Escherichia coli for efficiently soluble expression of recombinant human type Ⅲ collagen and construction and application thereof

By synergistically expressing the signal peptide PelB and the molecular chaperone Rsp_RS13455, the challenges of efficient and soluble expression and purification of recombinant human type III collagen were solved, achieving efficient and safe collagen preparation, simplifying the purification process and improving protein stability.

CN120988962BActive Publication Date: 2026-06-19SHANDONG SAIYA BIOTECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANDONG SAIYA BIOTECHNOLOGY CO LTD
Filing Date
2025-09-04
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing technologies are difficult to express and purify recombinant human type III collagen efficiently and safely, and there are problems such as the risk of infection from animal-derived diseases, immune rejection, allergic reactions, production capacity limitations, and high purification costs.

Method used

Recombinant human type III collagen was co-expressed using the signal peptide PelB and molecular chaperones such as the heat shock protein Rsp_RS13455. By regulating expression with the signal peptide and assisting folding with the molecular chaperone, efficient and soluble expression of collagen was achieved, and the purification process was simplified.

Benefits of technology

It significantly improved the soluble expression level of recombinant human type III collagen, reduced the misfolding rate, simplified the purification steps, and enhanced the stability and safety of the protein.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This application relates to the field of genetic engineering technology, specifically to an *E. coli* strain that efficiently expresses recombinant human type III collagen in a soluble manner, its construction, and its application. This invention constructs an *E. coli* strain that efficiently expresses recombinant human type III collagen in a soluble manner. This *E. coli* strain can co-express a signal peptide-regulated recombinant human type III collagen and a molecular chaperone. Experimental verification shows that the engineered bacteria provided in this application have the ability to efficiently express recombinant human type III collagen in a soluble manner. The recombinant human type III collagen provided in this application exhibits good stability and anti-inflammatory effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, specifically to an Escherichia coli strain that efficiently expresses recombinant human type III collagen, its construction, and its application. Background Technology

[0002] Collagen is the most abundant protein family in the human body, accounting for 30% of total protein. It is an important component of skin, muscles, bones, and connective tissue. Common collagen types include type I, type II, type III, type V, and type XI. Type III collagen is a fibrillary collagen with a unique (Gly-XY) structure. n The structure can regulate the inflammatory response of macrophages through integrin receptors (such as α1β1). Currently, commonly used methods for preparing type III collagen include animal-derived extraction or recombinant expression.

[0003] Patent CN116179634A discloses a type III collagen peptide and its preparation method. The method involves defatting, sonicating, and fermenting animal skin, scales, or bones to obtain a crude extract of total protein. The crude collagen extract is then extracted under acidic conditions. A clarifying agent is added to remove impurities, and the extract is fermented with Bacillus coagulans to obtain type III collagen. The extract is then hydrolyzed with a complex protease and fermented in a manner mimicking Staphylococcus aureus. The resulting type III collagen peptide is then separated and purified. Animal-derived extraction methods are mainly used for industrial-scale preparation through acid and enzymatic methods, which are relatively cheaper. However, these methods have drawbacks such as infection by animal-derived diseases, immune rejection or allergic reactions, and production capacity limitations.

[0004] Patent CN119101145A discloses a method for expressing recombinant type III collagen in Escherichia coli using fusion tag technology. When establishing the recombinant expression system, taking the expression system in E. coli as an example, due to the unique (Gly-XY) of recombinant human type III collagen... nTopological structure of repetitive sequences and post-translational modification requirements: Prokaryotic systems lack eukaryotic-specific prolyl-4-hydroxylase-catalyzed key hydroxylation modifications and are limited by the absence of molecular chaperone systems, resulting in delayed folding dynamics of newly formed collagen peptide chains. This leads to 70-90% of recombinant proteins forming inactive inclusion bodies through hydrophobic interactions. Currently, this problem is addressed by introducing charge-balancing modules (such as SUMO and TrxA) through fusion tag technology to directionally regulate the hydrophilicity of the collagen surface. At the same time, the steric hindrance effect is used to shield abnormal interaction sites of folding intermediates, thereby overcoming the solubility bottleneck and improving the yield of soluble active proteins. However, fusion tag technology has problems such as tag structure interference with target protein function, additional cleavage increasing costs, and the risk of foreign sequence protein residues. In addition, E. coli contains a large amount of host proteins and endotoxins, and after fragmentation, multiple purification steps such as ion exchange chromatography and hydrophobic chromatography are required to remove impurities, increasing the preparation cost. The tag structure may also interfere with the functionality of the target protein. The stability of fused collagen is also lower than that of natural proteins.

[0005] Therefore, there is an urgent need to construct an efficient, safe, and soluble system for expressing type III collagen, as well as a method for efficiently preparing type III collagen using this system. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide an Escherichia coli strain that can efficiently express recombinant human type III collagen, and its construction and application.

[0007] To solve the above problems, the technical solution adopted by the present invention is as follows:

[0008] Technical Topic 1

[0009] A highly efficient soluble Escherichia coli strain for expressing recombinant human type III collagen is characterized by the co-expression of recombinant human type III collagen and a molecular chaperone regulated by a signal peptide.

[0010] As a further improvement of the present invention, the amino acid sequence of the recombinant human type III collagen is shown in SEQ ID NO.3 or SEQ ID NO.27.

[0011] As a further improvement of the present invention, the signal peptide is PelB.

[0012] As a further improvement of the present invention, the molecular chaperone is one of the heat shock protein Rsp_RS13455, the chaperone protein GroEL, or the chaperone protein GroES.

