccine A32, and vaccine A33 groups were able to successfully produce high-concentration antibodies against the pT231 site ( Figure 4 F); after immunization, mice in the vaccine A6, vaccine A13, vaccine A19, vaccine A24, vaccine A28, vaccine A31, vaccine A34, and vaccine A35 groups were able to successfully produce high-concentration antibodies against the pS262 site ( Figure 4 G); after immunization, mice in the vaccine A7, vaccine A14, vaccine A20, vaccine A25, vaccine A29, vaccine A32, vaccine A34, and vaccine A36 groups were able to successfully produce high-concentration antibodies against the pS396 site ( Figure 4 H); after immunization, mice in the vaccine A8, vaccine A15, vaccine A21, vaccine A26, vaccine A30, vaccine A33, vaccine A35, and vaccine A36 groups were able to successfully produce antibodies against the pS404 site ( Figure 4 I). In summary, after immunizing animals with the 36 pTau candidate vaccine compositions designed in Example 1, 28 vaccines were able to produce antibodies targeting the corresponding phosphorylation sites, demonstrating good immunogenicity.
[0133] Two weeks after the fourth vaccination, the Elispot assay was used to detect the level of IFN-γ produced by the immunized mice against specific antigens to evaluate the level of T cell immune response generated by the antigen. The specific experimental steps are as follows:
[0134] A monoclonal antibody against the cytokine interferon gamma (from the Elispot kit, purchased from BD Biosciences) was coated on a 96-well plate at a concentration of 5 μg / mL. 50 μL was added to each well and the plate was covered and coated overnight at 4°C. The coated plate was discarded, and the plate was washed once with complete medium containing 10% fetal bovine serum. 200 μL of this complete medium was added to each well and the plate was blocked at 37°C for 1 hour before the medium was discarded. The experimental mice were sacrificed by cervical dislocation, and their spleen cells were harvested to prepare a cell culture plate with a concentration of 10 7Cells were stimulated and activated by adding 100 μL of a 100 μL cell suspension to a coated 96-well plate. 1 μg / mL of a specific phosphorylated peptide antigen (pT181-BSA, pS199-BSA, pS202-BSA, pT205-BSA, pT217-BSA, pT231-BSA, pS262-BSA, pS396-BSA, pS404-BSA, or peptide antigen) or 1 μg / mL of prokaryotically expressed full-length Tau protein was added to each well. The cells were incubated at 37°C in a 5% CO2 incubator for 24 hours to stimulate and activate the cells. After 24 hours, the plates were washed twice with sterile water and then washed six times with sterile PBST (pH 7.4, 0.01 mol / L PBS containing 0.05% Tween-20) to remove the cells. Add 50 μL of interferon-γ antibody (from the Elispot kit, purchased from BD Biosciences) to each well at a concentration of 2 μg / mL and incubate at room temperature for two hours. Wash the 96-well plate and add 50 μL of horseradish peroxide-labeled biotin secondary antibody (from the Elispot kit, purchased from BD Biosciences) to each well. Incubate at room temperature for 2 hours, wash four times with PBST, and wash twice with PBS. Then, add 50 μL of Elispot color development solution (AEC substrate) to each well and react at room temperature in the dark for 5-60 minutes. Discard the staining solution, wash with distilled water, and dry overnight. Count the number of activated cells in the sample using a microscope.
