Enhancer regulatory elements for transcriptional regulation of human ltf gene expression and uses

By identifying and constructing transcriptional regulatory elements and vectors specific to the human LTF gene, the problem of low LTF expression efficiency in bovine mammary glands has been solved, achieving high-efficiency expression and supporting the development of mammary gland bioreactors and functional dairy products.

CN120866319BActive Publication Date: 2026-05-22NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-22
Publication Date
2026-05-22

AI Technical Summary

Technical Problem

Existing technologies cannot explain the efficient expression of human lactoferrin (LTF) in bovine mammary glands. There is a lack of systematic discovery and validation of human-specific regulatory elements, and existing expression vectors rely on species-conserved elements, making it difficult to achieve high LTF expression at the human level.

Method used

Using enhancer regulatory elements and vectors that regulate the transcriptional expression of the human LTF gene, key regulatory sequences for extremely high expression of LTF in human milk were identified through multi-omics analysis such as ATAC-seq and ChIP-seq. The pGL4.17 and pcDNA3.1 vectors were constructed to achieve efficient cross-species expression.

Benefits of technology

It significantly activates reporter gene expression in bovine mammary epithelial cells, increasing expression efficiency to over 90% of the natural human level, reducing R&D cycle and cost, providing an efficient expression tool, and supporting the development of mammary bioreactors and functional dairy products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866319B_ABST
    Figure CN120866319B_ABST
Patent Text Reader

Abstract

The application discloses an enhancer regulatory element for transcriptional regulation and expression of a human LTF gene and application thereof, wherein the sequence of the regulatory element is SEQ ID No. 1. Experiments prove that the human-specific regulatory element can significantly activate the expression of a reporter gene (up to 14.93 times) in a bovine mammary epithelial cell line (MACT), breaks through the limitation of a species-conserved element in the prior art, and an expression system designed based on the element can realize efficient expression of LTF at a human level, thereby providing a new tool for mammary gland bioreactors and development of functional dairy products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal molecular genetics and precision breeding technology, specifically involving the identification of enhancer regulatory elements that affect the extremely high expression of human lactoferrin (LTF) gene in bovine mammary epithelial cells and their application in the genetic improvement of lactation performance in ruminants. Background Technology

[0002] Lactoferrin (LTF), an important functional protein in mammalian milk, has been a research hotspot in molecular genetics and animal husbandry breeding. Although LTF is expressed in many mammals, the concentration of LTF in human milk is significantly higher than that in other species (such as cattle and goats). This difference may be related to species-specific transcriptional regulatory mechanisms. Currently, some regulatory elements of the LTF gene have been identified through genome alignment and epigenetic analysis. For example, patent CN117586383 discloses a mammary gland-specific expression vector based on the bovine LTF gene promoter, but its driving efficiency is still far lower than the expression level of human endogenous LTF. The limitations of the existing technology are mainly reflected in: (1) the identified regulatory elements (such as promoters or conserved enhancers) are functionally conserved in different species, but cannot explain the specific high expression of human LTF; (2) there is a lack of systematic discovery and functional verification of human-specific regulatory elements; (3) existing expression vectors rely on species-conserved elements, making it difficult to achieve efficient expression of human-level LTF. Therefore, developing a high-efficiency LTF expression system based on human-specific regulatory elements is of great significance for the optimization of mammary gland bioreactors and the development of functional dairy products. Summary of the Invention

[0003] For the reasons stated above, this invention proposes an enhancer regulatory element for the transcriptional regulation of human LTF gene expression and its applications. Specifically, to achieve the objectives of this invention, the following technical solution is proposed:

[0004] This invention relates, in one aspect, to an enhancer regulatory element for the transcriptional regulation of human LTF gene expression, the sequence of which is SEQ ID No. 1, specifically as follows:

[0005] .

[0006] Another aspect of the present invention relates to a vector containing an enhancer regulatory element for the transcriptional regulation of the above-mentioned human LTF gene.

[0007] In a preferred embodiment of the present invention, the vector comprises pGL4.17[1uc2 / Neo] and pcDNA3.1.

[0008] Another aspect of the present invention relates to the application of enhancer regulatory elements or the aforementioned vectors for the transcriptional regulation of human LTF gene expression in enhancing LTF gene expression.

[0009] In a preferred embodiment of the present invention, the enhancement of LTF gene expression refers to enhancing the expression of the LTF gene in dairy cows.

[0010] The beneficial effects of this invention are:

[0011] 1. First identification and verification of a regulatory element unique to the human LTF gene: Through multi-omics analysis (ATAC-seq, ChIP-seq, etc.), a key regulatory sequence that is extremely highly expressed in human milk LTF was discovered. This element is absent or absent in mammals such as cattle and mice.

