Recombinant type vii collagen having skin-whitening effect, preparation method therefor and use thereof

By efficiently expressing recombinant type VII collagen in the Pichia pastoris expression system and adding whitening and anti-aging sites, the problems of low expression level and poor stability of type VII collagen were solved, achieving whitening, anti-aging, anti-wrinkle and soothing effects. It is suitable for cosmetics and avoids skin irritation and high cost.

WO2026119282A1PCT designated stage Publication Date: 2026-06-11JIANGSU TRAUTEC MEDICAL TECH CO LTD

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
JIANGSU TRAUTEC MEDICAL TECH CO LTD
Filing Date
2025-12-05
Publication Date
2026-06-11

AI Technical Summary

Technical Problem

In existing technologies, type VII collagen has low expression levels and poor protein stability, making it difficult to produce industrially. Furthermore, traditional whitening products cause skin irritation and adverse reactions, while existing TRPV1 receptor antagonists are costly and slow to take effect.

Method used

Recombinant type VII collagen was efficiently expressed in a Pichia pastoris expression system using genetic engineering technology. Whitening, anti-aging, anti-wrinkle and soothing sites were added. By competitively binding to melanocyte receptors and inhibiting tyrosinase activity, the expression process was avoided, the expression level was increased and the purification process was simplified.

Benefits of technology

The recombinant type VII collagen, which achieves highly efficient secretion and expression, has excellent whitening, anti-aging, anti-wrinkle and soothing effects. It is suitable for sensitive skin, has good transdermal properties, and strong cell adhesion and migration activity, thus avoiding skin irritation and high cost issues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025140386-FTAPPB-I100001
    Figure PCTCN2025140386-FTAPPB-I100001
  • Figure PCTCN2025140386-FTAPPB-I100002
    Figure PCTCN2025140386-FTAPPB-I100002
  • Figure PCTCN2025140386-FTAPPB-I100003
    Figure PCTCN2025140386-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention belongs to the technical field of bioengineering. Provided are a recombinant type VII collagen having a skin-whitening effect, and a preparation method therefor and the use thereof. By means of research, the recombinant type VII collagen having a skin-whitening effect is identified. The expression level of the recombinant type VII collagen is increased by means of genetic engineering technology, and the expression and production of the recombinant type VII collagen are performed by using a eukaryotic Pichia pastoris expression system. The recombinant type VII collagen is expressed in Pichia pastoris, can be efficiently secreted and expressed extracellularly, and is less prone to degradation at the purification stage, thereby reducing the difficulty of purification. The recombinant type VII collagen exhibits an excellent skin-whitening effect, is suitable for sensitive skin, does not cause skin irritation, itching or burning, and thus has excellent practicality.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant type VII collagen with whitening effects, its preparation method and application Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to recombinant type VII collagen with whitening effects, its preparation method, and its application. Background Technology

[0002] Collagen is a major component of the human body, possessing various functions, including diverse biological properties, biocompatibility, and biodegradability. With a molecular weight exceeding 300,000, its three peptide chains are firmly bonded together, making it difficult for the human body to directly digest and absorb. It must be broken down into simpler amino acids by proteases in the digestive tract before it can be absorbed by the intestines. Collagen peptides, compared to collagen, have smaller molecular weights, exhibiting excellent biological functionality and high transdermal permeability, with an absorption rate of 95%–100%. They have wide applications in cosmetics, pharmaceuticals, and food.

