Application of FGA-sourced 12 peptide in preparation of nerve injury repairing medicine

Abstract

The invention belongs to the field of nerve injury repair, and particularly discloses application of FGA-sourced 12 peptide in preparation of nerve injury repair drugs, active polypeptide disclosed by the invention is sourced from human endogenous polypeptide FGA and consists of 12 amino acids, and related functions of the active polypeptide are not reported at present. The effect of the micromolecule active polypeptide in nerve injury repair is studied, and it is found that the cell culture fluid containing the micromolecule active polypeptide can be used for promoting survival of hippocampal neuronal cells after oxygen-glucose deprivation; in a rat hypoxic ischemic brain injury model, it is found that the small molecule polypeptide can enter neuronal cells through lateral ventricle administration injection, and encephaledema caused by hypoxic ischemia is remarkably reduced; the cerebral infarction area of the hypoxic ischemic brain injury of the rats is improved; the survival of neurons in the cortex area and the hippocampus area is promoted Therefore, the FGA-sourced 12 peptide disclosed by the invention has a good prospect in preparation of reagents or medicines for repairing nerve injury.

Description

Technical Field

[0001] The present invention belongs to the field of promoting nerve repair, and specifically discloses a small molecule polypeptide derived from FGA and its use in preparing a drug for promoting nerve repair. Background Art

[0002] In recent years, hypoxic-ischemic encephalopathy (HIE), a serious brain injury disorder, has garnered significant attention, particularly in neonates and after certain cerebrovascular events, leading to neuronal damage, brain tissue necrosis, and permanent impairment of neurological function. Although numerous treatment strategies, such as mild hypothermia and drug interventions, have been developed to mitigate neuronal damage and promote recovery, their efficacy is limited and they cannot completely alleviate neurological damage. Therefore, the development of new treatments, particularly precision therapies targeting neuroprotection and neurorepair, is urgently needed.

[0003] Peptides, due to their structural diversity, high bioactivity, and strong targeting, have become an important research area in the field of nerve injury repair. Peptides are easily degraded under physiological conditions and are less likely to cause immune rejection. They can promote nerve regeneration, reduce inflammation, regulate apoptosis, and improve microcirculation by binding to specific receptors or activating signaling pathways. Therefore, the search for novel peptides with neuroprotective and repairing properties is of great clinical significance for the treatment of hypoxic-ischemic neural damage. Summary of the Invention

[0004] To solve the above problems, the present invention discloses a small molecule polypeptide and its use in the preparation of a nerve damage repair reagent or drug. The small molecule polypeptide can significantly inhibit the death of hippocampal neurons caused by hypoxia-ischemia, promote the survival of hippocampal neuronal cells, and significantly reduce the nerve damage in rats with hypoxic-ischemic brain damage. It can be used as a potential nerve repair drug or for preparing cell culture fluid for nerve cells, and has good application prospects.

[0005] This study discovered a specific endogenous polypeptide derived from FGA and its use in the preparation of neural injury repair reagents or drugs. The small molecule polypeptide can significantly promote the activity of hippocampal neurons and inhibit the death of hippocampal neurons after oxygen-glucose deprivation. In the rat hypoxic-ischemic brain injury model, it was found that the above-mentioned small molecule polypeptide can directly enter the neuronal cells through injection into the lateral ventricle to exert its function, reducing cerebral edema caused by hypoxia-ischemia; improving the area of ​​cerebral infarction in rats with hypoxic-ischemic brain injury; promoting the survival of neurons in the cortex and hippocampus; reducing neuroinflammatory response; promoting hippocampal neuron density; and improving learning and memory disorders caused by hypoxia-ischemia. Mechanism analysis found that the active polypeptide improves neural damage by inhibiting hypoxia-ischemia-induced neuronal ferroptosis. The polypeptide can be used as a potential neurorepair drug or for the preparation of drugs for nourishing nerve cells, and has good application prospects.

[0006] The present invention includes the following technical solutions:

[0007] In one aspect, the present invention discloses a small molecule polypeptide having an amino acid sequence as shown in SEQ ID NO. 1, which is originally derived from endogenous human FGA and is named PFGA12 in the present invention.

