Anticancer agent, pharmaceutical composition for cancer treatment, kit, and activator
By using a human parainfluenza virus type 2 vector to express cytokines and chemokines, combined with immune activators and inhibitors, the problem of suppressing tumor-infiltrating lymphocytes in solid cancer was solved, achieving more effective anti-tumor treatment.
Patent Information
- Application Number
- CN202480015575.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-01
- Filing Date
- 2024-02-29
- Publication Date
- 2025-11-07
AI Technical Summary
Existing immune checkpoint inhibitors and CAR-T therapy have not been effective in treating solid tumors, mainly because the microenvironment of solid tumors leads to the inhibition of tumor-infiltrating lymphocytes and the obstruction of immune cell activation, making it difficult to effectively improve anti-tumor effects.
Human parainfluenza virus type 2 (hPIV2) was used as a vector to express cytokines such as IL-2, IL-7, IL-12, IL-15, and IL-18, or combinations thereof with CCL19 and CCL21. Combined with immune activators and immune checkpoint inhibitors, the drugs were administered locally to enhance the infiltration and activation of immune cells within tumors.
It significantly improved the anti-tumor effect of solid tumors, enhanced the infiltration and activation of immune cells within tumors, and improved the therapeutic effect on solid tumors.
Smart Images

Figure CN120916775A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to an anticancer agent, a pharmaceutical composition for cancer treatment, a kit, and an activator. BACKGROUND
[0002] Cancer cells occur due to various abnormalities such as immunosuppression mechanisms, cell proliferation inhibition mechanisms, variations in genes, translocations, metabolism, and the like. In terms of cancer treatment, blood cancers such as leukemia have increased effectiveness by immune checkpoint inhibitors such as anti-PD1 antibodies and CAR-T therapy. (For example, refer to Patent Literature 1.) PRIOR ART DOCUMENTS PATENT LITERATURE
[0003] Patent Literature 1: Japanese Patent Application Laid-Open No. 2019-523301 Patent Literature 2: Japanese Patent No. 5801202 Patent Literature 3: Japanese Patent No. 5807917 Patent Literature 4: Japanese Patent No. 7398680 Patent Literature 5: Japanese Patent No. 6358706 NON-PATENT LITERATURE
[0004] Non-Patent Literature 1: Hum Gene Ther., (2013) 24(7):683 Non-Patent Literature 2: Scientific Reports (2023) 13:11361 Non-Patent Literature 3: Scientific Reports (2019) 9:13999 SUMMARY PROBLEMS TO BE SOLVED BY THE INVENTION
[0005] However, it is not easy to improve the effectiveness of solid cancer by only the immune checkpoint inhibitor that suppresses negative immunity, CAR-T therapy. In solid cancer, due to incomplete vascularization, stress conditions such as hypoxia, glucose starvation, and the like, specific microenvironments (tumor microenvironment (TME)) of solid cancer, fibroblasts, macrophages, inflammatory cells, and the like, which aggravate cancer cells, drug resistance, and the like, are formed. It has been reported that under such conditions, the infiltration of tumor infiltrating lymphocytes such as CAR-T cells into cancer tissues is suppressed, and the tumor regression effect is reduced. In addition, it has also been reported that in humans, due to the formation of a stroma of cells and the like between solid cancer and its marginal cells, the infiltration of immune cells into tumor tissues is hindered, and T cell therapy that has an effect in mice is easily suppressed from infiltrating in humans, and the anti-tumor effect is reduced.
[0006] The present application was completed in view of the above-described circumstances, and aims to provide an anticancer agent, a pharmaceutical composition for cancer treatment, a kit, and an activator, which are excellent in antitumor effect. Means for solving the problem
[0007] The present application includes the following modes. [1] An anticancer agent against solid cancer, which contains human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-18, or a combination of the cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, as an effective ingredient. [2] The anticancer agent against solid cancer according to [1], wherein the at least one cytokine is IL-12 constituting a heterodimer or a mutant thereof having the same function. [3] The anticancer agent against solid cancer according to [1], wherein the human parainfluenza virus type 2 is a non-propagative type in which a F gene is deleted from a genome. [4] A pharmaceutical composition for cancer treatment against solid cancer, which contains the anticancer agent according to any one of [1] to [3]. [5] The pharmaceutical composition for cancer treatment against solid cancer according to [4], which further contains an immune activator and / or an immune checkpoint inhibitor. [6] The pharmaceutical composition for cancer treatment against solid cancer according to [4], wherein the immune checkpoint inhibitor comprises at least one selected from the group consisting of an anti-PD1 antibody, an anti-PD-L1 antibody, an anti-CTLA4 antibody, and an anti-TIM3 antibody. [7] The pharmaceutical composition for cancer treatment against solid cancer according to [4], which is for intratumoral administration. [8] A kit for treating solid cancer, wherein the kit comprises, for simultaneous or sequential use in the treatment, human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-18, or a combination of the cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, and an immune activator and / or an immune checkpoint inhibitor. [9] The kit according to [8], wherein the at least one cytokine is IL-12 constituting a heterodimer or a mutant thereof having the same function.
[10] The kit according to [8], wherein the human parainfluenza virus type 2 is a non-propagative type in which a F gene is deleted from a genome.
[11] The kit according to [8], wherein the immune checkpoint inhibitor comprises at least one selected from the group consisting of an anti-PDl antibody, an anti-PD-Ll antibody, an anti-CTLA4 antibody, and an anti-TIM3 antibody.
[12] The kit according to any one of [8] to
[11] , wherein the kit is for intratumoral administration.