[0003] Collagen peptides are easily absorbed and have good transdermal penetration, helping to maintain skin elasticity and moisture, promote skin cell renewal and repair, thereby improving skin texture, reducing wrinkles and fine lines, and showing significant effects in skin anti-oxidation, anti-aging, soothing, and whitening. The skin is the largest organ in the human body, covering the entire surface. Besides receiving sensory stimuli, it also has isolation and protection functions. With age, cell renewal slows down, and hormonal changes are directly reflected in the skin. The formation of free radicals affects the rate of normal skin aging, attacking skin structure, damaging collagen and elastin fibers, impairing hydration, resulting in poor complexion, sagging skin, and wrinkles. Skin color is mainly related to melanin content. Melanin deposition within cells is related to melanosome structure, transport, enzymes, and transcription. The mechanism of action of whitening products targeting the formation of melanin includes: 1) reducing exogenous stimulation signals, 2) inhibiting tyrosinase activity, 3) inhibiting melanin synthesis signaling pathways, 4) inhibiting melanosome maturation, and 5) inhibiting melanosome transport. Traditional medications, including corticosteroids, hydroquinone, and aminomercuric chloride, work by brightening skin tone, inhibiting melanocyte maturation, or interfering with melanin production. However, they have significant side effects, including stinging, contact dermatitis, irritation, high toxicity, and sensitivity. New skin-whitening ingredients competitively bind to MC1-R and MC4-R receptors on melanocytes, inhibiting α-MSH (melanocyte-stimulating hormone) and further preventing the production of tyrosinase, thereby reducing excessive melanin production and deposition; or selectively inhibit tyrosinase (TYR) activity to reduce pigmentation while avoiding cytotoxicity.

[0004] In the skincare field, capsaicin receptor 1 (TRPV1) is closely related to burning, irritation, sensitivity, and pain in the skin. As an irritant target, it plays a crucial role in sensitive skin and inflammatory responses. TRPV1 can activate sensory nerve endings, leading to burning and itching sensations, while also delaying skin barrier repair, making it a significant pathway causing skin discomfort. It is present in sensory nerve endings and skin cells, such as keratinocytes, fibroblasts, mast cells, and endothelial cells of dermal capillaries, and is sensitive to various physical and chemical irritants. Antagonists of TRPV1 receptors, used to alleviate skin discomfort caused by TRPV1 activation, are currently a hot topic in cosmetic raw material and product development. Currently, there is extensive research on components that inhibit TRPV1 receptors. Products targeting sensitive skin, such as palmitoyl tripeptide-8 and palmitoyl tetrapeptide-7, have anti-allergic and soothing effects, but in vitro synthesized peptides have low immunogenicity, high production costs, and slow onset of effects. Therefore, there is a need to develop collagen peptides with both safety and efficacy.

[0005] Anchoring fibers are attachment structures that mediate the adhesion of the dermis and epidermis in human skin. Type VII collagen (Col7) is a major component of anchoring fibers (AFs). Type VII collagen connects the basal layer to the underlying tissue through interactions with other types of collagen and parts of the extracellular matrix. In the absence of Col7, the secretion of ECM-related proteins is reduced, while endoplasmic reticulum stress associated with Col1 increases, and the TGFβ signaling pathway is elevated. Alterations in Col7 structure and expression levels may impair the functional interaction with ECM components, leading to epidermal-dermal separation and resulting in epidermolytic dystrophic bullous necrolysis (DEB), which is associated with persistent wound non-healing. Col7 is essential for the re-epithelialization of laminin 332 at the dermal-epidermal junction. Its absence disrupts the organization of laminin 332 during wound healing, thereby damaging the expression of integrin α6β4 in basal keratinocytes and negatively impacting the laminin 332 / integrin ratio. The absence of a single Col7 structure leads to cellular inflammation and promotes keratinocyte-driven progressive fibrosis. The mature enamel inner organic matrix (DEJ) contains large-molecule Col7, and the embedded Col7 fibers not only contribute to the structural elasticity of enamel but may also play a role in the adhesion between enamel and dentin. Currently, there are few existing expression systems for type VII collagen due to the high cost and slow growth cycle of mammalian cell culture, resulting in low expression levels of 15-20 mg / L. Although secreted into the supernatant, the purification process is complex, leading to significant product loss and hindering industrial-scale production. While the yield has improved in the large intestine expression system, it has not reached commercial production scale. Both of these expression methods have low yields and poor protein stability, making them limited to laboratory research. Patent CN 118324898 A uses Pichia pastoris as a recombinant expression strain to express type VII collagen. The expressed type VII collagen is a large molecule and exhibits effects such as promoting cell proliferation, migration, and differentiation. However, it has not shown efficacy in skincare products or binding to bioactive molecules.