[0008] Furthermore, the method for preparing the above-mentioned small molecule polypeptide is prepared by the method described in any one of 1) to 3):

[0009] 1) Chemical synthesis; for example, it can be obtained by amino acid solid phase synthesis method;

[0010] 2) Expression in microorganisms or host cells; for example, publicly known and commonly used microorganisms and host cells can be used. After expression, the polypeptide can be isolated and purified by methods and techniques known to those skilled in the art, for example, by conventional liquid chromatography.

[0011] 3) Obtain long-chain polypeptides through biological enzymatic digestion technology.

[0012] Furthermore, the long-chain polypeptide is the human endogenous polypeptide FGA, which becomes FGA12 after cleavage.

[0013] In another aspect, the present invention discloses a biomaterial comprising any one or more of materials i)-v):

[0014] i) a polypeptide or polypeptide composition comprising a small molecule polypeptide according to claim 1;

[0015] ii) a nucleic acid molecule encoding the small molecule polypeptide according to claim 1;

[0016] iii) a vector comprising a nucleic acid sequence encoding the small molecule polypeptide according to claim 1;

[0017] iv) bacteria containing the vector described in iii);

[0018] v) a cell culture medium comprising the polypeptide or polypeptide combination described in i); preferably, the concentration of the polypeptide or polypeptide combination is 10 μM-50 μM.

[0019] Furthermore, the vector iii) is a pET vector or a pGEX vector.

[0020] Furthermore, the iv) cells are selected from one or more of Escherichia coli, Actinomycetes, Bacillus spore-forming bacteria or Streptomyces.

[0021] On the other hand, the present invention discloses a pharmaceutical preparation containing the above-mentioned biological material, and the preparation is in a pharmaceutically acceptable form, including but not limited to one or more of capsules, tablets, pills, pellets, suppositories, lozenges, sprays, creams, and patches.

[0022] On the other hand, the present invention discloses the use of the above-mentioned small molecule polypeptides, biomaterials or pharmaceutical preparations in the preparation of drugs for preventing and / or treating hypoxic-ischemic nerve damage and neuroinflammation.

[0023] Furthermore, the reagent / drug is a drug that promotes the viability of hippocampal neurons under normoxia, promotes the viability of hippocampal neurons in oxygen-glucose deprivation (OGD / R), and or inhibits the death of hippocampal neurons in oxygen-glucose deprivation (OGD / R). In some embodiments, the addition of PFGA12 to the cell culture fluid has the effect of promoting the viability of hippocampal neurons; in some embodiments, the addition of PFGA12 to the cell culture fluid has the effect of promoting the viability of OGD / R hippocampal neurons; in some embodiments, the addition of PFGA12 to the cell culture fluid has the effect of inhibiting the death of HT22 cells in oxygen-glucose deprivation (OGD / R).

[0024] Furthermore, the hippocampal neuronal cells are HT22 cell lines. In the embodiments, the normoxic condition is a normal culture condition, wherein the cells are cultured in a medium supplemented with high-glucose DMEM, FBS, and double-antibody in a carbon dioxide incubator; the OGD / R oxygen-glucose deprivation model is a conventional oxygen-glucose deprivation model, wherein the cells are cultured in a medium supplemented with sugar-free DMEM and cultured in an oxygen-deprived state in a three-gas cell culture incubator of 5% CO2, 94.9% N2, and 0.1% O2 for 12 hours, after which the cells are transferred to a normal cell culture incubator with a medium supplemented with high-glucose DMEM and FBS and reoxygenated for 24 hours.

[0025] The nerve damage is nerve cell damage caused by oxygen-glucose deprivation. In some embodiments, adding PFGA12 to the cell culture medium has the function of inhibiting oxygen-glucose deprivation-induced hippocampal neuron damage.

[0026] Furthermore, the nerve damage is hypoxic / ischemic brain damage or cerebral infarction. In some embodiments, intracerebroventricular injection of PFGA12 can significantly improve the cerebral infarction area of ​​rats with hypoxic / ischemic brain damage.

[0027] Compared with the prior art, the present invention has the following outstanding beneficial effects:

[0028] The present invention discloses a small molecule polypeptide obtained by biological analysis and repeated experimental screening of the endogenous human polypeptide PFGA12. This peptide is derived from FGA and consists of 12 amino acids. Currently, no relevant functional reports have been published. Bioinformatics analysis results show that this endogenous active polypeptide is derived from amino acids 23-35 of the FGA protein. ProtParam online analysis revealed that FGA12 has a molecular weight of 1206.28, an isoelectric point of 4.14, a fat coefficient of 65, and an average hydrophilicity of -0.333. This polypeptide exhibits lipophilic and hydrophobic properties and easily penetrates cell membranes and enters cells.