[13] A tumor infiltrating T cell and dendritic cell activator comprising a human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-18, or a combination of the cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, as an effective ingredient. Effects of the Invention
[0008] According to the present application, it is possible to provide an anticancer agent, a pharmaceutical composition for cancer treatment, a kit, and an activator, which are excellent in antitumor effect. BRIEF DESCRIPTION OF DRAWINGS
[0009] Figure 1 is an explanatory diagram of a plasmid for producing BC-PIV / IL-7 alone, or CCL19 or CCL21. Specifically, it is a construction diagram for introducing a desired gene into the Notl or Mlul restriction enzyme sequence of a plasmid for constructing hPIV2 from which the F gene is deleted. Figures 2-4 is a diagram confirming the expression of IL-7, CCL19, and CCL21 in the infected cells of BC-PIV into which IL-7 alone, or CCL19 or CCL21 was introduced, by Western blotting. Figure 2 is a diagram confirming the expression in the infected cells of BC-PIV into which IL-7 was introduced. Figure 3 is a diagram confirming the expression in the infected cells of BC-PIV into which IL-7 and CCL19 were introduced. Figure 4 is a diagram confirming the expression in the infected cells of BC-PIV into which IL-7 and CCL21 were introduced. Figure 5 is an explanatory diagram of a plasmid for producing BC-PIV into which the IL-12 gene as a heterodimer was introduced. EIS is a sequence regulating the expression of the BC-PIV gene. Figures 6-7 is a diagram confirming the expression of IL-12 (P35) and IL-12 (P40) in the infected cells of BC-PIV into which the IL-12 gene as a heterodimer was introduced, by Western blotting. Figure 6Figure 1 is a graph confirming the expression of P35 and P40 expressed via the EIS sequence list of BC-PIV in BC-PIV infected cells. Figure 7 Figure 2 is a graph confirming the expression of P35 and P40 caused by BC-PIV into which the P40 and P35 genes were introduced at the Notl and Mlul restriction enzyme sequence sites and constructed in BC-PIV infected cells. Figure 8 Figure 3 is a graph confirming the IL-12 protein (P70) based on ELISA. Figure 9 Figure 4 is a graph showing the schedule for an animal test for confirming the anti-tumor effect based on BC-PIV. Figure 10 Figure 5 is a graph showing the anti-tumor effect achieved by IL-7 and CCL19 expressed by BC-PIV and the synergistic effect with an anti-mouse PD1 antibody. Figure 11 Figure 6 is a graph showing the anti-tumor effect achieved by IL-7 and CCL19 expressed by BC-PIV and the synergistic effect with an anti-mouse PD1 antibody. Figure 12 Figure 7 is a graph showing the anti-tumor effect achieved by IL-7 and CCL19 or CCL21 expressed by BC-PIV and the synergistic effect with an anti-mouse PD1 antibody. Figure 13 Figure 8 is a graph showing the anti-tumor effect achieved by IL-7 and CCL19 or CCL21 expressed by BC-PIV and the synergistic effect with an anti-mouse PD1 antibody. Figure 14 Figure 9 is a graph of pathological analysis of treated tumors. Figure 15 Figure 10 is a graph of pathological analysis of treated tumors. Figure 16 Figure 11 is a graph showing the distribution of T cells in the inside and periphery of tumors evaluated using T cell specific antibodies. Figure 17 Figure 12 is a graph showing the distribution of CD8 positive T cells in the inside and periphery of tumors evaluated using CD8 specific antibodies. Figure 18 Figure 13 is a graph showing the anti-tumor effect of BC-PIV into which a cytokine (IL-7) and a chemokine (CCL19) were introduced and the synergistic effect with an anti-mouse PD1 antibody on renal cancer RENCA cells. Figure 19 Figure 14 is a graph showing the anti-tumor effect achieved by BC-PIV into which IL-12 was introduced and the synergistic effect with an anti-mouse PD1 antibody. Figure 20is a graph showing the synergistic effect of the anti-tumor effect achieved by BC-PIV into which IL-12 was introduced and the anti-mouse PD1 antibody. DETAILED DESCRIPTION
[0010] Promotion of T cell uptake into tumor tissue [Chemokines and chemokine receptors] Chemokine receptor 7 (CCR7) is a major homing receptor that collects T cells, B cells, and dendritic cells to form a functional microenvironment in secondary lymphatic vessels, and is an important regulator for eliciting antigen-specific immune responses. Two endogenous ligands exist in CCR7. One is CCL21, which is constantly expressed in the high endothelial venules (HEV) of secondary lymphoid tissues. It is reported that lymphatic vessels of inflammatory skin tissues also induce expression. The other CCL19 is produced in the T cell area of lymph nodes and is presented by transcytosis from the basal membrane side to the luminal side of HEV. It has been reported that these chemokine ligands 21 (CCL21) and chemokine ligand 19 (CCL19) have apparently opposite two roles in cancer (see Patent Literature 2). One is that CCR7 plays an important role in promoting metastasis of cancer via the lymphatic system, and the correlation of upregulation of CCR7 with lymph node (LN) metastasis has been reported in pancreatic cancer, breast cancer, esophageal cancer, head and neck cancer, prostate cancer, colorectal cancer, and the like. On the other hand, the relationship of this CCR7 with CCL19 / 21 is also involved in the regulation of immune responses to growing tumors, and dendritic cells (DCs), CD4-positive helper T cells, regulatory T cells, B cells, and memory T cells express CCR7 and are transported by interaction with CCL19 and CCL21, and CCR7 plays an important role in activation of antigen presentation and T cell-mediated responses, and it is considered that intratumoral introduction of CCL19 and CCL21 contributes to cancer immunotherapy by enhancing immune responses to tumors. CCR7 is a G protein-coupled receptor, and such receptors are generally prone to desensitization, in which the receptor does not couple with further G protein activation after the first exposure to a ligand. It is known that CCL21 shows equal activity to CCL19 in activation of G protein signaling via CCR7, but does not cause receptor desensitization.
[0011] [Chemokines and chemokine receptors] Regarding IL-7, IL-7 secreted from thymic epithelial cells contributes to the proliferation of immature T cells, the development of T cells, and IL-7 secreted from lymphatic endothelial cells contributes to the survival, maintenance of the number, and the like of naive and memory T cells.
[0012] [Chemokines and chemokine receptors] In the above-described introduction of cytokines alone, it is considered that proliferation of CTL cells having an antitumor effect is promoted, but there is still a possibility that infiltration of CTL cells into a solid tumor is inhibited by a marginal cell stroma of the solid tumor. In order to improve infiltration of tumor-specific CTL cells into the inside of a solid tumor, a countermeasure is required in which cells in a marginal region of a tumor tissue actively take in CTL cells. Therefore, it is considered that ectopic expression of CCL19 or CCL21 in cells contacted by CTL cells not only in a solid tumor but also in the cells can improve the case in which CTL cells expressing CCR7 are actively taken in a tumor tissue, which can improve antitumor immunity.