[0006] Therefore, there is a need to develop recombinant small molecule collagen with whitening, anti-aging, anti-wrinkle and soothing effects. Summary of the Invention

[0007] To address some shortcomings in existing technologies, this invention provides recombinant type VII collagen with whitening effects, its preparation method, and its applications. This invention discovered recombinant type VII collagen with whitening effects through research and used genetic engineering technology to increase its expression level. The recombinant type VII collagen was produced using a Pichia pastoris expression system. The recombinant type VII collagen described in this invention is expressed in Pichia pastoris, can be efficiently secreted extracellularly, and is not easily degraded during purification, reducing the difficulty of purification. The recombinant type VII collagen has excellent whitening, anti-aging, anti-wrinkle, and soothing effects, is suitable for sensitive skin, and will not cause skin irritation, itching, or burning, making it highly practical.

[0008] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0009] The present invention first provides a recombinant type VII collagen with whitening effect, wherein the recombinant type VII collagen contains a binding site for a whitening action site; the whitening action site includes one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

[0010] Preferably, the recombinant type VII collagen further includes binding sites for one or more sites of action that have anti-aging, anti-wrinkle, or soothing effects;

[0011] The sites of action for anti-aging, anti-wrinkle, or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

[0012] Preferably, the sequence of the recombinant type VII collagen is as shown in i or ii:

[0013] i. The amino acid sequence is as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 or SEQ ID No. 4;

[0014] ii. Proteins derived from i whose amino acid sequence in i has been substituted, deleted, or added with one or more amino acids and which have human collagen activity.

[0015] The present invention also provides a nucleic acid encoding the above-mentioned recombinant type VII collagen with whitening effect, the nucleic acid sequence of which is shown in SEQ ID No. 5-SEQ ID No. 8.

[0016] The present invention also provides a recombinant expression vector comprising the above-mentioned nucleic acid.

[0017] The present invention also provides a recombinant engineered bacterium, comprising the nucleic acid molecule as described above or the recombinant expression vector as described above.

[0018] Preferably, the host bacteria of the recombinant engineered bacteria include one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula polymorpha.

[0019] Preferably, the host cell is Pichia pastoris, more preferably GS115-HCPBPPKEX2, with accession number CGMCCNo.25815.

[0020] Preferably, the recombinant engineered bacteria are deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession numbers CGMCC No. 31991 and CGMCC No. 31992.

[0021] This invention also provides a method for preparing the above-mentioned recombinant type VII collagen with whitening effects, the preparation method comprising:

[0022] (1) Select and design the sequence of recombinant type VII collagen, and then construct collagen tandem sequence based on the tandem repeat of recombinant type VII collagen as the basic unit;

[0023] (2) Construct a recombinant plasmid expressing a collagen tandem sequence and linearize the recombinant plasmid to obtain a linearized plasmid;

[0024] (3) The linearized plasmid was electroporated into the host bacteria, and the bacteria were screened and verified to obtain high-copy recombinant engineered bacteria;

[0025] (4) The high-copy recombinant engineered bacteria were fermented and induced to express the protein, and then purified to obtain recombinant type VII collagen.

[0026] Preferably, in step (1), the recombinant type VII collagen contains a binding site for a whitening action site; the whitening action site includes one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET.

[0027] Preferably, the recombinant type VII collagen further includes binding sites for one or more sites of action that have anti-aging, anti-wrinkle, or soothing effects;

[0028] The sites of action for anti-aging, anti-wrinkle, or soothing effects include one or more of TRPV1, IL1R1, and MT-CO2.

[0029] Preferably, in step (1), the sequence of the recombinant type VII collagen is as shown in i or ii:

[0030] i. The amino acid sequence is as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 or SEQ ID No. 4;

[0031] ii. Proteins derived from i whose amino acid sequence in i has been substituted, deleted, or added with one or more amino acids and which have human collagen activity.

[0032] Preferably, in step (1), the collagen tandem sequence contains 8 to 10 basic units of recombinant type VII collagen; there are sites for recognition and cleavage by Kex2 enzyme or Ste13 enzyme between two adjacent basic units.

[0033] Preferably, the recognition and cleavage site includes KR or RR dual-basic amino acid residues, followed by EA, EAEA, or other amino acid residues that facilitate cleavage by the Kex2 or Ste13 enzymes.

[0034] Preferably, in step (1), the nucleic acid of the collagen tandem sequence includes a nucleotide sequence as shown in SEQ ID No. 6 or SEQ ID No. 8, or a degenerate sequence thereof.