[0029] The present invention discovered that adding PFGA12 to cell culture fluid inhibits damage to hippocampal neurons caused by oxygen-glucose deprivation. CCK8 experiments confirmed that PFGA12 significantly promoted the viability of hippocampal neurons in both the control and oxygen-glucose deprivation groups. Live-dead cell staining experiments also showed that PFGA12 significantly reduced hippocampal neuron death caused by oxygen-glucose deprivation. Therefore, cell culture fluid containing PFGA12 can be used in the preparation of reagents or drugs to promote the survival of hippocampal neurons after oxygen-glucose deprivation.

[0030] Furthermore, fluorescently labeled PFGA12 was constructed and injected into the lateral ventricle, and it was found that PFGA12 could effectively enter neuronal cells.

[0031] Furthermore, the present invention established a rat model of hypoxic-ischemic brain damage (HIBD). Intracerebroventricular injection of PFGA12 significantly improved cerebral edema, reduced infarct size, and decreased hippocampal neuronal loss in rats with HIBD. Therefore, the PFGA12 disclosed in the present invention can be used to prepare reagents or drugs for the recovery of neurological damage in HIBD.

[0032] Furthermore, the present invention found that intracerebroventricular injection of PFGA12 significantly reduced neuroinflammatory responses, primarily by inhibiting the proliferation and activation of microglia and astrocytes in the cortex and hippocampus. Therefore, the PFGA12 disclosed in the present invention can be used to prepare reagents or drugs to inhibit neuroinflammation in hypoxic-ischemic brain injury.

[0033] Furthermore, the present invention found that PFGA12 can significantly improve learning and memory impairment in HIBD rats and increase neuronal density in the cortex and hippocampus of HIBD rats. Therefore, the PFGA12 disclosed in the present invention can be used to prepare reagents or drugs to improve learning and memory impairment and promote nerve damage repair.

[0034] Furthermore, the present invention constructed an oxygen-glucose deprivation / reoxygenation (OGD / R) hippocampal neuron (HT22) cell model and found that PFGA12 can significantly reduce OGD / R-induced ferroptosis in HT22 cells. This is mainly reflected in the fact that PFGA12 can significantly promote GPX4 expression, reduce ACSL4 expression, reduce Fe2+ accumulation, improve mitochondrial damage, and reduce ROS accumulation. Therefore, the PFGA12 disclosed in the present invention can be used to prepare reagents or drugs that reduce ferroptosis in hypoxic-ischemic hippocampal neurons.

[0035] Furthermore, the present invention constructed an RSL3-induced HT22 cell model of ferroptosis and found that PFGA12 can significantly reduce OGD / R-induced ferroptosis in HT22 cells. This is mainly reflected in the fact that PFGA12 can significantly promote GPX4 expression, reduce ACSL4 expression, reduce Fe2+ accumulation, improve mitochondrial damage, and reduce ROS accumulation. Therefore, the PFGA12 disclosed in the present invention can be used to prepare reagents or drugs that reduce ferroptosis in hippocampal neurons caused by hypoxia-ischemia.

[0036] Furthermore, the present invention constructs PFGA12 labeled with biotin, and through protein affinity pull-down experiments (Pull-down), it is found that PFGA12 can play a role by binding to PRDX1; through fluorescence co-localization experiments, it is found that PFGA12 and PRDX1 are co-localized; in addition, through molecular docking and thermal drift experiments, it is found that PFGA12 binds to PRDX1 and affects the stability of PRDX1; further Western blot experiments find that PFGA12 does not affect the expression of PRDX1, but affects the phosphorylation level of PRDX1; immunofluorescence experiments show that PFGA12 significantly inhibits the phosphorylation level of PRDX1 in the hippocampus. Therefore, the PFGA12 disclosed in the present invention can inhibit neuronal ferroptosis by directly binding to PRDX1 and inhibiting p-PRDX1.