[0012] 2. Cross-species function was verified: Experiments showed that this human-specific regulatory element can significantly activate reporter gene expression (by 14.93 times) in the bovine mammary epithelial cell line (MACT), overcoming the limitations of existing technologies that rely on species-conserved elements.

[0013] 3. Precise Control Applications: The expression system designed based on this element can achieve high-efficiency LTF expression at the human level, providing a new tool for the development of mammary bioreactors and functional dairy products. Attached Figure Description

[0014] Figure 1 The binding sites of transcription factor ELF5 in human milk that affect the regulator element chr3:46,488,833-46,488,933, which is an enhancer of extreme overexpression of the LTF gene.

[0015] Figure 2 Schematic diagram of the construction of vectors for enhancing regulatory elements affecting the human LTF gene. Using mouse epigenetic data (ATAC-seq and chip-seq) as a reference, conserved regulatory elements in humans and mice were screened to identify the core transcription factor ELF5. Figure 2 First, the specific location of ELF5 was shown. Next, a plasmid vector containing the transcription factor ELF5 and the regulatory element was constructed. The transcription factor ELF5 and the regulatory element were then transfected together into bovine mammary epithelial cells to detect the transfection efficiency.

[0016] Figure 3 Results of dual-luciferase reporter gene assays using human-specific enhancer regulatory elements transferred into HEK-293T and bovine mammary epithelial cells (MACT). Detailed Implementation

[0017] To further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0018] Unless otherwise specified, all reagents involved in the embodiments of this invention are commercially available products and can be purchased through commercial channels.

[0019] (I) Identification of regulatory elements for extreme overexpression of the human LTF gene

[0020] 1. Identification of enhancer regulatory elements in the human LTF gene

[0021] Potential enhancer regulatory elements within ±100 kb of the LTF gene were identified using human milk ATAC-seq data. By integrating mouse epigenomic data (including ATAC-seq and ChIP-seq data for H3K27ac, H3K4me1, H3K4me3, STAT5, GR, MED1, and PolII), we identified this enhancer (chr3: 46488833-46489420), which exhibits positional conservation in mice. However, sequence alignment revealed only partial motif conservation (88.89% similarity), and the binding site of the core transcription factor ELF5 was absent in mice, cows, and goats.

[0022] (II) Identification of LTF gene expression enhancer regulatory elements

[0023] 1. Sequence of enhancer regulatory elements in the human LTF gene

[0024] chr3: 46488833-46489420

[0025] agattgctcggtagagggcggtggagggacgttgcaggaggaaggggcgctcctGCCATTTCCAGTGAGGGCCACGGGAGGGCGGTCCGGGTGTGAGGACTGCGGTCTGCTGCACCTGCAGCCTGGGTTGTGGCGATGACCTTTTCT GCAGCCCTCTCAACACAGACCTCGGAGTCTCGAGCAGCCCTGTGTGCTCTGCAGGCCTGCTGTCCGTGCTGGCGCCCAGACTTCCTCTCCAAGCTCCCGCCTGCCCTGTGGCCCCGAAGGTTCCATGCTGAGCTGCAGCACTTCCTG CAAGCCTCCAGTGGCTCAGGCGCTCAAAAGGCCTCCTGTCCCCACTGTATGCCCATGTCACTGGTTCCCGATCCCCTGCTCCTTTGTCGGCTTAcagacagtggcctgttgcctgcccaacaaattcctggccagcgccagcctgac caaaccggtgagagtcctctgctagcaggtgtgctgactgcacctccaagaagtctgaacccttccaagcttgtccttcccagggtgcactccctcagcacgaggatacaatgcagtttcttcattaactcctctcctgtcctagGA

[0026] 2. Construction of a fluorescent reporter carrier for regulatory elements

[0027] (1) Using the human whole genome sequence published by the database website NCBI as the standard sequence, the sequence chr3:46488833-46489420 was synthesized, ligated into the vector pGL4.17, and the enhancer sequence was inserted after the universal strong promoter CMV with KpnI / XhoI as the restriction site to evaluate the enhancer activity (Shanghai Sangon Biotech Co., Ltd.).

[0028] (2) The binding sites of transcription factor ELF5 in human milk that affect the regulator element chr3:46,488,833-46,488,933, which is an enhancer of extremely high expression of the LTF gene, are as follows: Figure 1 As shown, its core sequence is tgcaggaggaagggg, but this sequence is missing in mice and partially missing in cows, goats and sheep.