[0013] [Vector expressing both cytokine and chemokine (BC-PIV)] The inventors have developed a vector capable of carrying genes and proteins simultaneously using human parainfluenza virus 2: BC-PIV (see Patent Literature 3). BC-PIV is capable of introducing two or more genes and proteins, and an antitumor immunotherapeutic agent having a ligand protein of TNFRSF mounted on BC-PIV has been shown to be effective to date (see Patent Literature 4). Here, it was confirmed that two genes introduced into BC-PIV were expressed in infected cells, and this time, genes of a cytokine and a chemokine were introduced into BC-PIV, and the above-described effects were investigated. It was reported that BC-PIV is human parainfluenza virus 2, and the host is human, and human parainfluenza virus 2 is poor permissive in mice, and although high expression of introduced genes cannot be expected, if effectiveness can be confirmed in mice, it is considered that extrapolation to humans is high. Further, it was shown that BC-PIV promotes maturation of dendritic cells (see Non Patent Literature 1), and by directly administering BC-PIV into a tumor, tumor cells killed or damaged are taken in by antigen-presenting cells such as dendritic cells and present antigens to T cells, and proliferation and activation of T cells and the like having a more effective antitumor effect can be achieved.
[0014] [Introduction of cytokine: IL-12 into BC-PIV] IL-12 is a heterodimer composed of 35 kDa and 40 kDa. IL-12 is a cytokine produced by dendritic cells, macrophages, and the like, and has useful activities such as maintenance of activated T cells, expression of killer T cells (CTLs), and the like, and on the other hand, is one of the most potent inflammatory cytokines. Therefore, there is a great concern about whether it can be used to cause inflammation in a tumor tissue and improve the efficiency of immunotherapy. On the other hand, it is known that IL-12 is extremely toxic due to systemic immune activation, and even if it is a maximum tolerated dose (MTD), the clinical effect is extremely limited. Many solid cancers have an immune-resistant microenvironment, and the infiltration, activation, and effector function of immune cells are inhibited, so they are in a state called Cold Tumor that does not respond to immunotherapy with immune checkpoint inhibitors (ICIs) including anti-PD1 antibodies and anti-CTLA4 antibodies. Therefore, it was considered that the introduction of IL-12, which is a heterodimer composed of 35 kDa and 40 kDa, into BC-PIV, allowing local expression of IL-12 in the tumor, could induce inflammation in the tumor tissue and improve the effectiveness of immunotherapy. Furthermore, since BC-PIV can introduce two genes, the introduction of two subunit genes of IL-12 was also studied.
[0015] Expression of cytokines and chemokines in tumor tissues In solid cancers, stress states such as hypoxia, glucose starvation, and the like due to incomplete vascularization form a specific microenvironment (tumor microenvironment (TME)) of cancer cells, drug resistance, and the like of fibroblasts, macrophages, inflammatory cells, and the like. Furthermore, by the formation of a stromal cell matrix at the edge of a solid tumor, the infiltration of anti-tumor immune cells such as CTL cells into the solid tumor is inhibited. Therefore, it is considered that the infiltration of anti-tumor immune cells such as T cells into the solid tumor tissue is required. Lymphocytes such as T cells control their movement in the body and homing to specific tissues through specific chemokines and chemokine receptors, and participate in the formation and homeostasis of the immune system in the body. In addition, the expression of different chemokines in the disease state induces various pathologies due to the migration of lymphocytes and the like.
[0016] Lymphocytes such as T cells express the chemokine receptor CCR7. CCL19 and CCL21 are two chemokines that are shared ligands for CCR7. Through these relationships, antigen-primed dendritic cells from peripheral blood T cells and B cells, and input lymphatic vessels, are induced to home to secondary lymphoid tissues. Therefore, it is considered that by allowing these chemokines to be expressed not only in the interior of the tumor but also in the cell heterogeneity at the boundary of the solid tumor tissue, lymphocytes expressing CCR7, particularly tumor-specific T cells and CTLs, can be migrated to the tumor tissue, and the infiltration of the tumor tissue is actively improved. Interleukin 7 (IL-7) is a cytokine necessary for the differentiation of initial lymphocytes, the maintenance of mature T cells, and the formation of lymphoid organs, and is considered to be a cytokine that maintains the homeostasis of the immune system.
[0017] <Anti-cancer agent> In one embodiment, the present application provides an anticancer agent against solid cancer, which contains human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18, or a combination of said cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, as an effective ingredient.
[0018] The virus used in the present embodiment is human parainfluenza virus type 2 (hPIV2). From the viewpoint of not producing 2 infectious particles, the human parainfluenza virus type 2 is preferably a non-propagative type lacking the F gene having a membrane fusion function.
[0019] In addition, the virus used in the present embodiment expresses at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18, or a combination of said cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function. As the combination of ligands expressed by the virus, one can cite each of IL-2, IL-7, IL-12, IL-15 and IL-18; two cytokines selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18; a combination of three or more cytokines selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18. Specifically, one can cite a combination of IL-2 with CCL19 or CCL21, a combination of IL-7 with CCL19 or CCL21, a combination of IL-12 with CCL19 or CCL21, a combination of IL-15 with CCL19 or CCL21, a combination of IL-18 with CCL19 or CCL21. As described later in the examples, it was confirmed that BC-PIV into which a human IL-12 gene was introduced had an antitumor effect. IL-12 is a heterodimer composed of 35 kDa and 40 kDa. As described later in the examples, when BC-PIV is introduced, it is preferable to connect the p35 gene and the p40 gene with the EIS sequence (ctctcataatttaagaaaaaatcataggcccggacgggttag (SEQ ID NO: 4)) of hPIV2. In addition, as the combination of ligands expressed by the virus, one can cite a combination of the above-mentioned cytokine with CCL19 and / or CCL21. As the combination, one can cite IL-7 / CCL19, IL-7 / CCL21, IL-12 / CCL19, IL-12 / CCL21, etc. As described in the examples, it was confirmed that BC-PIV into which a human IL-7 gene / human CCL-19 gene was introduced and BC-PIV into which a human IL-7 gene / human CCL-21 gene was introduced had an antitumor effect.