[0037] Furthermore, the present invention knocked down PRDX1 or overexpressed PRDX1 by lentivirus; it was found that PRDX1 knockdown could significantly promote the production of ROS in HT22; overexpression of PRDX1 reduced the accumulation of ROS induced by OGD / R; and in the OGD / R group treated with PFGA12, knocking out PRDX1 could reverse the effect of PFGA12 on Fe 2+ The reduction of Fe 2+ Therefore, the PFGA12 disclosed in the present invention can exert neuroprotective effects by directly binding to PRDX1. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 PFGA12 promotes HT22 cell survival under OGD / R conditions:

[0039] (A) PFGA12 synthesis mass spectrometry results;

[0040] (B) CCK8 assay was used to detect the viability of HT22 cells treated with 10, 25, and 50 μM PFGA12 under normoxia and OGD / R conditions;

[0041] (C) Calcein / PI staining showed the survival status of HT22 cells in the control group, OGD / R group, and 10 / 25 / 50 μM PFGA12 intervention group;

[0042] (D) Quantitative analysis of cell death rate in panel C. Data are expressed as mean ± standard deviation, **p < 0.01;

[0043] Figure 2 In vivo distribution and neuronal uptake of FITC-labeled PFGA12 peptide:

[0044] (A) Whole-body fluorescence imaging of mice at 0 / 12 / 24 h after injection showed the biodistribution of FITC-PFGA12;

[0045] (B) Brain tissue section 6 hours after injection showing fluorescent signals in the hippocampus;

[0046] (C) Confocal microscopy confirmed the colocalization of FITC-PFGA12 (green) and the neuronal marker NeuN (red);

[0047] Figure 3 PFGA12 alleviates nerve damage in neonatal rats with HIBD:

[0048] (A) Characteristics of brain edema in the sham group, model group, and 25 / 50 μM PFGA12-treated group 72 hours after surgery;

[0049] (B) Statistical analysis of brain water content in Figure A (n = 6 / group);

[0050] (C) TTC staining shows the cerebral infarction area (white) and normal tissue (red);

[0051] (D) Quantification of cerebral infarct volume in Figure C (n = 6 / group);

[0052] (E) Nissl staining of hippocampus;

[0053] (FG) Statistics of neuron numbers in CA1 / CA3 region;

[0054] (H) Hippocampal NeuN immunofluorescence;

[0055] (I) Quantification of NeuN fluorescence intensity in H figure;

[0056] Figure 4 PFGA12 reduces neuroinflammation in HIBD rats:

[0057] (AC) Immunofluorescence of Iba1 (red) and GFAP (green) in the whole brain / cortex / hippocampal CA1 region

[0058] (DG) Statistics of Iba1 / GFAP positive signals in the cortex and hippocampus;

[0059] Figure 5 PFGA12 improves learning and memory function in HIBD rats:

[0060] (A) Schematic diagram of the Y-maze experiment;

[0061] (B) Spontaneous alternation rate statistics;

[0062] (C) Golgi staining shows cortical / hippocampal neurons;

[0063] (DE) Neuron number statistics;

[0064] Figure 6 PFGA12 inhibits OGD / R-induced ferroptosis in HT22 cells: (A) GPX4 immunofluorescence;

[0065] (B) ACSL4 immunofluorescence and quantification;

[0066] (C) FerroOrange detects Fe 2+ ;

[0067] (D) TEM analysis of mitochondrial morphology;

[0068] (E) ROS and JC-1 membrane potential detection;

[0069] Figure 7 PFGA12 antagonizes RSL3-induced ferroptosis:

[0070] (A) Schematic diagram of experimental design

[0071] (B) CCK8 cell viability assay (CD) Fe 2+ / ROS fluorescence staining and quantification (E) JC-1 membrane potential analysis;

[0072] Figure 8 PRDX1 was identified as a target of PFGA12:

[0073] (A) Silver staining results of biotinylated peptides;

[0074] (BD) Venn analysis of protein interactions and ranking of binding proteins;

[0075] (E) Co-IP verification of PFGA12-PRDX1 binding;

[0076] (F) Colocalization analysis;

[0077] Figure 9 PFGA12 regulates PRDX1 phosphorylation:

[0078] (A) Molecular docking binding site prediction;

[0079] (BC) PRDX1 thermal stability was detected by CETSA;

[0080] (DE) Western analysis of p-PRDX1 expression;

[0081] (FG) Quantification of hippocampal p-PRDX1 immunofluorescence;

[0082] Figure 10 PRDX1 mediates the neuroprotective effect of PFGA12:

[0083] (A) Western validation of PRDX1 knockdown / overexpression (BC) ROS fluorescence detection and quantification (DE) Ferroptosis-related Fe 2+ Horizontal analysis. DETAILED DESCRIPTION

[0084] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0085] The reagents or instruments used in the examples of the present invention without indicating the manufacturer are all conventional reagent products that can be obtained through commercial purchase.