[0135] Elispot test results of vaccines Figure 5As shown, the A1, A2, A3, A4, A5, A6, A7, and A8 vaccines produced fewer positive spots in mouse splenocytes after stimulation with pT181-BSA peptide and Tau protein. The A1, A9, A10, A11, A12, A13, A14, and A15 vaccines produced fewer positive spots in mouse splenocytes after stimulation with pS199-BSA peptide and Tau protein. The A2, A9, A16, A17, A18, A19, A20, and A21 vaccines produced fewer positive spots in mouse splenocytes after stimulation with pS202-BSA peptide and Tau protein. The A3, A10, A16, A22, A23, A24, A25, and A26 vaccines produced fewer positive spots in mouse splenocytes after stimulation with pT205-BSA peptide and Tau protein. The A4, A11, A17, A22, A27, A28, A29, and A30 vaccines produced fewer positive spots in mouse splenocytes after stimulation with pT217-BSA peptide and Tau protein. The A5, A12, A18, A23, A27, A31, A32, and A33 vaccines produced fewer positive spots in mouse splenocytes after stimulation with pS231-BSA peptide and Tau protein. The A6, A13, A19, A24, A28, A31, A34, and A35 vaccine groups produced fewer positive spots in mouse splenocytes after stimulation with pS262-BSA peptide and Tau protein. The A7, A14, A20, A25, A29, A32, A34, and A36 vaccine groups produced fewer positive spots in mouse splenocytes after stimulation with pS396-BSA peptide and Tau protein. Vaccines A8, A15, A21, A26, A30, A33, A35, and A36 produced fewer positive spots in mouse splenocytes after stimulation with the pS404-BSA peptide and Tau protein. In summary, the number of IFN-γ-positive spots produced by splenocytes in each group of mice upon stimulation with the phosphorylated peptide and full-length Tau protein was less than 50. This indicates that vaccines A1-A36 do not stimulate T cell responses in mice, confirming the safety of the vaccines.
[0136] Example 9 pTau vaccine composition treatment in TauP301S transgenic model mice
[0137] The A2-A8 and A16-A36 vaccines were used in therapeutic studies in TauP301S transgenic mice. The specific immunization protocol was as follows: TauP301S transgenic mice were purchased from Changzhou Cavens Laboratory Animal Co., Ltd. (Changzhou, China). Two hundred and eighty TauP301S transgenic mice of a C57 / BL6 background were bred and 10 age-matched wild-type C57 / BL6 mice were born from the same cage. When the mice reached six months of age, the TauP301S mice were randomly divided into groups (10 per group, 5 females and 5 males), namely the A2-A8 and A16-A36 vaccine groups, the PBS group, and the wild-type C57 / BL6 mice as a control group (referred to as the WT group). For the A2-A8 and A16-A36 vaccine groups, each immunization dose was 25 μg, supplemented with 50 μL of MF59 and 50 μg of CpG as a combined adjuvant, via bilateral intramuscular injection. Immunizations were performed five times, with the first four immunizations occurring at two-week intervals, followed by a booster dose at 10 months of age. Serum was collected throughout the immunization period for titer testing, and behavioral evaluation was performed at 12 months of age.
[0138] During the whole experimental period, serum antibodies in mice were monitored by ELISA test. Figure 6 As shown in the data, with the increase in the number of immunizations, the concentration of antibodies targeting various pTau sites in mice continued to increase. After booster immunization at 10 months of age, the antibody concentration continued to increase, approaching the antibody level two weeks after the fourth immunization, and the downward trend of antibodies slowed down, proving that A2-A8 and A16-A36 vaccines can successfully induce mice to produce antibodies to pT181, pS202, pT205, pT217, pT231, pS262, pS396, and pS404 sites after immunization, and the antibodies are persistent.
[0139] At 12 months of age, the animals were tested for nesting to assess their ability to perform daily activities. Nesting scores were given at 24 hours of the experiment. Figure 7 The results showed that the nesting test scores of P301S model mice decreased, while the scores of wild-type mice remained relatively stable. Immunotherapy with the A2-A8 and A16-A36 vaccines restored the nesting ability of mice.