[0013] As a further improvement of the present invention, the gene encoding the recombinant human type III collagen expressed under the regulation of the signal peptide and the gene encoding the molecular chaperone are expressed using any one of the plasmids pACYCDuet-1, pCOLADuet-1, or pCDFDuet-1 as expression vectors; or, the two genes are co-transformed into pET series plasmids or pRSF series plasmids with different copy numbers.

[0014] As a further improvement of the present invention, the signal peptide is PelB, the amino acid sequence of which is shown in SEQ ID NO.7, the molecular chaperone is heat shock protein Rsp_RS13455, the amino acid sequence of which is shown in SEQ ID NO.11, the gene encoding the recombinant human type III collagen regulated by the signal peptide and the gene encoding the molecular chaperone are expressed in pACYCDuet-1 as an expression vector, and the Escherichia coli is BL21 (DE3).

[0015] Technical Theme Two

[0016] A method for constructing an Escherichia coli strain that efficiently expresses recombinant human type III collagen, as described in Technical Subject 1, is characterized by comprising the following steps:

[0017] S1. The gene encoding the signal peptide is fused with the gene encoding recombinant human type III collagen and ligated into an expression vector to obtain a recombinant plasmid.

[0018] S2. The gene encoding the molecular chaperone is linked to the recombinant plasmid obtained in S1 to obtain an expression vector for the gene encoding the recombinant human type III collagen regulated by the signal peptide and the gene encoding the molecular chaperone.

[0019] S3. Transfer the expression vector obtained in S2 into... E. coli The strain was constructed in BL21 (DE3).

[0020] As a further improvement to the present invention, the following steps are included:

[0021] S1. The PelB coding gene was fused with the recombinant human type III collagen coding gene and ligated into the pACYCDuet-1 plasmid to obtain the recombinant plasmid.

[0022] S2. The gene encoding the heat shock protein Rsp_RS13455 was ligated into the recombinant plasmid obtained in S1 to obtain expression vectors for the gene encoding the recombinant human type III collagen regulated by the signal peptide and the gene encoding the molecular chaperone.

[0023] S3. Transfer the expression vector obtained in S2 into... E. coli The strain was constructed in BL21 (DE3).

[0024] Technical Theme 3

[0025] A method for efficient soluble expression of recombinant human type III collagen, the key of which is to activate and culture *E. coli* prepared in Technical Topic 1 to prepare seed culture, inoculate the seed culture into a culture medium to obtain a culture solution, place the culture solution in an oven for heat shock, add isopropyl-β-D-thiogalactoside (IPTG) for induction culture to obtain fermentation broth, centrifuge, collect the fermentation supernatant, purify, and obtain recombinant human type III collagen.

[0026] As a further improvement to the present invention, the following steps are included:

[0027] Single colonies were obtained by streaking Escherichia coli, which is highly efficient at expressing recombinant human type III collagen as described in Technical Topic 1, on LB solid medium.

[0028] Seed culture was prepared by inoculating single colonies into LB liquid medium containing chloramphenicol and activating them overnight at 37 ℃ and 180-200 rpm for 10-12 h.

[0029] The seed culture was inoculated into LB liquid medium containing chloramphenicol and cultured at 37°C and 180-200 rpm until OD reached. 600 = 0.6 - 0.8 to obtain the culture medium. The culture medium was placed in an oven at 42 ℃ for 10-12 min for heat shock. Then, IPTG with a final concentration of 0.4-0.5 mM was added. The culture was fermented at 25 ℃ and 150-160 rpm for 16-20 h. After centrifugation, the fermentation supernatant was separated and purified to obtain recombinant human type III collagen.

[0030] The volume ratio of the seed culture to the culture medium is 0.5-2:50.

[0031] As a further improvement of the present invention, the method includes the following steps.

[0032] Single colonies were obtained by streaking Escherichia coli, which is described in Technical Topic 1, for its efficient soluble expression of recombinant human type III collagen, on LB solid medium.

[0033] Seed culture was prepared by inoculating single colonies into LB liquid medium containing chloramphenicol and activating the culture overnight at 37 °C and 200 rpm.

[0034] The seed culture was inoculated into LB liquid medium containing chloramphenicol and cultured at 37 °C and 200 rpm until OD reached. 600 = 0.6 - 0.8 to obtain the culture medium. The culture medium was placed in an oven at 42 ℃ for 10 min for heat shock. Then, IPTG with a final concentration of 0.4 mM was added, and fermentation was carried out at 25 ℃ and 160 rpm for 18 h. After centrifugation, the fermentation supernatant was separated and purified to obtain recombinant human type III collagen.

[0035] The volume ratio of the seed culture to the culture medium is 1:50.

[0036] Technical Theme 4

[0037] A recombinant human type III collagen prepared by the method described in Technical Subject 3.

[0038] The beneficial effects of adopting the above technical solution are as follows:

[0039] This application utilizes overexpression of the heat shock protein RSP_RS13455 to specifically bind to the hydrophobic motif of unfolded collagen, inhibiting premature aggregation of intermediate peptides. It also synergistically guides the transmembrane transport of nascent peptide chains to the periplasmic lumen via the periplasmic targeting signal peptide pelB, completing post-folding transport to the extracellular space. This coupling strategy significantly reduces the misfolding rate of recombinant human type III collagen through a cascade regulation of "cytoplasmic fold protection - periplasmic oxidative folding," thereby increasing the soluble expression level. Simultaneously, secretory expression avoids intracellular host protein and endotoxin contamination, simplifying the purification process.