[0086] The small molecule polypeptide PFGA12, fluorescently labeled FITC-PFGA12 and biotin-labeled Biotin-PFGA12 were commissioned to Shanghai Kepeptide Biotechnology Co., Ltd. for synthesis by solid phase method, and the sequence is Glu-Gly-Asp-Phe-Leu-Ala-Glu-Gly-Gly-Gly-Val-Arg, as shown in SEQ ID NO.1.

[0087] The above sequence is a natural sequence derived from human umbilical cord blood. In addition to being obtained by chemical solid-phase synthesis, it can also be obtained by cloning and expressing a DNA fragment carrying a nucleotide sequence encoding one of the polypeptides in a host microorganism or cell; it can also be obtained by biological enzymatic digestion of long-chain polypeptides, or prepared by existing recombinant DNA technology.

[0088] The expression vectors and host cells used in the present invention are all known to the public through recombinant technology. Examples of expression vectors include pET vectors and pGEX vectors; and host cells include Escherichia coli, Actinomycetes, Bacillus, and Streptomyces. The polypeptides described in the present invention can be isolated from host cells using conventional enzymatic digestion methods or separated and purified by conventional liquid chromatography. These separation and purification methods are all well known to those skilled in the art.

[0089] The CCK-8 cell viability assay kit was purchased from Nanjing Novezan Biotechnology Co., Ltd., the Calcein / PI cell viability and cytotoxicity assay kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd., the TTC staining kit was purchased from Beijing Solebaugh Technology Co., Ltd., Western Blot reagents were purchased from Shanghai Beyotime Biotechnology Co., Ltd., immunofluorescence antibodies were purchased from Proteintech and Cell Signaling Technology, and Golgi staining solution was purchased from Servicebio.

[0090] Example 1

[0091] PFGA12 promotes HT22 cell survival under OGD / R conditions.

[0092] Synthesize the peptide PFGA12 and detect it by mass spectrometry ( Figure 1 A); Hippocampal neuronal cell line (HT22) was used as the research object. HT22 cells were cultured in a 37°C, 5% CO2 incubator and then seeded into 96-well plates. After 24 hours of culture, the complete culture medium (high-glucose DMEM, 10% FBS, 1% penicillin-streptomycin) was replaced with a sugar-free, serum-free culture medium (sugar-free DMEM, 1% penicillin-streptomycin). HT22 cells were then placed in a three-gas incubator with 5% CO2, 94.7% N2, and 0.3% O2. After 12 hours of treatment, the cells were transferred to a normal cell culture incubator for culture to establish an oxygen-glucose deprivation (OGD) hippocampal neuronal (HT22) cell model. Endogenous peptide PFGA12 was used to intervene in HT22 cells under normoxia and OGD / R treatment for 24 hours. The peptide treatment concentrations were 10μM, 25μM, and 50μM. The control group was given scrambled Scr peptide as a control. Three replicates were used in each group. After 24 hours of intervention, the 96-well plate was removed and 10μl CCK-8 was added to each well. The plate was returned to the 37°C incubator for further incubation for 2 hours. The absorbance at a wavelength of 450nm was measured using a microplate reader and recorded. Cell viability ( Figure 1B). An oxygen-glucose deprivation (OGD) hippocampal neuron (HT22) cell model was constructed. Endogenous peptide PFGA12 was used to intervene in OGD / R-treated HT22 cells for 24 hours. Calcein / PI cell viability and cytotoxicity assay kits were used to detect the effect of peptide PFGA12 on hippocampal neuron cell death after oxygen-glucose deprivation ( Figure 1 CD).

[0093] like Figure 1 As shown, the peptide PFGA12 can significantly improve the nerve cell damage caused by OGD / R, promote the vitality of OGD / R nerve cells, and reduce the nerve cell death caused by OGD / R.