[0140] Subsequently, the Morris water maze experiment was used to test the learning and memory ability of the model mice for their sense of spatial position and direction (spatial positioning). The experiment lasted for a total of 5 days, with a fixed time period every day and 4 training sessions in each time period. At the beginning of the training, the platform was placed in a fixed quadrant, and the mice were placed into the pool facing the pool wall from any of the four starting points on the pool wall. The free video recorded the time it took for the mice to find the platform (escape latency) and the swimming path. The mice were placed into the water from four different starting points (different quadrants) for 4 training sessions. Morris water maze experimental method: After the mice found the platform or could not find the platform within 60 seconds (the latency was recorded as 60 seconds), the experimenter led them onto the platform and rested on the platform for 15 seconds before the next test. The mice were trained 4 times a day, and the average latency was used as the learning performance of the mice on that day. On the 6th day, the original platform was removed, and the mice were placed into the water at the entry point farthest from the platform. All mice had the same entry point, and the number of times the mice crossed the original platform within 60 seconds was recorded. The latency of the mice is as follows: Figures 8 - 9 As shown, the PBS-immunized TauP301L control group mice had poor learning ability in the water maze test. The TauP301L group mice had a longer latency to reach the original hidden platform and crossed the original platform significantly less frequently than the control group mice, suggesting that the TauP301L mice had a weakened ability to consolidate spatial memory. The A2-A8 and A16-A36 vaccine-treated groups had a significantly shorter latency to reach the original hidden platform than the PBS group, and crossed the original platform significantly more frequently than the PBS group, and were essentially similar to the wild-type control group. Treatment with the vaccines A2-A8 and A16-A36 improved the memory ability of mice, with no significant differences between the groups, and all significantly better than the PBS control group. These results demonstrate that the vaccines A2-A8 and A16-A36 prepared by the present invention significantly improve the cognitive memory ability of TauP301L AD model mice.
[0141] It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention. The scope of protection of the present invention shall be determined by the scope of the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications shall also be considered within the scope of protection of the present invention.
[0142] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. A pTau antigen complex comprising: (1) a pTau epitope peptide with a first tag, and (2) ferritin nanoparticles composed of ferritin recombinant protein expressed in fusion with a second tag; Wherein, an isopeptide bond is spontaneously formed between the second tag and the first tag, thereby covalently linking the pTau antigen epitope peptide to the ferritin nanoparticle.
2. The pTau antigen complex according to claim 1, characterized in that The pTau antigen epitope peptide comprises at least one polypeptide fragment from a human full-length Tau protein, wherein the polypeptide fragment comprises at least one phosphorylation site; Preferably, the length of the polypeptide fragment is 7 to 11 amino acids; and / or the phosphorylation site is located at serine and / or threonine in the polypeptide fragment. More preferably, the polypeptide fragment is from a region rich in phosphorylation modification sites of the human full-length Tau protein; Further preferably, the polypeptide fragment is from the following region of human full-length Tau protein: amino acids 177-266 of human full-length Tau protein and / or amino acids 392-408 of human full-length Tau protein.