[0040] This application constructs an Escherichia coli system for the efficient soluble expression of recombinant human type III collagen. The Escherichia coli co-expresses recombinant human type III collagen regulated by a signal peptide and a molecular chaperone. Experiments have verified that the engineered bacteria provided in this application have the ability to efficiently express recombinant human type III collagen in a soluble manner. The recombinant human type III collagen provided in this application has good stability and anti-inflammatory effects. Attached Figure Description

[0041] Figure 1 This is a schematic diagram of the recombinant plasmid pACYC-PelB-rhCOL3H of this application;

[0042] Figure 2 This is a schematic diagram of the recombinant plasmid pACYC-PelB-rhCOL3H-RS of this application;

[0043] Figure 3These are SDS-PAGE results of fermentation supernatants and cell lysis supernatants of different strains in this application. Lane M: marker; 1: PB3HS cell lysis supernatant; 2: PB3H cell lysis supernatant; 3: PB3 cell lysis supernatant; 4: PB3HS fermentation broth supernatant; 5: PB3H fermentation broth supernatant; 6: PB3 fermentation broth supernatant.

[0044] Figure 4 This is a graph showing the SDS-PAGE results of the rhCOL3H protein purified by ion exchange column in this application. Lane M: marker; 1, 2: purified protein (repeat experiment); 3: elution waste liquid from ion exchange column purification.

[0045] Figure 5 These are SDS-PAGE results of fermentation supernatants from different engineered bacteria in this application, where M: Marker; 1: S3RS; 2: S3P; 3: S3;

[0046] Figure 6 This is an SDS-PAGE result of the rhCOL3H stability assay in this application; where lane M: marker; lane 1: rhCOL3H protein after 7 days of storage in the dark;

[0047] Figure 7 This is a verification of the anti-inflammatory efficacy of rhCOL3H in this application, where A is the result of the endoinflammatory cytokine IL-1β and B is the result of the endoinflammatory cytokine IL-6. Detailed Implementation

[0048] To make the objectives, technical solutions, and advantages of the present invention clearer, the invention will be described clearly and completely below in conjunction with specific embodiments.

[0049] The ClonExpress II One Step Cloning Kit used in this application was purchased from Nanjing Novizan Biotechnology Co., Ltd., item number: C112-01 / 02.

[0050] The Pierce™ Dilution-Free™ Rapid Gold BCA Protein Assay kit was purchased from Thermo Fisher Scientific (China) Co., Ltd., catalog number: A55860.

[0051] The ABTS ELISA Buffer Kit, PeproTech®, was purchased from Thermo Fisher Scientific (China) Co., Ltd., catalog number: 900-K00.

[0052] In this application, the annealing temperature refers to the temperature in the intermediate step of each cycle in the PCR amplification program. For example, the amplification program is: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 52 ℃ for 20 s, 72 ℃ for 30 s); 72 ℃ for 5 min; 4 ℃ ∞. Here, 52 ℃ is the annealing temperature.

[0053] Example 1: Gene Design and Synthesis

[0054] (1) Collagen gene design and synthesis:

[0055] i. Based on the sequence characteristics of the anti-inflammatory function of human type III collagen, a recombinant human type III collagen (rhCOL3) sequence was designed, the amino acid sequence of which is shown in SEQ ID NO.1:

[0056] SEQ ID NO.1:

[0057] MGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIA

[0058] The nucleic acid sequence of the amino acid sequence was reverse-engineered, and codon optimization was performed for expression in the host *E. coli*. After the above optimization, the corresponding nucleic acid fragment encoding recombinant human type III collagen was obtained, and its nucleic acid sequence is shown in SEQ ID NO.2:

[0059] SEQ ID NO.2:

[0060] ATGGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCG CCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCG CTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCC GGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCT

[0061] Based on the nucleic acid sequence, the nucleic acid fragment encoding rhCOL3, SEQ ID NO.2, was synthesized by General Biotechnology (Anhui) Co., Ltd.

[0062] Based on SEQ ID NO.1, a 6×His tag was added to the C-terminus for easier separation and purification, denoted as rhCOL3H, and its corresponding amino acid sequence is SEQ ID NO.3.

[0063] SEQ ID NO.3:

[0064] MGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAGKDGPRGLTGPIGPPGPAGAPGTPGPQGIAHHHHHH

[0065] Using the nucleic acid fragment encoding rhCOL3 (SEQ ID NO.2) as a template, the rhCOL3 gene sequence was amplified by PCR using primers rhCOL3-F and rhCOL3-R. The amplification system was as follows: 2 μL of the rhCOL3 nucleic acid fragment (SEQ ID NO.2) template; 2 μL each of primers rhCOL3-F and rhCOL3-R; 25 μL of 2X Phanta Max Master Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. The amplification program was: 95℃ for 3 min; 30 cycles × (95℃ for 20 s, 55℃ for 20 s, 72℃ for 1 min); 72℃ for 5 min; 4℃ to infinity. The PCR product was purified by gel extraction to obtain rhCOL3H, and the rhCOL3H gene fragment is shown in SEQ ID NO.4.