[0094] Example 2

[0095] Distribution and neuronal uptake of FITC-labeled PFGA12 peptide in vivo

[0096] Seven-day-old Sprague-Dawley (SD) rats were anesthetized with isoflurane and fixed in a stereotaxic apparatus. 50 μM FITC-labeled PFGA12 peptide (3 μL total) was injected into the lateral ventricle, and the needle was left in place for 5 minutes to prevent reflux. Whole-body fluorescence imaging was performed using a Tanon ABL X6 imaging system (Tianneng, Shanghai, China) 30 minutes, 12 hours, and 24 hours after injection. Figure 2 A). To evaluate the colocalization of FITC-PFGA12 with neurons, brain tissue was harvested 6 hours after injection ( Figure 2 B), Immunofluorescence staining using anti-NeuN antibody to mark neurons ( Figure 2 C).

[0097] like Figure 2 As shown, the peptide PFGA12 can diffuse in brain tissue and enter nerve cells.

[0098] Example 3

[0099] PFGA12 alleviates nerve damage in neonatal rats with HIBD

[0100] A rat model of hypoxic-ischemic brain damage was established. SD rat pups were taken 7 days after birth. The left common carotid artery was exposed and ligated according to the conventional Rice-Vannucci method. After being returned to the mother rat for 2 hours, the rats were placed in an 8% O2, 92% N2 hypoxia box for 2 hours to establish the hypoxic-ischemic brain damage (HIBD) group. In the peptide intervention group, after ligating the left common carotid artery, peptide intervention (intervention concentrations of 25 and 50 μM) was performed in the lateral ventricle of the rats in the hypoxic-ischemic brain damage group using a stereotaxic apparatus. The control group used a sham operation group, which only exposed the left common carotid artery. After treatment, the rats were returned to the mother rat. After 72 hours, the pups' brains were taken for subsequent experiments. The brain tissue was dissected, and by testing the water content of the brain tissue, it was found that 25 and 50 μM PFGA12 could significantly reduce brain tissue edema in HIBD rats ( Figure 3 AB); TTC staining results showed that 25 and 50 μM PFGA12 could significantly reduce cerebral infarction volume (3C-D); Nissl staining results showed that 25 and 50 μM PFGA12 could significantly reduce neuronal loss in hippocampal brain tissue (3E-G); immunofluorescence results showed that 25 and 50 μM PFGA12 could significantly reduce neuronal loss in hippocampal brain tissue (3H-I).

[0101] like Figure 3 As shown in the results, the peptide PFGA12 can significantly alleviate the nerve damage in neonatal rats with HIBD.

[0102] Example 4

[0103] PFGA12 reduces neuroinflammation in HIBD rats

[0104] Immunofluorescence staining with IBA1 and GFAP to mark microglia and astrocytes, respectively, revealed that PFGA12 significantly reduced the activation of microglia and astrocytes in the cortex and hippocampal CA1 region (4A-G). Figure 4 As shown in the results, the peptide PFGA12 can significantly inhibit neuroinflammation in HIBD rats.

[0105] Example 5

[0106] PFGA12 improves learning and memory function in HIBD rats

[0107] To assess the spatial memory ability of rats, a Y-maze system was used. The maze consists of three arms of equal length (40 cm long × 10 cm wide × 15 cm high), labeled A, B, and C. Each rat was placed at the end of Arm A and allowed to explore freely for 5 minutes. The entire process was recorded by a camera system. The working memory ability of the rat was assessed by analyzing the order in which the rat entered the different arms (defined as spontaneous alternation of entering three different arms in succession). After each rat was tested, the maze was cleaned with 75% ethanol.

[0108] In order to observe the morphology of neurons, Golgi staining was used. After the experimental animals were anesthetized, the brain tissue was immediately taken and fixed in Golgi staining solution at 4°C in a dark environment for 14 days. After fixation, the brain tissue was gently rinsed with phosphate buffered saline (PBS), and then transferred to a 10% ammonium silver nitrate solution and immersed in the dark for 48 hours. The stained tissue was cut into 30μm thick sections with a freezing microtome, rinsed 3 times with 0.01M PBS (5 minutes each), dehydrated with 5%, 10%, and 20% gradient ethanol (5 minutes each), and transparentized with xylene twice (15 minutes each), and finally sealed with neutral gum. All sections were observed for neuronal structure under a bright field microscope.

[0109] The results show that Figure 5 As shown in the Y-maze experiment, it was found that PFGA12 polypeptide intervention significantly promoted the autonomous conversion rate of HIBD rats in the Y-maze and improved the learning and memory ability of HIBD rats (5A-B); Golgi staining results showed that PFGA12 polypeptide intervention significantly promoted the density of cortical and hippocampal neurons (5C-E).