[0020] A mutant thereof having the same function means a mutant having a signal transducing ability, which is composed of an amino acid sequence in which one or more amino acids are deleted, substituted, inserted, or added in an amino acid sequence constituting the ligand. As the number of the amino acids to be deleted, substituted, inserted, or added, 1 to 20, more preferably 1 to 10, and particularly preferably 1 to 5 are preferable. In addition, as the cytokine and / or chemokine used in the present embodiment, homologues thereof are also included.
[0021] <Pharmaceutical composition for cancer treatment against solid cancer> In one embodiment, the present application contains the above-mentioned anticancer agent. The pharmaceutical composition for cancer treatment against solid cancer of the present embodiment can further contain an immune activator and / or an immune checkpoint inhibitor. As the immune activator, agonistic antibody of TNFRSF receptor can be exemplified, and anti-Ox40 agonistic antibody, anti-GITR agonistic antibody, anti-CD30 agonistic antibody, anti-4-1BB agonistic antibody, anti-CD27 agonistic antibody, and the like can be exemplified. As the immune checkpoint inhibitor, anti-PD1 antagonist antibody, anti-PD-L1 antagonist antibody, anti-CTLA4 antagonist antibody, anti-TIM3 antagonist antibody, and the like can be exemplified.
[0022] The pharmaceutical composition for cancer treatment against solid cancer of the present embodiment preferably contains a pharmaceutically acceptable carrier. As the pharmaceutically acceptable carrier, a carrier used in general formulations can be used without particular limitation, and solvents such as sterilized water, physiological saline, and the like; binding agents such as gelatin, corn starch, tragacanth gum, acacia gum, and the like; excipients such as crystalline cellulose; bulking agents such as alginic acid, and the like can be exemplified.
[0023] The pharmaceutical composition for cancer treatment against solid cancer of the present embodiment can contain an additive. As the additive, lubricants such as magnesium stearate; sweeteners such as sucrose, lactose, saccharin, and the like; flavoring agents such as peppermint, aromatic white pearl essential oil, and the like; stabilizers such as benzyl alcohol, phenol, and the like; buffering agents such as phosphate, sodium acetate, and the like; dissolution aids such as benzyl benzoate, benzyl alcohol, and the like; antioxidants; preservatives; surfactants; emulsifiers, and the like can be exemplified.
[0024] The pharmaceutical composition for cancer treatment against solid cancer of the present embodiment can be formulated by mixing the above-mentioned pharmaceutically acceptable carrier and additive in a unit dose form which is generally confirmed.
[0025] The pharmaceutical composition for cancer treatment of the present embodiment against solid cancer can be formulated into a dosage form for oral use or a dosage form for non-oral use, and is preferably formulated into a dosage form for non-oral use. As the dosage form for oral use, for example, tablets, capsules, elixirs, microcapsules, and the like can be given. As the dosage form for non-oral use, for example, injections, ointments, patches, and the like can be given, and injections are preferred.
[0026] As the solvent for injections, for example, isotonic solutions containing a physiologically acceptable agent such as physiological saline, glucose, D-sorbitol, D-mannose, D-mannitol, sodium chloride, and the like can be given. The solvent for injections can contain alcohol such as ethanol; polyhydric alcohol such as propylene glycol, polyethylene glycol; nonionic surfactants such as polysorbate 80 (trademark), HCO-50, and the like.
[0027] The administration to a patient can be, for example, in addition to intra-arterial injection, intravenous injection, subcutaneous injection, and the like, intranasal, transbronchial, intramuscular, transdermal, or oral methods, and is preferably intratumoral administration.
[0028] The amount of administration of the pharmaceutical composition for cancer treatment of the present embodiment per 1 time is, in the case of non-oral administration, different depending on the administration subject, the subject organ, the symptoms, the administration method, and the like, and for example, in the form of injections, in general, in adults (body weight is assumed to be 60 kg), 1 x 10 6 BC-PIV particles to 1 x 10 11 BC-PIV particles, for example, 1 x 10 7 BC-PIV particles to 1 x 10 11 BC-PIV particles. In addition, the above amount can be administered once a day or divided into several times a day.
[0029] As the application target of the pharmaceutical composition for cancer treatment of the present embodiment against solid cancer, there is no limitation as long as it is a solid cancer, and examples of the solid cancer include breast cancer (e.g., invasive breast cancer, non-invasive breast cancer, inflammatory breast cancer, etc.), prostate cancer (e.g., hormone-dependent prostate cancer, hormone-independent prostate cancer, etc.), pancreatic cancer (e.g., pancreatic ductal carcinoma, etc.), gastric cancer (e.g., papillary adenocarcinoma, mucinous adenocarcinoma, adenotubular carcinoma, etc.), lung cancer (e.g., non-small cell lung cancer, small cell lung cancer, malignant mesothelioma, etc.), colon cancer (e.g., gastrointestinal stromal tumor, etc.), rectal cancer (e.g., gastrointestinal stromal tumor, etc.), large intestinal cancer (e.g., familial large intestinal cancer, hereditary non-polypoid large intestinal cancer, gastrointestinal stromal tumor, etc.), small intestinal cancer (e.g., non-Hodgkin's lymphoma, gastrointestinal stromal tumor, etc.), esophageal cancer, duodenal cancer, tongue cancer, pharyngeal cancer (e.g., upper pharyngeal cancer, middle pharyngeal cancer, lower pharyngeal cancer, etc.), head and neck cancer, salivary gland cancer, brain tumor (e.g., pineal astrocytoma, pilocytic astrocytoma, diffuse astrocytoma, anaplastic astrocytoma, etc.), schwannoma, liver cancer (e.g., primary liver cancer, extrahepatic bile duct cancer, etc.), renal cancer (e.g., renal cell carcinoma, metaplastic carcinoma of the renal pelvis and ureter, etc.), gallbladder cancer, bile duct cancer, endometrial cancer, cervical cancer, uterine sarcoma, ovarian cancer (e.g., epithelial ovarian cancer, gonadal embryonic cell tumor, ovarian embryonic cell tumor, ovarian low-grade tumor, etc.), bladder cancer, urethral cancer, skin cancer (e.g., Merkel cell carcinoma, etc.), angioma, melanoma (malignant melanoma), thyroid cancer (e.g., medullary thyroid carcinoma, etc.), parathyroid cancer, nasal cavity cancer, sinus cancer, bone tumor (e.g., osteosarcoma, Ewing's sarcoma, soft tissue sarcoma, etc.), metastatic medulloblastoma, angiofibroma, desmoid fibrosarcoma, retinal sarcoma, penile cancer, testicular tumor, pediatric solid cancer (e.g., Wilms' tumor, pediatric renal tumor, etc.), Kaposi's sarcoma, Kaposi's sarcoma caused by AIDS, maxillary sinus tumor, fibrosing histiocytoma, leiomyoma, rhabdomyoma, chronic myeloproliferative disease, and the like.