[0066] SEQ ID NO.4:

[0067] ATGGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGC CCGGCTGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGAC GGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCC CCGGGCACCCCGGGCCCCCAGGGGATCGCTGGCAAGGACGGCCCGAGGGGCCTGACGGGCCCCATCGGCCCGCCGGGCCCGGCTGGTGCCCCCGGGCACCCCGGGCCCCCAGGGGATCGCTCATCATCATCATCATCATTAA

[0068] Primers:

[0069] rhCOL3-F:

[0070] ATGGGCAAGGACGGCCCGAG (SEQ ID NO.5)

[0071] rhCOL3-R:

[0072] TTAATGATGATGATGATGATGAGCGATCCCCTGGGGG (SEQ ID NO.6)

[0073] (2) Synthesis of signal peptide genes:

[0074] The signal peptide used is PelB, whose amino acid sequence is as follows:

[0075] MKYLLPTAAAGLLLLAAQPAMAGGGGS (SEQ ID NO.7)

[0076] Its nucleic acid sequence (SEQ ID NO.8) was obtained by amplifying the PelB gene fragment using PCR technology with primers PelB-F and PelB-R and plasmid pET22b as template DNA. The amplification system consisted of: 2 μL of plasmid pET22b template; 2 μL each of primers PelB-F and PelB-R; 25 μL of 2X Phanta Max Master Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. The amplification program was: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 52 ℃ for 20 s, 72 ℃ for 30 s); 72 ℃ for 5 min; 4 ℃ infinity.

[0077] SEQ ID NO.8:

[0078] ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCGGTGGTGGTGGTTCT

[0079] Primers:

[0080] PelB-F:

[0081] ATGAAATACCTGCTGCCGACC (SEQ ID NO.9)

[0082] PelB-R:

[0083] AGAACCACCACCACCGGCCATCGCCGGCTGGG (SEQ ID NO.10)

[0084] (3) Synthesis of the molecular chaperone Rsp_RS13455 gene

[0085] The amino acid sequence of molecular chaperone Rsp_RS13455 is as follows:

[0086] MRSYDFSPLYRATVGFDRIADLMDRVMTSEVAQPTYPPYNIEKTAENAYRISIAVAGFTPDELAVEVKENTLHVGARKAADEAERTYLHRGIATRAFERRFALADHVRVSGATHEHGMLHIDLVRETPEALKPRRIEIARGDLGGTRSIEAVKEPVEA (SEQ ID NO.11)

[0087] Its nucleic acid sequence (SEQ ID NO.12) was obtained by retrieving the Rsp_RS13455 gene sequence from the NCBI database, and then amplifying the Rsp_RS13455 gene sequence using PCR technology with RS13455-F and RS13455-R as primers and the Rhodotorula glutinis S1 genome as a template.

[0088] Amplification system: 1 μL of Rhodopseudomonas aeruginosa S1 genome template; 2 μL each of primers RS13455-F and RS13455-R; 25 μL of 2X Phanta Max Master Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. Amplification program: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 56 ℃ for 20 s, 72 ℃ for 1 min); 72 ℃ for 5 min; 4 ℃ infinity.

[0089] SEQ ID NO.12:

[0090] ATGCGTAGCTATGATTTCTCGCCGCTCTACCGCGCCACCGTCGGCTTCGACCGGATTGCCGACCTGATGGACCGCGTGATGACCAGCGAGGTCGCCCAGCCCACCTATCCGCCCTACAACATCGAGAAGACCGCCGAGAATGCCTATCGCATCTCGATCGCGGTGGCGGGCTTCACGCCCGACGAGCTGGCGGTCGAGGTCAAGGAGAACACGCTCCATGTCGGCGCCCGGAAGGCCG CGGACGAAGCCGAGCGGACCTATCTCCACCGCGGCATTGCCACCCGGGCCTTCGAGCGCCGCTTCGCGCTGGCCGATCATGTCCGCGTCTCCGGTGCCACGCACGAGCACGGGATGCTGCACATCGATCTGGTGCGCGAGACGCCCGAAGCGCTGAAGCCGCGCCGCATCGAGATCGCCCGCGGCGACCTCGGTGGGACCAGGTCCATCGAGGCGGTGAAGGAGCCGGTCGAGGCCTGA

[0091] Primer RS13455-F:

[0092] ATGCGTAGCTATGATTTCTCGCC (SEQ ID NO.13)

[0093] RS13455-R:

[0094] TCAGGCCTCGACCGGCTCC (SEQ ID NO.14)

[0095] Example 2: Construction of expression vector

[0096] (1) Using restriction endonucleases EcoR I and hind III. The plasmid pACYADuet-1 was subjected to double enzyme digestion, and linearized pACYCDuet-1 was obtained by gel recovery.

[0097] (2) SEQ ID NO.8 was amplified using primers PelB-F / B3H-R. The amplification system consisted of: 2 μL template; 2 μL each of primers PelB-F and B3H-R; 25 μL 2X Phanta Max Master Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. The amplification program was: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 56 ℃ for 20 s, 72 ℃ for 30 s); 72 ℃ for 5 min; 4℃∞.

[0098] SEQ ID NO.4 was amplified using primers B3H-F / rhCOL3His-R. The amplification system consisted of: 1 μL template; 2 μL each of primers B3H-F and rhCOL3His-R; 25 μL 2X Phanta MaxMaster Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. The amplification program was: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 60 ℃ for 20 s, 72 ℃ for 1 min); 72 ℃ for 5 min; 4 ℃ infinity.

[0099] The two fragments obtained were amplified using fusion PCR with primers PelB-F / rhCOL3His-R. The amplification system was as follows: template 1 μL; primers PelB-F and rhCOL3His-R 2 μL each; 2X Phanta Max Master Mix (DyePlus) 25 μL; ultrapure water to 5 μL; amplification program: 95 ℃ 3 min; 30 cycles × (95 ℃ 20 s, 58 ℃ 20 s, 72 ℃ 1 min); 72 ℃ 5 min; 4 ℃∞. The amplification products were purified and recovered to obtain the recombinant fragment PelB-rhCOL3H.