[0110] Example 6

[0111] PFGA12 inhibits OGD / R-induced ferroptosis in HT22 cells

[0112] An OGD / R HT22 cell model was constructed and the expression of ferroptosis marker genes GPX4 and ACSL4 was detected by immunofluorescence. 2+ The intracellular ferrous ion content was detected by staining; the mitochondrial morphology was observed by transmission electron microscopy; the intracellular reactive oxygen species level was observed by ROS staining; and the mitochondrial membrane potential was observed by JC-1 staining.

[0113] The results show that Figure 6 As shown in the results of immunofluorescence, PFGA12 peptide intervention significantly promoted the low expression of GPX4 induced by OGD / R and reduced the high expression of ACSL4 induced by OGD / R (6A-D); it also reduced the Fe 2+ High accumulation (6E-F); improved mitochondrial morphology (6G); reduced OGD / R-induced ROS accumulation (6H-I); and promoted mitochondrial membrane potential (6J-K).

[0114] Example 7

[0115] PFGA12 antagonizes RSL3-induced ferroptosis

[0116] HT22 cells were treated with ferroptosis inducer RSL3, and cell viability, Fe 2+content, ROS level and mitochondrial membrane potential.

[0117] The results show that Figure 7 As shown in Figure 7, CCK-8 assays showed that as the concentration of RSL3 increased, cell viability decreased in a dose-dependent manner, while PFGA12 treatment significantly restored the viability of HT22 cells treated with 10 nM and 25 nM RSL3 (7B). FerroOrange staining showed that PFGA12 could significantly reduce the Fe 2+ PFGA12 significantly increased the ROS production in HT22 cells treated with RSL3 (7C). ROS staining showed that ROS production was significantly increased in HT22 cells treated with RSL3, an effect effectively inhibited by PFGA12 (7D-E). JC-1 staining further confirmed that PFGA12 treatment significantly increased the JC-1 aggregate / monomer ratio, suggesting an improvement in mitochondrial membrane potential (7F-G).

[0118] Example 8

[0119] PRDX1 was identified as a target of PFGA12

[0120] To further explore the molecular mechanism by which PFGA12 inhibits neuronal ferroptosis, its direct targets were identified through affinity pull-down experiments, Co-IP verification, and fluorescence co-localization.

[0121] The results show that Figure 8 As shown, silver staining results showed that PFGA12 can bind to a variety of proteins with different molecular weights (8A). Mass spectrometry analysis identified 124 proteins that bind to PFGA12, of which 37 were PFGA12-specific binding proteins (compared to the disordered peptide control group) (8B). By performing Venn analysis on these 37 specific proteins and the ferroptosis-related protein database, PRDX1 was found to be the only overlapping protein (8C-D), suggesting that PFGA12 may inhibit ferroptosis by targeting PRDX1. This interaction was further verified by pull-down combined with Western blot experiments, confirming that PFGA12 can directly bind to PRDX1 (8E). Immunofluorescence microscopy observations showed that PFGA12 and PRDX1 co-localized in the cytoplasm, supporting the hypothesis that PFGA12 inhibits ferroptosis through PRDX1.

[0122] Example 9

[0123] PFGA12 regulates PRDX1 phosphorylation

[0124] To clarify whether PFGA12 directly binds to and regulates PRDX1 expression, molecular docking analysis, cell thermal shift assay (CETSA), Western blot experiment, and immunofluorescence staining were performed.

[0125] The results show that Figure 9 As shown, PFGA12 binds to PRDX1 through multiple hydrogen bonds and hydrophobic interactions, forming a stable conformation (9A). Cellular thermal shift assay (CETSA) demonstrated that PFGA12 reduced the thermal stability of PRDX1, as evidenced by a decrease in PRDX1 protein content under high temperature conditions (9B-C). In OGD / R-induced HT22 cells, Western blot analysis showed that PFGA12 significantly reduced OGD / R-induced PRDX1 phosphorylation levels (9D-E). Immunofluorescence staining of hippocampal neurons in a mouse model of hypoxic-ischemic brain damage (HIBD) revealed that PFGA12 treatment effectively reduced p-PRDX1 expression in neurons (9F-G). These results suggest that PFGA12 exerts neuroprotective effects by regulating the stability and phosphorylation status of PRDX1.