[0030] <Kit> In one embodiment, the present application provides a kit for treating cancer, comprising: a human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-18, or a combination of the cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, for simultaneous or sequential use in the treatment; and an immune activator and / or an immune checkpoint inhibitor. Further, the preferred mode of the kit of the present embodiment is the same as that of the <Pharmaceutical composition for cancer treatment>. The order in the case of sequential administration is not particularly limited.
[0031] <Tumor-infiltrating T cell and dendritic cell activator> In one embodiment, the present application provides a tumor-infiltrating T cell and dendritic cell activator containing human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-18, or a combination of the cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, as an effective ingredient. As described in the examples, in the BC-PIV administration group with IL-7 / CCL19 or IL-7 / CCL21, infiltration of T cells inside the tumor and infiltration of lymphocytes around the tumor were observed, and an antitumor effect was exerted by the infiltration.
[0032] <Therapeutic method> In one embodiment, the present application provides a therapeutic method for cancer, which includes administering the above-described anticancer agent or pharmaceutical composition for cancer treatment to a patient in need of treatment.
[0033] In addition, in one embodiment, the present application provides a therapeutic method for cancer, which includes administering human parainfluenza virus type 2 expressing an effective amount of a desired cytokine, or a combination of a desired cytokine with a chemokine, and an effective amount of an immune activator and / or an immune checkpoint inhibitor, simultaneously or sequentially, to a patient in need of treatment. Furthermore, the preferred mode of the therapeutic method of the present embodiment is the same as that of the <Pharmaceutical composition for cancer treatment>. The order in the case of sequential administration is not particularly limited.
[0034] [Other embodiments] In one embodiment, the present application provides an anticancer agent, a pharmaceutical composition for cancer treatment, or a kit for use in the treatment of cancer. As the anticancer agent, the pharmaceutical composition for cancer treatment, or the kit, the same content as described above can be used. [Examples]
[0035] Next, examples are shown to explain the present application in more detail, but the present application is not limited to the following examples. In the expression of IL-7, IL-12, CCL19, and CCL21, etc. in the following examples, it is assumed to be derived from humans.
[0036] [Experimental Example 1] Construction of BC-PIV retaining IL-7 gene, CCL19 gene, and CCL21 gene The combination of plasmids for constructing BC-PIV into which IL-7 gene, CCL19 gene, and CCL21 gene were introduced alone or 2 genes (refer to Figure 1 ) is as follows.
[0037] BC-PIV (Reference Example 1) was introduced with the IL-7 gene alone, the CCL19 gene alone, the 2 genes of IL-7 / CCL19, the 2 genes of IL-7 / CCL21 in combination. These gene sequences are derived from human sequences. Figure 1 The IL-7 gene sequence used at this time is GenBank: BC047698.1 (SEQ ID NO: 1). The CCL19 gene sequence is GenBank: BC027968.1 (SEQ ID NO: 2). The CCL21 gene sequence is GenBank: BC027918.1 (SEQ ID NO: 3). The genes were completely synthesized based on these genes with the addition of a tag for embedding in BC-PIV. Recovery of BC-PIV from the plasmid was performed by reverse genetics using the method of the present inventors et al. (see Patent Literature 4, Patent Literature 5).
[0038] [Experimental Example 2] Introduction of IL-7, CCL19, and CCL21 genes into BC-PIV and confirmation of desired genes in infected cells It was investigated whether the BC-PIV that could be recovered in Example 1 expressed the target proteins. BC-PIV was recovered from the Notl restriction enzyme sequence site and / or the Mlul restriction enzyme sequence site of the plasmid for producing the virus of Example 1, each of which had all the genes. Then, the recovered BC-PIV was allowed to infect F membrane protein expression Vero cells of hPIV2 and cultured for 7 days, and the recovered cells were subjected to Western blotting using commercially available anti-human IL-7 antibody (GenTex, Cat#: TTX131448), anti-human CCL19 antibody (R&D systems, Cat#: AF361), and anti-human CCL21 antibody (company name Abeam, Cat#: ab 9851). As shown in FIG. 2, expression of each protein was confirmed in BC-PIV into which the IL-7 gene was added to the Notl restriction enzyme sequence site or BC-PIV into which the CCL19 gene was added to the Mlul restriction enzyme sequence site. Figure 2 As shown in FIG. 2, expression of each protein was confirmed in BC-PIV into which the IL-7 gene was added to the Notl restriction enzyme sequence site or BC-PIV into which the CCL19 gene was added to the Mlul restriction enzyme sequence site. As shown in FIG. 3, expression of both proteins was also confirmed in BC-PIV into which the 2 genes of CCL19 and IL-7 were introduced. Figure 3 As shown in FIG. 3, expression of both proteins was also confirmed in BC-PIV into which the 2 genes of CCL19 and IL-7 were introduced. As shown in FIG. 4, even when the IL-7 gene and the CCL21 gene were introduced at the same time, expression of each protein was confirmed in the BC-PIV into which each gene was introduced. Figure 4 As shown in FIG. 4, even when the IL-7 gene and the CCL21 gene were introduced at the same time, expression of each protein was confirmed in the BC-PIV into which each gene was introduced.