[0100] Primers:

[0101] PelB-F: Same as SEQ ID NO.9

[0102] B3H-R:

[0103] TGGTTGGTGGTTCT-AGAACCACCACCA (SEQ ID NO.15)

[0104] B3H-F:

[0105] CATGCATTGCA-ATGTGCAAGTGCTTCAACTGC (SEQ ID NO.16)

[0106] rhCOL3His-R:

[0107] GTGGTGGTGGTGGTGGTG (SEQ ID NO.17)

[0108] (3) The fragment PelB-rhCOL3H was amplified by PCR using primers CE-1F / R. The amplification system was as follows: 1 μL template; 2 μL each of primers CE-1F / R; 25 μL 2X Phanta Max Master Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. The amplification program was: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 56 ℃ for 20 s, 72 ℃ for 1 min); 72 ℃ for 5 min; and 4 ℃ ∞. The amplification product was purified and recovered. Then, the linearized pACYCDuet-1 was ligated to the purified fragment using the ClonExpressII One Step Cloning Kit to obtain the recombinant plasmid pACYC-PelB-rhCOL3H.

[0109] CE-1F:

[0110] TAAGCATTATGCGGCCGCAAGCTTTATGAAATACCTGCTGCCGACC (SEQ ID NO.18)

[0111] CE-1R:

[0112] AGGAGATATACCATGGGTGGTGGTGGTGGTGGTGGG (SEQ ID NO.19)

[0113] (4) Using restriction endonucleases Bgl II and Xho I. The recombinant plasmid pACYC-PelB-rhCOL3H was double-digested and gel-recovered. PCR amplification of the molecular chaperone RSP_RS13455 gene fragment was performed using primers CE2-F / R. The amplification system consisted of: 2 μL template; 2 μL each of primers CE2-F / R; 25 μL 2X Phanta Max Master Mix (Dye Plus); and ultrapure water to a final volume of 50 μL. The amplification program was: 95 ℃ for 3 min; 30 cycles × (95 ℃ for 20 s, 58 ℃ for 20 s, 72 ℃ for 1 min); 72 ℃ for 5 min; 4 ℃ infinity. After purification and recovery, the double-digested linearized vector was ligated to the purified RSP_RS13455 gene fragment using the ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pACYC-PelB-rhCOL3H-RS.

[0114] CE-2F:

[0115] GGAGATATACATATGGCAGATCTCTCAGGCCTCGACCGGCTC (SEQ ID NO.20)

[0116] CE-2R:

[0117] CGGTTTCTTTACCAGACTCGAGATGCGTAGCTATGATTTCTCGCC (SEQ ID NO.21)

[0118] Example 3: Construction of an engineered Escherichia coli strain expressing pACYC-PelB-rhCOL3H-RS

[0119] Transform the recombinant plasmid pACYC-PelB-rhCOL3H-RS E. coli BL21 (DE3) competent cells were plated on LB agar plates containing chloramphenicol and incubated at 37 °C for 12–16 h until single colonies formed. Subsequently, colony PCR was performed on the same single colony using primers YZ-1F / R and YZ-2F / R, respectively. Strains with correct verification results were subjected to gene sequencing, and the sequencing results were preserved and designated as PB3HS.

[0120] YZ-2F:

[0121] GGAGATATACATATGGCA (SEQ ID NO.22)

[0122] YZ-2R:

[0123] GTAGCTATGATTTCTCGCC (SEQ ID NO.23)

[0124] YZ-1F:

[0125] TAAGCATTATGCGGCCGCAAGCTT (SEQ ID NO.24)

[0126] YZ-1R:

[0127] GGTGGTGGTGGTGGTGGG (SEQ ID NO.25)

[0128] Preparation Example 1: Construction of an engineered Escherichia coli strain expressing pACYC-PelB-rhCOL3H

[0129] Transform the recombinant plasmid pACYC-PelB-rhCOL3H E. coliBL21 (DE3) competent cells were evenly spread onto LB agar plates containing chloramphenicol. After the liquid was absorbed, the plates were inverted and incubated at 37°C for 12–16 h until single colonies formed. Several single colonies were randomly selected and colony PCR was performed using primers YZ-1F / R to verify the correctness of the transformants. Plasmids were extracted from the strains with correct verification results and gene sequencing was performed. The strains with correct sequencing results were preserved and designated as PB3H.

[0130] Preparation Example 2: Preparation of strain P3

[0131] Using restriction endonucleases EcoR I and hind III. The plasmid pACYADuet-1 was subjected to double enzyme digestion, and linearized pACYCDuet-1 was obtained by gel recovery.

[0132] The rhCOL3 gene sequence was amplified by PCR using primers rhCOL3-F / R. The PCR product was purified by gel extraction to obtain the rhCOL3 gene fragment rhCOL3H with a 6×His tag added to the N-terminus.

[0133] Amplification system: Template 2 μL; primers rhCOL3-F / R 2 μL each; 2X Phanta Max Master Mix (DyePlus) 25 μL; ultrapure water to 50 μL. Amplification program: 95 ℃ 3 min; 30 cycles × (95 ℃ 20 s, 55 ℃ 20 s, 72 ℃ 1 min); 72 ℃ 5 min; 4 ℃ ∞.

[0134] The linearized pACYCDuet-1 was then ligated to the purified rhCOL3H fragment using the ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pACYC-rhCOL3H.

[0135] Transform the recombinant plasmid pACYC-rhCOL3H E. coli BL21 (DE3) competent cells were evenly spread onto LB agar plates containing chloramphenicol. After the liquid was absorbed, the plates were inverted and incubated at 37 °C for 12–16 h until single colonies formed. Several single colonies were randomly selected and colony PCR was performed using primers YZ-3F / YZ-1R to verify the correctness of the transformants.