[0126] Example 10

[0127] PRDX1 mediates the neuroprotective effect of PFGA12

[0128] A shRNA targeting the PRDX1 gene (LV-shPRDX1) and a scrambled control (LV-shControl) were designed. Their sequences were: shRNA1: GGATTAACACACCCAAGAAAC = SEQ ID NO. 2; shRNA2: GCCACCATTGCTCAGGATTATG = SEQ ID NO. 3; shRNA3: GCTGATGAAGGTATCTCTTTC = SEQ ID NO. 4. A lentiviral vector carrying the full-length PRDX1 cDNA (NM_011034.5) (LV-PRDX1) and an empty vector control (LV-Vector) were also constructed. HT22 cells were seeded in 6-well plates and the corresponding lentiviral particles were added at a multiplicity of infection (MOI) of 20. 8 μg / mL polybrene (Sigma-Aldrich) was used to enhance infection efficiency. After 24 hours, the culture medium was replaced with complete medium and cultured for an additional 72 hours. Overexpression and knockdown efficiencies were determined by Western blot. ROS staining and FerroOrange staining were performed.

[0129] The results show that Figure 10 As shown in Figure 10, siRNA1 / 2 / 3 can effectively reduce PRDX1 expression (10A), while the PRDX1 protein level in the overexpression group was significantly increased. ROS staining showed that PRDX1 knockout significantly increased the ROS level in HT22 cells, while PRDX1 overexpression significantly inhibited the ROS accumulation induced by OGD / R (10B-C). FerroOrange staining showed that PFGA12 could significantly alleviate the Fe 2+However, in the OGD / R group treated with PFGA12, PRDX1 knockout could reverse the effect of PFGA12 on Fe 2+ These results confirmed that PRDX1 is involved in regulating ROS metabolism during OGD / R, and PFGA12 exerts its anti-ferroptosis effect by targeting PRDX1.

[0130] Based on the above examples, it can be seen that the present invention discloses a small molecule polypeptide and its use in the preparation of a nerve damage repair reagent or drug. The small molecule polypeptide can significantly inhibit the death of hippocampal neurons caused by OGD, promote the survival of hippocampal neurons, and significantly reduce the nerve damage in rats with hypoxic-ischemic brain damage. It can be used as a potential nerve repair drug or for preparing cell culture fluid for nerve cells, and has good application prospects.

[0131] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.

Claims

1. A small molecule polypeptide, characterized in that: The small molecule polypeptide has an amino acid sequence as shown in SEQ ID NO.

1.

2. The method for preparing a small molecule polypeptide according to claim 1, wherein: The small molecule polypeptide is prepared by the method described in any one of 1) to 3): 1) Chemical synthesis; 2) Expression in microorganisms or host cells; 3) Obtain long-chain polypeptides through biological enzymatic digestion technology.

3. The method for preparing a small molecule polypeptide according to claim 2, characterized in that: The long-chain polypeptide is the human endogenous polypeptide COL3A1.

4. Biomaterial, characterized in that Including any one or more of i)-v): i) a polypeptide or polypeptide composition comprising a small molecule polypeptide according to claim 1; ii) a nucleic acid molecule encoding the small molecule polypeptide according to claim 1; iii) a vector comprising a nucleic acid sequence encoding the small molecule polypeptide according to claim 1; iv) bacteria containing the vector described in iii); v) a cell culture medium containing the polypeptide or polypeptide composition described in i).

5. The biomaterial according to claim 4, characterized in that The iv) cells are selected from one or more of Escherichia coli, Actinomycetes, Bacillus spore-forming bacteria or Streptomyces.

6. The biomaterial according to claim 4, characterized in that In the v) cell culture medium, the concentration of the polypeptide or polypeptide combination is 10 μM-50 μM.

7. A pharmaceutical preparation, characterized in that The pharmaceutical preparation contains the biomaterial according to claim 4, and the preparation is in a pharmaceutically acceptable form, including but not limited to one or more of capsules, tablets, pills, pellets, suppositories, lozenges, sprays, creams, and patches.

8. Use of the small molecule polypeptide, biomaterial or pharmaceutical preparation according to any one of claims 1, 4 to 6, and 7 in the preparation of an agent / drug for promoting hippocampal neuronal cell proliferation or repairing nerve damage.

9. The use according to claim 8, characterized in that The nerve damage is nerve cell damage caused by oxygen and glucose deprivation.

10. The use according to claim 8, characterized in that The nerve damage is hypoxic / ischemic brain damage or cerebral infarction.

Images