[0039] [Experimental Example 3] Construction of BC-PIV with IL-12 gene BC-PIV into which an IL-12 gene was introduced (Reference Example 1) Figure 5 ). The IL-12 cytokine is a heterodimer (P35 and P40). The p35 gene and / or the p40 gene was introduced into the NotI restriction enzyme sequence site and the MluI restriction enzyme sequence site of BC-PIV, and BC-PIV was recovered. In addition, in addition to the cytokine of which two genes consisting of a heterodimer such as IL-12 cytokine are grouped as one, in order to combine a chemokine or the like, the p35 gene and the p40 gene were ligated with the EIS sequence of hPIV2 (ctctcataatttaagaaaaaatcataggcccggacgggttag (SEQ ID NO: 4)), and BC-PIV into which the p35 gene and the p40 gene were inserted into the NotI restriction enzyme sequence site was recovered. The p35 gene sequence of IL-12 used at this time was GenBank: NM_000882.4 (SEQ ID NO: 5), and the p40 gene sequence was GenBank: NM_002187.3 (SEQ ID NO: 6).
[0040] [Experimental Example 4] Introduction of IL-12 gene into BC-PIV and confirmation of desired gene in infected cells It was investigated whether the BC-PIV recovered in Example 3 expressed the target protein. In the MluI restriction enzyme sequence site of BC-PIV into which the p35 and p40 genes introduced in the NotI restriction enzyme sequence site and / or the MluI restriction enzyme sequence of the plasmid used for the production of the virus in Example 3 were introduced, the p35 gene and the p40 gene were introduced via the EIS sequence of hPIV2, and the virus was recovered (Reference Example 2). Figure 4 ) The recovered BC-PIV was allowed to infect F membrane protein expression Vero cells of hPIV2, cultured for 7 days, and the recovered cells were subjected to a Western blot using a commercially available anti-human P35 antibody (Abeam, Cat#: ab131039), an anti-human P40 antibody (company name Abeam, cat#: ab133752). As shown in Figure 6 , it was confirmed that P40 and P35 proteins were expressed via the EIS of hPIV2. In addition, in Example 3, it was confirmed that P40 and P35 proteins were expressed in the infected cells of BC-PIV into which the p40 gene and the p35 gene were introduced into the NotI and MluI restriction enzyme sequence sites as shown in Figure 7 Figure 5 . According to the above results, it was confirmed that BC-PIV can express P40 and P35 proteins simultaneously in one cell using one vector.
[0041] [Experimental Example 5] Confirmation of expression of IL-12 based on ELISA The supernatant of the infected cells expressing IL-12 using BC-PIV (infected for 4 days) was subjected to ELISA. The ELISA assay kit was used by Bio Legend, Cat#: 431704. The assay was performed according to the assay method of the kit. The concentration was determined by the ELISA using P70 specific antibody. According to the dilution ratio and the standard curve shown in the figure, the expression of IL-12 protein of about 1.0 ng / mL was confirmed in the supernatant. Figure 8
[0042] [Experimental Example 6] Synergistic effect of BC-PIV introducing cytokine (IL-7) and chemokine (CCL19) and anti-mouse PD1 antibody (first time) Using BC-PIV introducing the obtained IL-7 gene and CCL19 gene, CT26 mouse colon cancer cells were transplanted into BALB / c mice, and the anti-tumor effect was investigated. It is known that BC-PIV is poorly permissive for infection and proliferation in the tissues and cells of mice, and if the anti-tumor effect is confirmed in this test, the extrapolation to humans can be greatly expected. After the ventral side of the mouse was depilated, 5 x 10 5 CT26 mouse colon cancer cells were transplanted subcutaneously into the ventral side of the mouse at 2 places, and 7 days later, the effect of BC-PIV not introducing foreign genes (Emp), IL-7 / CCL19 introducing BC-PIV was investigated in the unilateral tumor in which the tumor diameter proliferated to about 5-7 mm. The synergistic effect of this immune checkpoint inhibitor and anti-mouse PD1 antibody was also investigated. It is reported that the effect of anti-mouse PD1 antibody on mouse B16F10 melanoma cells is low, and BALB / c mice transplanted with CT26 mouse colon cancer cells were used for evaluation. About 1 x 10 7 TCID 50 BC-PIV was administered intraperitoneally at 7 and 9 days after transplantation, and 200 pg of anti-mouse PD1 antibody was administered intraperitoneally at 11 and 13 days after transplantation. Then, the tumor diameter was measured every 3 or 4 days, and the tumor volume was calculated as (long diameter x short diameter 2 ) ÷ 2. The experimental time is shown in Figure 9 . The groups of the mice consisted of the following 6 groups.
[0043] (1): Non-treatment group (non-treat) (2): BC-PIV group (Emp) (3): Anti-mouse PD1 antibody group (aPPD1) (4): BC-PIV + anti-mouse PD1 antibody group (Emp + aPD1) (5) : BC-PIV / IL-7 / CCL19 group (IL-7 / CCL19) (6) : BC-PIV / IL-7 / CCL19 + anti-mouse PDl antibody group (IL-7 / CCL19 + aPDl)
[0044] [Experimental Example 7] Anti-tumor effect by BC-PIV into which cytokine (IL-7) and chemokine (CCL19) were introduced and synergistic effect with anti-mouse PDl antibody (first time) The results are shown in Figure 10 , Figure 11 . Tumor volume (refer to Figure 10 ) in the non-treatment group, BC-PIV group (Emp), anti-mouse PDl antibody group (aPDl), and BC-PIV + anti-mouse PDl antibody group (Emp + aPDl) did not confirm significant anti-tumor effect (reduction in tumor volume). In addition, in this administration, anti-tumor effect of anti-mouse PDl antibody alone was hardly confirmed. On the other hand, in the BC-PIV / IL-7 / CCL19 group (IL-7 / CCL19) and the BC-PIV / IL-7 / CCL19 + anti-mouse PDl antibody group (IL-7 / CCL19 + aPDl), anti-tumor effect was confirmed (refer to Figure 10 ). In the non-administration side, in the BC-PIV / IL-7 / CCL19 + anti-mouse PDl antibody group (IL-7 / CCL19 + aPDl), anti-tumor effect was shown, and abscopal effect was confirmed (refer to Figure 11 ). In summary, in the administration side, in the transplanted tumors of the mice in groups (5) and (6), anti-tumor effect was confirmed. In the non-administration side, in the mice in group (6), high tumor regression effect was also confirmed, and higher abscopal effect was confirmed by synergistic effect with anti-mouse PDl antibody.