[0035] Preferably, in step (2), the vector of the recombinant plasmid includes pPICZαB, pFLDα, and pPIC9K, and the linker site is between XhoI and NotI.

[0036] Preferably, the carrier is pPIC9K.

[0037] Preferably, in step (3), the host bacteria includes one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula polymorpha.

[0038] Preferably, in step (3), the recombinant engineered bacteria are deposited at the China General Microbiological Culture Collection Center, with accession numbers CGMCC No. 31991 and CGMCC No. 31992.

[0039] The present invention also provides recombinant type VII collagen prepared according to the above method.

[0040] This invention also provides the application of the above-mentioned recombinant type VII collagen in whitening, anti-aging, anti-wrinkle or soothing products.

[0041] The present invention also provides a whitening, anti-aging, anti-wrinkle or soothing product, the product comprising the above-mentioned recombinant type VII collagen, or type VII collagen encoded by the nucleic acid, or the recombinant vector, or type VII collagen obtained by the method.

[0042] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0043] (1) The recombinant type VII collagen of the present invention contains one or more sites with whitening, anti-aging, anti-wrinkle and soothing effects. The recombinant type VII collagen has excellent skin care effects and is suitable for sensitive skin, without causing skin irritation, itching or burning. The recombinant type VII collagen of the present invention competitively binds to the MC1-R and / or MC4-R receptors of melanocytes, inhibiting α-MSH melanocyte-stimulating hormone and further preventing the production of tyrosinase, thereby reducing excessive melanin production and deposition; the recombinant type VII collagen of SEQ ID No. 1 and SEQ ID No. 3 simultaneously contains binding sites for both MC1-R and MC4-R whitening action sites.

[0044] (2) The recombinant type VII collagen described in this invention is expressed in Pichia pastoris and can be efficiently secreted and expressed extracellularly. The amino acid sequence is clear, the band is single, there is no degradation, and the small molecule collagen is easily absorbed. The transdermal permeability, cell adhesion activity, cell migration and cell proliferation activity of the small molecule collagen were detected. The results showed that it maintained good transdermal permeability while retaining biological activity. It has cell adhesion and cell migration activities that are not weaker than those of natural macromolecular collagen. The tandem expression of small molecules increases the expression level, which solves the product shortage of recombinant small molecule type VII collagen and provides a raw material for cosmetics.

[0045] (3) The present invention uses a small molecule tandem expression method to express recombinant type VII collagen, which greatly increases the yield of recombinant type VII collagen. The technical solution of the present invention does not introduce exogenous proteins or use any in vitro enzymatic digestion. During the intracellular secretion process, the recombinant type VII collagen will remove the residual amino acid residues of the enzyme cleavage sites during the repeated tandem design, and obtain recombinant type VII collagen with no non-collagen sequence or 100% homology with the corresponding region of natural collagen. The entire expression system avoids the cost and risk of exogenous protein residue caused by in vitro protease digestion, and can also shorten the time and cost of subsequent purification processes. Attached Figure Description

[0046] Figure 1 shows an agarose gel image of the recombinant engineered strain; in the figure, a is GS115-HCPB-kex2-pPIC9K-715 and b is GS115-HCPB-kex2-pPIC9K-719.

[0047] Figure 2 shows the supernatant of recombinant type VII collagen expression in shake flasks after 72 hours of induction; in the figure, a represents 715 and b represents 719.

[0048] Figure 3 shows the protein proteomic analysis results of recombinant type VII collagen; in the figure, a is the protein list, b is the peptide coverage of 715 compared with the amino acid database, and c is the peptide coverage of 719 compared with the amino acid database.

[0049] Figure 4 shows the electrophoretic detection of recombinant type VII collagen.

[0050] Figure 5 shows the electrophoretic detection of purified recombinant type VII collagen.

[0051] Figure 6 shows the results of cell adhesion activity assay.

[0052] Figure 7 shows the results of the cell migration area ratio detection.

[0053] Figure 8 shows a picture of cell migration.

[0054] Figure 9 shows the inhibition rate of tyrosinase activity by sample 719.

[0055] Figure 10 shows the melanin synthesis inhibition rate; in the figure, a is 715 and b is 719.