[0136] YZ-3F:

[0137] ATGGGCAAGGACGGCCCGAG (SEQ ID NO.26)

[0138] Example 4

[0139] The LB solid culture medium used in this embodiment has the following formula: NaCl 10 g / L, yeast extract 5 g / L, tryptone 10 g / L, agar 20 g / L, and the remainder is water.

[0140] The LB liquid culture medium used in this embodiment has the following formula: NaCl 10 g / L, yeast extract 5 g / L, tryptone 10 g / L, and the remainder is water.

[0141] Single colonies of preserved Escherichia coli engineered strains P3, PB3H, and PB3HS were isolated by streaking on LB solid medium containing 25 μg / mL chloramphenicol. Then, single colonies were picked and inoculated into LB liquid medium containing 25 μg / mL chloramphenicol and activated at 37 ℃ and 200 rpm for 12 h to prepare seed culture.

[0142] The seed culture was inoculated at a ratio of 1:50 (V / V) into 200 mL of fresh LB liquid medium containing 25 μg / mL chloramphenicol, and cultured at 37 °C and 200 rpm until OD. 600 = 0.6 - 0.8, in this embodiment, cultured to OD 600 =0.8, the culture medium was heat-shocked in an oven at 42 ℃ for 10 min, and then 0.5 M IPTG aqueous solution was added to bring the final IPTG concentration to 0.4 mM. The cells were then cultured in shake flasks at 25 ℃ and 160 rpm for 18 h. The induced fermentation broth was centrifuged (8000 rpm, 4 ℃, 10 min), and the fermentation supernatant and cells were collected separately. The cells were washed twice with Tris-HCl buffer (pH=7.4) and then resuspended in 10 mL Tris-HCl buffer. The cells were sonicated on ice for 15 min, and the supernatant was collected at 8000 rpm and 4 ℃ for 20 min.

[0143] The collected fermentation supernatant and cell lysis supernatant were subjected to SDS-PAGE analysis to verify whether rhCOL3 expression was successfully induced. Strains P3 (which do not express PelB and Rsp_RS13455) served as a control. Based on theoretical predictions, the molecular weight of rhCOL3H in this application is 16.6 kDa. Figure 3 As shown, under the same induction conditions and sample volume, the rhCOL3H bands of each strain were of varying depths. Among them, the rhCOL3H band in the fermentation supernatant of PB3HS was the deepest, which further indicates that PB3HS has the strongest ability to produce soluble rhCOL3H and can effectively guide rhCOL3H to be secreted extracellularly.

[0144] Example 5: Purification of rhCOL3H

[0145] The fermentation supernatant prepared in Example 4 was separated and purified using the method described in this embodiment.

[0146] (1) Initial purification by nickel column affinity chromatography

[0147] Based on the His tagging characteristics of rhCOL3H, primary purification was performed using Ni²⁺ chelate affinity chromatography:

[0148] Gradient settings: The equilibration / loading buffer uses a Tris-HCl system with pH 7.4, and the imidazole concentration is increased in increments of 5 mM (10-30 mM) to reduce non-specific binding; the elution buffer uses a high concentration of imidazole (250-500 mM, 50 mM increments) to release the target protein through competitive binding.

[0149] Dynamic loading enhancement: Repeated sample loading twice prolongs the contact time between rhCOL3H and Ni-NTA filler, thereby improving the binding efficiency.

[0150] (2) Ion exchange chromatography purification

[0151] Based on the positively charged nature of recombinant human type III collagen, Q Sepharose Fast Flow anion exchange chromatography was used to purify the nickel column affinity chromatography pre-purified extract.

[0152] Charge separation mechanism: Under pH 7.4 conditions, rhCOL3H flows directly through due to its positive surface charge, while the negatively charged host protein is adsorbed onto the medium surface through electrostatic interaction.

[0153] Buffer optimization: The conductivity of the loading solution is controlled at 20-30 mS / cm (containing 50 mM NaCl) to avoid high salt interference with charge interactions; the collected flow-through solution is the purified protein solution.

[0154] The results are as follows Figure 4 As shown, the protein purified by the above steps has a purity greater than 95% and a yield greater than 80%.

[0155] (3) Determine the protein concentration of the sample.

[0156] After dialysis of the purified protein solution obtained in step (2), the content of rhCOL3H in the fermentation supernatant of strains P3, PB3H and PB3HS was determined by BCA method. The concentration results are shown in Table 1. The purified protein solution was then frozen and stored.

[0157] Table 1

[0158]

[0159] Quantitative analysis showed that strain PB3HS produced 0.993 g / L of rhCOL3H, a 55.2% increase compared to the basic strain P3; while strain PB3HS, which only expressed the molecular chaperone, had a rhCOL3H yield of 0.766 g / L, a 19.7% increase compared to the basic strain P3. This indicates that the synergistic effect of the molecular chaperone and the signal peptide PelB significantly enhanced the soluble expression efficiency of rhCOL3H.

[0160] Example 6

[0161] Using the same steps and methods as in Examples 1-3, *E. coli* strain S3RS, co-expressing recombinant human type III collagen (SrhCOL3) regulated by a signal peptide and a molecular chaperone, was prepared. Furthermore, *E. coli* strain S3P containing the recombinant vector pACYC-PelB-SrhCOL3 was prepared using the steps and methods in Example 1, and *E. coli* strain S3 containing the recombinant vector pACYC-SrhCOL3 was prepared using the steps and methods in Example 2. The obtained engineered strains were then subjected to secretory expression of recombinant human type III collagen (SrhCOL3) using the method in Example 4. SDS-PAGE analysis of the fermentation supernatant was performed to verify the effectiveness of the molecular chaperone and signal peptide in promoting the soluble expression of recombinant human type III collagen.