[0045] [Experimental Example 8] Anti-tumor effect by BC-PIV into which cytokine (IL-7) and chemokine (CCL19 or CCL21) were introduced and synergistic effect with anti-mouse PDl antibody (second time) The test was performed in the same manner as in Example 6. The group of mice consisted of the following 6 groups.
[0046] (1) : Non-treatment group (non-treat) (2) : BC-PIV group (Emp) (3) : BC-PIV / IL-7 / CCL19 group (IL-7 / CCL19) (4): BC-PIV / IL-7 / CCL21 group (IL-7 / CCL21) (5): BC-PIV / IL-7 / CCL21 + anti-mouse PD1 antibody group (IL-7 / CCL21 + aPD1)
[0047] The results are shown in Figure 12 , Figure 13 . As with the results of Example 8, no significant anti-tumor effect (reduction in tumor volume) was confirmed in the non-treated group, the BC-PIV group (Emp) on the administration side (refer to Figure 12 ). On the other hand, an anti-tumor effect was confirmed in the BC-PIV / IL-7 / CCL19 group (IL-7 / CCL19), the BC-PIV / IL-7 / CCL21 group (IL-7 / CCL21), and the BC-PIV / IL-7 / CCL19 + anti-mouse PD1 antibody group (IL-7 / CCL19 + aPD1) (refer to Figure 12 ). On the non-administration side, a high anti-tumor effect was shown in the BC-PIV / IL-7 / CCL21 + anti-mouse PD1 antibody group (IL-7 / CCL21 + aPD1), and an abscopal effect was confirmed (refer to Figure 13 ). Comparing CCL19 and CCL21, there was a tendency for the anti-tumor effect of CCL21 to be high. Although CCL21 shows equivalent activity to CCL19 in the activation of G protein signaling via CCR7, it is reported that it does not cause receptor desensitization, and the anti-tumor effect is likely to be higher.
[0048] [Experimental Example 9] Anti-tumor effect by BC-PIV into which a cytokine (IL-7) and a chemokine (CCL19 or CCL21) were introduced and T cell / B cell activation in the tumor 8 days after the primary administration based on anti-mouse PD1 antibody treatment The treated mice 11 days after BC-PIV administration were perfusion-fixed with 4% paraformaldehyde, and the tumor on the administration side was excised (refer to Figure 14 ) for anti-mouse T cell antibody (company name CST, cat#: 78588) and anti-mouse B cell antibody (company name CST, Cat#: 98941). The groups of mice consisted of the following 5 groups.
[0049] (1): BC-PIV group (Emp) (2): BC-PIV / IL-7 / CCL19 + anti-mouse PD1 antibody group (IL-7 / CCL19 + aPD1) (3): non-treated group (non-treat) (4): BC-PIV / IL-7 / CCL19 group (IL-7 / CCL19) (5): BC-PIV / IL-7 / CCL21 group (IL-7 / CCL21)
[0050] According to the size of the tumor mass, the tumor size of the mice administered with IL-7 / CCL19, IL-7 / CCL21, and IL-7 / CCL19 + anti-mouse PD1 antibody was smaller, and it was presumed to have an anti-tumor effect from the tumor diameter and appearance. Based on the HE-stained images (refer to Figure 15 ), the characteristics of these treated tumors were mostly that the necrotic foci of tumor cells inside the tumor were large, and the tumor cells remaining around the necrosis also began to degenerate. In particular, the characteristic point was that a large number of lymphocytes were confirmed to be aggregated around the blood vessels outside the tumor at the boundary portion of the tumor. This characteristic was confirmed in the BC-PIV / IL-7 / CCL19 administered tumor in which a significant increase in lymphocytes was confirmed around the blood vessels at the tumor boundary portion (refer to Figure 15 ). On the other hand, in the BC-PIV administered and untreated tumors, compared to the IL-7 / CCL19, IL-7 / CCL21, and IL-7 / CCL19 + anti-mouse PD1 antibody administered groups, the infiltration of T cells into the inside of the tumor was less, but T cell-positive cells were confirmed inside the tumor. However, no aggregation of lymphocytes to the peritumoral region was found (refer to Figure 15 ). It is considered that this is because of the expression of CCL19 or CCL21 chemokines due to the infection of BC-PIV to the cells inside and around the tumor, and the aggregation of lymphocytes expressing CCR7 receptors around the tumor.
[0051] Figure 16 The situation of T cells inside and around the tumor is shown. Positive reactions to anti-mouse B cell antibodies were not found in any of the tumors, and it is considered that B cells did not aggregate in large numbers by this treatment. On the other hand, in the IL-7 / CCL19, IL-7 / CCL21, and IL-7 / CCL19 + anti-mouse PD1 antibody administered tumors, a large number of T cell-positive cells were confirmed in the tumor and around the tumor. The tumors of the mice administered with IL-7 / CCL19, IL-7 / CCL21, and IL-7 / CCL19 + anti-mouse PD1 antibody were smaller, but infiltration of T cell-positive cells was also confirmed inside the BC-PIV alone administered tumor (refer to Figure 16). However, infiltration of lymphocytes was not found in the periphery of the tumor. So far, it has been confirmed that the effect of BC-PIV alone to mature dendritic cells is high (cf. Non-Patent Literature 1), but this time, it was confirmed that BC-PIV alone can activate T cells, but it was confirmed that it does not have the ability to make these lymphocytes gather around the administration site. Figure 17 The case of CD8-positive T cells inside and around the tumor is shown. It is considered that in the inside and periphery of the tumor of CD4-positive T cells, positive reaction of the anti-mouse B cell antibody was hardly found in any tumor, and by this treatment, CD4-positive T cells did not gather in large numbers. On the other hand, in the IL-7 / CCL19, IL-7 / CCL21, and IL-7 / CCL19 + anti-mouse PD1 antibody administered tumors, a large number of T cell positive cells were confirmed in the tumor and the periphery of the tumor. The tumor of the IL-7 / CCL19, IL-7 / CCL21, and IL-7 / CCL19 + anti-mouse PD1 antibody administered mice was smaller, but infiltration of CD8-positive T cells was also confirmed inside the BC-PIV alone administered tumor (cf. Figure 17 ). However, when BC-PIV was administered alone, infiltration of lymphocytes around the tumor was not found. In this experiment, in mice, since BC-PIV is poor permissive, it is assumed that the expression of the introduced IL-7, IL-12, CCL19, and CCL21 genes is relatively low, but even so, a high anti-tumor effect was confirmed, and it is expected that the expression will be higher in humans who are permissive, and it is considered that the anti-tumor effect will be higher.