3. The pTau antigen complex according to claim 2, characterized in that The full-length Tau protein comprises the amino acid sequence shown in SEQ ID NO: 10; Preferably, the phosphorylation site is located at a position selected from the group consisting of Thr181, Ser199, Ser202, Thr205, Thr217, Thr231, Ser262, Ser396 and Ser404, wherein the amino acid sites correspond to the full-length Tau protein; More preferably, the pTau antigen epitope peptide comprises two phosphorylation sites; Further preferably, the pTau antigen epitope peptide comprises, preferably from N-terminus to C-terminus, the following phosphorylation sites: 181 (P-Thr181) and 199 (P-Ser199); 181 (P-Thr181) and 202 (P-Ser202); 181 (P-Thr181) and 205 (P-Thr205); 181 (P-Thr181) and 217 (P-Thr217); 181 (P-Thr181) and 231 (P-Thr231); 181 (P-Thr181) and 262 (P-Ser262); 181 (P-Thr181) and 396 (P-Ser396); 181 (P-Thr181) and 217 (P-Thr217); 1) and 404 (P-Ser404); 199 (P-Ser199) and 202 (P-Ser202); 199 (P-Ser199) and 205 (P-Thr205); 199 (P-Ser199) and 217 (P-Thr217); 199 (P-Ser199) and 231 (P-Thr231); 199 (P-Ser199) and 262 (P-Ser262); 199 (P-Ser199) and 396 (P-Ser396); 199 (P-Ser199) and 404 (P-Ser404); 202 (P-Ser202) and 205 (P-Thr205); 202 (P-Ser Ser202) and 217 (P-Thr217); 202 (P-Ser202) and 231 (P-Thr231); 202 (P-Ser202 and 262 (P-Ser262); 202 (P-Ser202) and 396 (P-Ser396); 202 (P-Ser202) and 404 (P-Ser404); 205 (P-Thr205) and 217 (P-Thr217); 205 (P-Thr205) and 231 (P-Thr231); 205 (P-Thr205) and 262 (P-Ser262); 205 (P-Thr205) and 396 (P-Ser396); 205 ( P-Thr205) and 404 (P-Ser404); 217 (P-Thr217) and 231 (P-Thr231); 217 (P-Thr217) and 262 (P-Ser262); 217 (P-Thr217) and 396 (P-Ser396); 217 (P-Thr217) and 404 (P-Ser404); 231 (P-Thr231) and 262 (P-Ser262); 231 (P-Thr231) and 396 (P-Ser396); 231 (P-Thr231) and 404 (P-Ser404); 262 (P-Ser262) and 396 (P-Ser396);262 (P-Ser262) and 404 (P-Ser404); or, 396 (P-Ser396) and 404 (P-Ser404); Still further preferably, the polypeptide fragment is selected from the group consisting of Tau177-185 (positions 177-185 of the full-length Tau protein), Tau195-203, Tau198-206, Tau201-209, Tau213-221, Tau227-235, Tau258-266, Tau392-400 and Tau400-408.
4. The pTau antigen complex according to claim 3, characterized in that The pTau antigen epitope peptide comprises a plurality of polypeptide fragments from a full-length human Tau protein, wherein different polypeptide fragments are operably connected to each other, for example, by peptide bonds or linkers; the linker is preferably a (GSG)n linker; wherein n is an integer from 1 to 3, preferably 1; Preferably, the pTau antigen epitope peptide comprises, preferably comprises the following polypeptide fragments in sequence from N-terminus to C-terminus: Tau177-185 and Tau195-203, Tau177-185 and Tau198-206, Tau177-185 and Tau201-209, Tau177-185 and Tau213-221, Tau177-185 and Tau227-235, Tau177-185 and Tau258-266, Tau177-185 and Tau392-400, Tau177-185 and Tau400-408, Tau195-206, Tau195-209, Tau195-203 and Tau213-221, Tau195-203 and Tau227-235, Tau195-203 and Tau258-266, Tau195-203 and Tau392-400, Tau195-203 and Tau400-408, Tau198-209, Tau198-206 and Tau213-221, Tau198-206 and Tau227-235, Tau198-206 and Tau au258-266, Tau198-206 and Tau392-400, Tau198-206 and Tau400-408, Tau201-209 and Tau213-221, Tau201-209 and Tau227-235, Tau201-209 and Tau258-266, Tau201-209 and Tau392-400, Tau201-209 and Tau400-408, Tau213-221 and Tau227-235, Tau Tau213-221 and Tau258-266, Tau213-221 and Tau392-400, Tau213-221 and Tau400-408, Tau227-235 and Tau258-266, Tau227-235 and Tau392-400, Tau227-235 and Tau400-408, Tau258-266 and Tau392-400, Tau258-266 and Tau400-408, or Tau392-408; More preferably, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 11-46; Further preferably, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 12-18 and 26-46.
5. The pTau antigen complex according to any one of claims 1 to 4, characterized in that The pTau antigen epitope peptide and the first tag are connected via a linker; the linker is preferably a (GGGS)n linker, wherein n is an integer from 1 to 3, preferably 1; and / or, the pTau antigen epitope peptide is located at the carboxyl end of the first tag; Preferably, the first tag is a SpyTag tag; further preferably, the SpyTag tag comprises the amino acid sequence shown in SEQ ID NO: 6; More preferably, the pTau antigen epitope peptide with the first tag comprises an amino acid sequence selected from the following: SEQ ID NO: 47-82.