[0162] Construction of engineered bacteria S3RS:

[0163] The amino acid sequence of the recombinant human type III collagen used in this embodiment is shown in SEQ ID NO.27, and the corresponding nucleic acid sequence is shown in SEQ ID NO.28. Based on the nucleic acid sequence, it was synthesized by General Biotech (Anhui) Co., Ltd. without labeling and directly used in subsequent experiments. The synthesis of PelB and molecular chaperone Rsp_RS13455 nucleic acid sequences was the same as in Example 1.

[0164] The difference between the construction of the recombinant plasmid in this embodiment and the steps and methods in Example 2 is that, in step (2), the primers for amplifying SEQ ID NO.8 are PelB-F / B3S-R, and the annealing temperature is 58 ℃; the nucleic acid sequence encoding the amino acid sequence of recombinant human type III collagen in this application is SEQ ID NO.28, and the primers for amplifying it are B3S-F / SCOL3-R, and the annealing temperature is 57 ℃; the two fragments obtained by amplification are fused together, with the primers being PelB-F / SCOL3-R and the annealing temperature being 57 ℃, to obtain PelB-SrhCOL3, which is used in step (3); in step (3), the primers for amplifying PelB-SrhCOL3 are CE-S1F / CE-S1R, and the annealing temperature is 61 ℃, and the conditions of the other steps are the same as in Example 2, to obtain the recombinant plasmid pACYC-PelB-SrhCOL3-RS.

[0165] The difference between the construction of the engineered bacteria in this embodiment and the steps and methods in Example 3 is that in step (3), the verification primer 1 is YZ-S2F / YZ-S2R, and the annealing temperature is 54 ℃. Primer 2 is YZ-2F / YZ-2R, and the other verification conditions are the same as in Example 3, resulting in engineered bacteria S3RS.

[0166] Construction of engineered bacteria S3P:

[0167] In this embodiment, the construction method of engineered bacteria S3P is the same as that of PB3H in preparation example 1. The difference is that the recombinant vector pACYC-PelB-SrhCOL3 constructed in the construction method of engineered bacteria S3RS is used to construct an engineered strain of Escherichia coli. After transformation, colony PCR verification is performed on the same single colony using YZ-S2F / R and YZ-2F / R to obtain S3P.

[0168] Construction of engineered bacteria S3:

[0169] In this embodiment, the construction of S3 is the same as that of P3 in Preparation Example 2. The difference is that SEQ ID NO.28 is amplified by PCR using SCOL3-F / SCOL3-R and the annealing temperature is 56 ℃. The verification primers for the constructed Escherichia coli strain are YZ-S1F / YZ-S1R and the annealing temperature is 56 ℃. All other conditions are the same as in Preparation Example 2, and engineered bacteria S3 is obtained.

[0170] The engineered bacteria obtained were subjected to recombinant human type III collagen (SrhCOL3) secretion expression using the method described in Example 4. The fermentation supernatant was analyzed by SDS-PAGE, and the results are as follows: Figure 5As shown, the results indicate that the content of the target protein in the fermentation supernatant of engineered strain S3RS was significantly higher than that in the fermentation supernatant of engineered strains S3 and S3P. This demonstrates that the *E. coli* strain constructed in this application that expresses recombinant human type III collagen has broad efficacy for recombinant human type III collagen and can efficiently express recombinant human type III collagen in a soluble manner.

[0171] SEQ ID NO.27

[0172] MGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGA PGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAPGERGAPGPNGIPGEKGPAGERGAP

[0173] SEQ ID NO.28

[0174]

[0175] B3S-R:

[0176] TCCGCGTTCGCCCAT-AGAACCACCACCACC(SEQ ID NO.29)

[0177] B3S-F:

[0178] TGGTGGTGGTTCT-ATGGGCGAACGCGGA(SEQ ID NO.30)

[0179] SCOL3-F:

[0180] AGCATTATGCGGCCGCAAGCTT-ATGGGCGAACGCGGA(SEQ ID NO.31)

[0181] SCOL3-R:

[0182] AGGAGATTACCATGG-TCATGGAGCTCCTCT(SEQ ID NO.32)

[0183] CE-S1F:

[0184] GCATTATGCGGCCGCAAGCTT-ATGAAATACCTGCTGCC(SEQ ID NO.33)

[0185] CE-S1R:

[0186] AGGAGATTACCATG-TCATGGAGCTCCTCTCT(SEQ ID NO.34)

[0187] YZ-S2F:

[0188] ATGAAATACCTGCTGCC(SEQ ID NO.35)

[0189] YZ-S2R:

[0190] AGGAGATATACCATGG(SEQ ID NO.36)

[0191] YZ-S1F:

[0192] AGCATTATGCGGCCGCAAGCTT(SEQ ID NO.37)

[0193] YZ-S1R:

[0194] TCATGGAGCTCCTCTCT (SEQ ID NO.38)

[0195] Example 7: Stability determination of rhCOL3H

[0196] The rhCOL3H stock solution obtained by separating and purifying the fermentation supernatant of strain PB3HS in Example 5 was prepared into a 10 mg / mL solution, stored at 4 °C in the dark for 7 days, and then analyzed by spectrophotometry (OD). 280 The absorbance fluctuation rate was only 3%, indicating no significant aggregation or degradation; further SDS-PAGE analysis was used to detect the degradation of rhCOL3H. The results are as follows... Figure 6 As shown, the degradation degree of rhCOL3H is extremely low, indicating that the stability of rhCOL3H is not compromised. This data confirms that the rhCOL3H produced by the method of this patent has excellent conformational stability under liquid storage conditions (4 °C).