[0052] [Experimental Example 10] Study of the anti-tumor effect of BC-PIV into which cytokine (IL-7) and chemokine (CCL19) were introduced and the synergistic effect with anti-mouse PD1 antibody on renal cancer RENCA cells Various systemic treatments using tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) such as anti-PD1 antibody are performed on patients with advanced renal cell carcinoma (aRCC), and the ICI alone or in combination with other agents is studied. This time, the inventors studied the effect of BC-PIV into which IL-7 / CCL19 was introduced and anti-mouse PD1 antibody on mouse renal cancer-derived cells, i.e., RENCA cells. Mouse RENCA renal cancer cells (8 x 10 4(Number of cells) were transplanted into the backs of BALB / c mice. When the tumor diameter reached 3-5 mm, the effects of BC-PIV (Emp) without the foreign gene and BC-PIV with IL-7 / CCL19 were investigated in the proliferating unilateral tumors. The synergistic effect of this immune checkpoint inhibitor and the anti-mouse PD1 antibody was also studied. In in vitro experiments, it was reported that treatment with the anti-mouse PD1 antibody alone did not inhibit the proliferation of RENCA cells (see Non-Patent Literature 2). The mice were divided into the following 4 groups.
[0053] (1): Non-treat group (2): BC-PIV group (Emp) (3): BC-PIV / IL-7 / CCL19 group (IL-7 / CCL19) (4): BC-PIV / IL-7 / CCL19 + anti-mouse PD1 antibody group (IL-7 / CCL19+αPD1)
[0054] The results of the drug administration side are shown in Figure 18 It was found that, on the administered side, BC-PIV / IL-7 / CCL19 and the BC-PIV / IL-7 / CCL19 + anti-mouse PD1 antibody group were effective. In RENCA cells, the anti-mouse PD1 antibody alone did not show any cell proliferation inhibition effect (see Non-Patent Literature 2), but an anti-tumor effect was confirmed when used in combination with BC-PIV / IL-7 / CCL19. Furthermore, an anti-tumor effect was confirmed even when BC-PIV / IL-7 / CCL19 was administered alone. Although not illustrated, on the non-administered side, all tumors grew at the same size, and no anti-tumor effect was confirmed.
[0055] [Experimental Example 11] The anti-tumor effects of BC-PIV infused with cytokine (IL-12) and its synergistic effect with anti-mouse PD1 antibody. IL-12 is known to be highly toxic due to systemic immune activation, and even at the maximum tolerated dose (MTD), its clinical efficacy is extremely limited. Introducing BC-PIV, through local administration into the tumor, reduces toxicity and achieves an antitumor effect. The IL-12 introduced in this study is human, and compatibility with mice has been almost entirely confirmed. However, non-patent literature 3 reports the antitumor effects of human IL-12 in mice. This study investigates the antitumor effects of the human IL-12 introduced with BC-PIV in mice. The experiment was conducted using the same method as described above. On the administration side (refer to) Figure 19 ) and non-drugated side (refer to)Figure 20 ) confirmed the anti-tumor effect of human IL-12 alone. The anti-tumor effect was further improved when administered together with an anti-mouse PD1 antibody (see Figure 19 、 Figure 20 ). Industrial applicability
[0056] According to the present application, it is possible to provide an anticancer agent, a pharmaceutical composition for cancer treatment, a kit, and an activator, which are excellent in anti-tumor effect.
Claims
1. An anticancer agent against solid cancer, comprising human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18, or a combination of said cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, as an effective ingredient.
2. The anti-cancer agent against solid cancer according to claim 1, wherein, The at least one cytokine is IL-12 constituting a heterodimer or a mutant thereof having the same function.
3. The anti-cancer agent against solid cancer according to claim 1, wherein, The human parainfluenza virus type 2 is a non-propagative type from which the F gene is deleted from the genome.
4. A pharmaceutical composition for cancer treatment against solid cancer, comprising the anticancer agent against solid cancer according to any one of claims 1 to 3.
5. The pharmaceutical composition for use in cancer treatment of solid cancer according to claim 4, wherein, The pharmaceutical composition for cancer treatment further comprises an immune-activating agent and / or an immune checkpoint inhibitor.
6. The pharmaceutical composition for cancer treatment of solid cancer according to claim 4, wherein, The immune checkpoint inhibitor comprises at least one selected from the group consisting of an anti-PD1 antibody, an anti-PD-L1 antibody, an anti-CTLA4 antibody and an anti-TIM3 antibody.
7. The pharmaceutical composition for cancer treatment of solid cancer according to claim 4, wherein, The pharmaceutical composition for cancer treatment is for intratumoral administration.
8. A kit for treating solid cancer, wherein, The kit comprises human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18, or a combination of said cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, and an immune-activating agent and / or an immune checkpoint inhibitor, for simultaneous use or sequential use in the treatment.
9. The kit of claim 8, wherein, The at least one cytokine is IL-12 constituting a heterodimer or a mutant thereof having the same function.
10. The kit of claim 8, wherein, The human parainfluenza virus type 2 is a non-propagative type from which the F gene is deleted from the genome.
11. The kit of claim 8, wherein, The immune checkpoint inhibitor comprises at least one selected from the group consisting of an anti-PD1 antibody, an anti-PD-L1 antibody, an anti-CTLA4 antibody and an anti-TIM3 antibody.
12. The kit of any one of claims 8 to 11, wherein, The kit is for intratumoral administration.
13. A tumor-infiltrating T cell and dendritic cell activator, comprising human parainfluenza virus type 2 expressing at least one cytokine selected from the group consisting of IL-2, IL-7, IL-12, IL-15 and IL-18, or a combination of said cytokine with CCL19 and / or CCL21, or a mutant thereof having the same function, as an effective ingredient.
Citation Information
Patent Citations
controller
JP1983001202A
Sampling circuit
JP1983007917A
Electric film
JP1988058706A
Combination therapy of chimeric antigen receptor and PD-1 inhibitor
JP2019523301A