6. The pTau antigen complex according to any one of claims 1 to 5, characterized in that The ferritin and the second tag are connected via a linker; the linker is a (GGGGS)n linker, wherein n is an integer from 1 to 3, preferably 1; and / or the ferritin is located at the carboxyl end of the second tag; Preferably: the second tag is a SpyCatcher tag; the SpyCatcher tag preferably comprises an amino acid sequence as shown in SEQ ID NO: 7 or 8; And / or, the ferritin is selected from the group consisting of Helicobacter pylori ferritin, bullfrog ferritin, and ferritin secreted by the insect Trichoplusia ni, preferably Helicobacter pylori ferritin, further preferably Helicobacter pylori ferritin whose amino acid sequence is shown in SEQ ID NO: 1; More preferably, the fusion protein of the SpyCatcher and the ferritin comprises the amino acid sequence shown in SEQ ID NO:
9.
7. The pTau antigen complex according to any one of claims 1 to 6, characterized in that The pTau antigen epitope peptide connected by the isopeptide bond between the first tag and the second tag self-assembles with the ferritin nanoparticles to form a spherical structure, preferably a 24-mer spherical structure, and the pTau antigen epitope peptide is located on the surface of the spherical structure; Preferably, the molar ratio of the pTau antigen epitope peptide with the first tag to the ferritin nanoparticles is (2-10):1, preferably (4-8):1, for example 8:
1.
8. The method for preparing the pTau antigen complex according to any one of claims 1 to 7, comprising the following steps: (1) preparing a pTau antigen epitope peptide with a first tag; (2) preparing a fusion protein of the second tag and ferritin, which self-assembles to form ferritin nanoparticles; (3) mixing the pTau antigen epitope peptide with the first tag obtained in step (1) with the ferritin nanoparticles obtained in step (2) to perform a coupling reaction to obtain the pTau antigen complex.
9. The preparation method according to claim 8, characterized in that In step (1), the pTau antigen epitope peptide with the first tag is prepared by artificial synthesis; And / or, in step (2), ferritin nanoparticles are prepared by a method comprising the following steps: 1) Synthesizing a DNA fragment encoding a fusion protein of the second tag and ferritin; 2) constructing the DNA fragment into an expression vector to obtain a recombinant expression vector; 3) transferring the recombinant expression vector into a protein expression system for expression to obtain a fusion protein of the second tag and ferritin, which self-assembles to form ferritin nanoparticles; Preferably: In step (2), the expression vector is a pET-30a vector; In step (3), the molar ratio of the pTau antigen epitope peptide with the first tag to the fusion protein of the second tag and ferritin constituting the ferritin nanoparticles is (2-10):1, preferably (4-8):1, for example 8:1; And / or, in step (3), the coupling reaction is carried out in a PBS buffer system, preferably, the pH of the PBS buffer system is 7.2-7.4; and / or, the reaction temperature of the coupling reaction is 2-8° C., preferably 4° C., and the reaction time is 10-18 h, preferably 14 h; More preferably, step (3) further comprises the step of removing unsuccessfully linked ferritin nanoparticle carriers and / or pTau antigen epitope peptides by centrifugation, dialysis and / or ultrafiltration.
10. A vaccine composition comprising the pTau antigen complex according to any one of claims 1 to 7; Preferably, the vaccine composition further comprises a pharmaceutically acceptable adjuvant; further preferably, the pharmaceutically acceptable adjuvant is selected from the group consisting of MF59 and CpG, preferably a combination of MF59 and CpG.
11. Use of the pTau antigen complex according to any one of claims 1 to 7 or the vaccine composition according to claim 10 in the preparation of a medicament for preventing and / or treating a neurodegenerative disorder in a subject; Preferably, the neurodegenerative disorder is selected from the group consisting of Alzheimer's disease, Down syndrome, prion protein cerebral amyloid angiopathy, traumatic brain injury, and amyotrophic lateral sclerosis / Parkinson's disease-dementia syndrome; preferably Alzheimer's disease; Preferably, the subject is a mammal, preferably a human.
12. Use of the pTau antigen complex according to any one of claims 1 to 7 or the vaccine composition according to claim 10 in the preparation of a medicament for maintaining or improving, preferably restoring, more preferably completely restoring cognitive memory in a subject; Preferably, the subject is a mammal, preferably a human.