[0029] (3) Fluorescent reporter vectors influencing the regulatory elements of the human LTF gene enhancer were named control, human-enhancer, and ELF5+enhancer, respectively. These vectors were constructed with a pGL4.17 backbone containing a luciferase gene (1uc2), one of the most commonly used reporter genes in enhancer experiments. The enhancer sequence was inserted after the universal strong promoter CMV using KpnI / XhoI as the restriction site to assess enhancer activity. Transcription factor ELF5 was expressed using pcDNA3.1 as the backbone vector, with the stop codon removed, fused with the vector flag, and with BamHI / ApaI restriction sites to form an overexpression plasmid vector. This overexpression plasmid, along with the regulatory elements, was co-transfected into HEK-293T and MAC-T cells to detect the activity of the transcription factor and regulatory elements.

[0030] (4) Function of dual fluorescence detection modulation element

[0031] HEK-293T cells (Shanghai Sixin Biotechnology Co., Ltd.) and bovine mammary epithelial cell MAC-T cells (Shanghai Sixin Biotechnology Co., Ltd.) were passaged into 24-well plates at a density of 5 × 10⁵ cells per well and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco). When cell confluence reached 70%-80%, cells were transferred to liposomes (Lipofectamine). TM Transfection was performed using 3000 Transfection Reagent (Thermo Fisher Scientific). Prior to transfection, the medium was starved with Opti-DMEM for 1 hour, and then replaced with complete medium containing 5% serum. The plasmid dosages were: 0.4 μg pGL4.17 plasmid per well, 0.1 μg pRL-TK (Promega luciferase reporter vector) plasmid per well, and 0.4 μg ELF5-pcDNA3.1 plasmid per well. Groups were assigned as follows: control group (pGL4.17 empty vector and pRL-TK plasmid transfection); experimental group 1 (human-enhancer plasmid transfection with human-enhancer and pRL-TK); and experimental group 2 (ELF5+enhancer plasmid transfection with ELF5+enhancer, pRL-TK, and ELF5-pcDNA3.1). Incubate at room temperature for 10 min, then incubate at 37℃ for 8 h, change the medium, and lyse and collect the samples after 48 h. Use the TransDetect Double-Luciferase Reporter Assay Kit (Beijing TransGen Biotech Co., Ltd.) to identify luciferase activity.

[0032] Figure 3The results showed that the enhancer regulatory element (chr3: 46488833-46489420) influencing the extreme overexpression of the human LTF gene was identified. A dual-luciferase reporter gene assay was performed on this enhancer regulatory element and its core transcription factor, ELF5. To verify the cross-species function of this enhancer, the human-specific enhancer regulatory element was transfected into HEK-293T and bovine mammary epithelial cells (MACT) for dual-luciferase reporter gene assays. The results showed that in HEK-293T cells, enhancer activity was significantly increased by 2.91-fold compared to the control group, while co-transfection with ELF5 further increased activity by 1.37-fold. In MCT cells, the increase in enhancer activity was even more significant (14.93-fold), and co-transfection with ELF5 increased activity by 1.65-fold.

[0033] Experimental results show that:

[0034] Breakthrough improvement in expression efficiency: Existing technologies (such as bovine LTF promoter vectors) only achieve 1%-5% of the expression level in mammary cells compared to the endogenous level in humans, while the regulatory element driving efficiency of this invention can reach more than 90% of the natural human level (verified by dual-luciferase assay, p < 0.01).

[0035] Species-specific issues: Traditional methods relying on conserved regulatory sequences cannot explain the high expression of human LTF; this invention reveals for the first time the functional advantages of human-specific elements, filling a technological gap.

[0036] Reduced application costs: Compared to enhancing endogenous LTF expression in animals through gene editing (which requires a complex breeding process), this invention can achieve efficient expression through simple vector construction, saving more than 50% of the R&D cycle and production costs.

[0037] High functional scalability: This element can be used in combination with other breast-specific promoters (such as the β-lactoglobulin promoter) to further optimize the expression system.

[0038] Significant industrialization potential: The 14.93-fold activation effect verified in bovine mammary epithelial cells indicates that it can achieve human-grade LTF production in transgenic animals, providing a stable source of raw materials for high-value-added dairy products (such as antibacterial infant formula).

[0039] This invention provides the first solution for the efficient production of LTF based on human-specific control elements, combining scientific innovation with industrialization value.

[0040] The preferred embodiments of the present invention have been described above, but are not intended to limit the invention. Those skilled in the art can make modifications and variations to the embodiments disclosed herein without departing from the scope and spirit of the invention.

Claims

1. The application of an enhancer regulatory element for the transcriptional regulation of human LTF gene in enhancing the expression of luciferase gene luc2, wherein the sequence of the enhancer regulatory element for the transcriptional regulation of human LTF gene is SEQ ID No. 1, and enhancing the expression of luciferase gene luc2 refers to enhancing the expression of luciferase gene luc2 in bovine mammary epithelial cell line MCT.