[0197] Example 8: Verification of the anti-inflammatory efficacy of rhCOL3H

[0198] The rhCOL3H used in this embodiment is the rhCOL3H isolated and purified from the fermentation supernatant of strain PB3HS in Example 5.

[0199] Mouse model establishment:

[0200] Experimental subjects and grouping: In this embodiment, 6-8 week old C57BL / 6 mice with a weight of 20±2 g (purchased from Cyagen (Suzhou) Biotechnology Co., Ltd.) were selected, with 3 mice in each group, and divided into 3 groups; the experimental groups were: normal group, control group, and collagen treatment group.

[0201] Normal group: No ultraviolet radiation after hair removal on the back (area 2×2 cm), and physiological saline (50 μL / body) is applied locally daily.

[0202] Control group (UV-Control): Hair removal on the back (area 2×2 cm), followed by UV irradiation, and application of physiological saline (50 μL / animal) daily after irradiation.

[0203] Collagen treatment group (rhCOL3H): Hair removal on the back (area 2×2 cm), followed by UV irradiation, and application of 1% rhCOL3H solution (50 μL / each) after each irradiation.

[0204] UV irradiation was performed by irradiating the hairless area on the back of mice with a UVB lamp (peak wavelength 302 nm), with the lamp 20 cm away from the mouse's back and the irradiation intensity of 100 mJ / cm² (50% dose adaptation for the first irradiation), once a day for 5 consecutive days.

[0205] Sample collection: 24 h after the last administration, an appropriate amount of back skin tissue was taken from each group of mice, mixed with physiological saline, ground into homogenate, and centrifuged to obtain the supernatant.

[0206] Inflammatory factor detection: The levels of IL-1β and IL-6 in tissue fluid were detected using an ELISA kit.

[0207] The experiment was repeated three times. Data are expressed as mean ± standard deviation. Differences between groups were analyzed using one-way ANOVA and Tukey post-hoc test (p<0.05).

[0208] The results are as follows Figure 7 As shown, compared with the normal group, the expression levels of inflammatory cytokines IL-1β and IL-6 in the skin of mice exposed to ultraviolet light were significantly upregulated (p<0.01). After treatment with rhCOL3H, the levels of the two pro-inflammatory factors were significantly downregulated compared with the control group (p<0.05), and returned to near normal physiological ranges (p>0.05 vs. normal group). These results indicate that rhCOL3H collagen can effectively antagonize ultraviolet-induced skin inflammation and tissue damage by specifically inhibiting the excessive release of IL-1β and IL-6, suggesting its potential application value in the field of photoprotection.

[0209] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An E. coli which can express a recombinant human type III collagen solubly, characterized by, The *E. coli* strain co-expressed recombinant human type III collagen and molecular chaperone regulated by a signal peptide; The amino acid sequence of the recombinant human type III collagen is shown in SEQ ID NO.3; The signal peptide is PelB, and its amino acid sequence is shown in SEQ ID NO.

7. The molecular chaperone is the heat shock protein Rsp_RS13455, and its amino acid sequence is shown in SEQ ID NO.

11. The gene encoding the recombinant human type III collagen regulated by the signal peptide and the gene encoding the molecular chaperone are expressed in the same vector pACYCDuet-1. The Escherichia coli is BL21 (DE3).

2. The method for constructing E. coli expressing soluble recombinant human type III collagen according to claim 1, wherein, Includes the following steps: S1. The gene encoding the signal peptide is fused with the gene encoding recombinant human type III collagen and ligated into an expression vector to obtain a recombinant plasmid. S2. The gene encoding the molecular chaperone is linked to the recombinant plasmid obtained in S1 to obtain an expression vector for the gene encoding the recombinant human type III collagen regulated by the signal peptide and the gene encoding the molecular chaperone. S3, the expression vector obtained in S2 is transformed into E. coli BL21 (DE3) to construct the E. coli strain.

3. A method for soluble expression of recombinant human type III collagen, characterized by, Seed culture was prepared by activating and culturing Escherichia coli expressing recombinant human type III collagen as described in claim 1. The seed culture was inoculated into a culture medium to obtain a culture solution. The culture solution was placed in an oven for heat shock, and IPTG was added for induction culture to obtain a fermentation broth. The broth was centrifuged, the fermentation supernatant was collected, and purified to obtain recombinant human type III collagen.

4. The method of claim 3, wherein, Includes the following steps: I. Single colonies were obtained by streaking Escherichia coli expressing recombinant human type III collagen as described in claim 1 on LB solid medium; II. Prepare seed culture by inoculating single colonies into LB liquid medium containing chloramphenicol and activating overnight at 37 ℃ and 180-200 rpm for 10-12 h; III. Inoculate the seed culture into LB liquid medium containing chloramphenicol and incubate at 37 ℃ and 180-200 rpm until OD. 600 = 0.6 - 0.8 to obtain the culture medium, place the culture medium in an oven at 42 ℃ for heat shock for 10-12 min, then add IPTG to a final concentration of 0.4-0.5 mM, ferment at 25 ℃ and 150-160 rpm for 16-20 h, centrifuge, separate and purify the fermentation supernatant to obtain recombinant human type III collagen; The volume ratio of the seed culture to the culture medium is 0.5-2:

50.

5. A recombinant human type III collagen prepared by the method of claim 3.