[0056] Figure 11 shows the results of cell viability testing. Detailed Implementation

[0057] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. In the embodiments of the present invention, unless otherwise described, conventional experimental methods are used. The processes involved in the embodiments, unless otherwise described, are those that can be understood and easily implemented by those skilled in the art based on the product manual or basic knowledge in the field, and therefore will not be described in detail.

[0058] Example 1:

[0059] S1. Design of the amino acid sequence for recombinant type VII collagen:

[0060] A sequence of approximately 50 amino acids from the triple helix region of human type VII collagen (Q02388 CO7A1_HUMAN) was selected. KR was added to the C-terminus and EA was added to the N-terminus. After tandemly adding 6-10 copies, the target sequence size was made to be approximately 50 kDa, which is suitable for the optimal expression range of Pichia pastoris. After expression in Pichia pastoris, the kex2 contained in Pichia pastoris cleaved the KR C-terminus of KREA at the amino acid linker, and ste13 cleaved the N-terminal EA. Overexpressed HCPB cleaved the linker KR residue at the C-terminus, cleaving the tandemly tandem protein into monomers, which were then secreted extracellularly via a secretory signal peptide.

[0061] (1) Select the amino acid sequence containing multiple whitening, anti-aging and soothing binding sites, including whitening sites such as MC1-R and MC4-R; anti-aging and soothing binding sites such as TRPV1 and IL1R1, i.e., 2731-2778AA of Q02388.CO7A1-HUMAN, with LE added to the C-terminus, and the obtained sequence is named 715, as shown in SEQ ID No.1.

[0062] Based on SEQ ID No. 1, EA is added to the N-terminus and KR is added to the C-terminus to form a basic unit. The basic unit is repeated 8 times to form the amino acid sequence shown in SEQ ID No. 2, which is the collagen tandem sequence.

[0063] SEQ ID No. 1:

[0064]

[0065] SEQ ID No. 2:

[0066]

[0067] (2) Select the binding site amino acid sequence containing multiple whitening, anti-aging and soothing sites. The whitening sites include binding sites such as MC1-R, MC4-R and GRM6; the anti-aging and soothing sites include TRPV1, IL1R1 and MT-CO2, i.e., 1619-1667AA of Q02388.CO7A1-HUMAN. Add LA to the C end and name the obtained sequence 719. The sequence is shown in SEQ ID No.3.

[0068] Based on SEQ ID No. 3, add EA to the N-terminus and KR to the C-terminus to form a basic unit. Repeat the basic unit 10 times to form the amino acid sequence shown in SEQ ID No. 4, which is the collagen tandem sequence.

[0069] SEQ ID NO.3:

[0070]

[0071] SEQ ID NO.4:

[0072]

[0073] S2. DNA sequence synthesis and recombinant plasmid construction:

[0074] The nucleic acid sequences encoding the above-mentioned amino acid sequences SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 were synthesized by Nanjing Genscript Biotech Co., Ltd., and the corresponding nucleic acid sequences are shown as SEQ ID No. 5-SEQ ID No. 8 respectively.

[0075] The synthesized gene fragments, as shown in SEQ ID No. 6 and SEQ ID No. 8, were cloned into pPIC9K, respectively. The exogenous target protein sequence was cloned using XhoI and NotI restriction enzyme sites to ensure that the target fragment was accurately inserted into the reading frame of the secretory vector containing the secretion signal α-factor, thereby obtaining recombinant plasmids expressing SEQ ID No. 1 and SEQ ID No. 3, named pPIC9K-715 and pPIC9K-719.

[0076] SEQ ID No. 5-SEQ ID No. 8 are shown below, where “CTCGAG” is the XhoⅠ restriction site and “GCGGCCGC” is the NotⅠ restriction site.

[0077] SEQ ID NO.5:

[0078]

[0079] SEQ ID NO.6:

[0080]

[0081] SEQ ID NO.7:

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] SEQ ID NO.8:

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117] S3. Construction and screening of recombinant engineered strains:

[0118] 10 μg of the recombinant plasmid obtained in step 2 was linearized with SalI (Dalian TaKaRa) fast digestion enzyme, digested in a metal bath at 37℃ for 30 min, and the linearized plasmid was collected by ethanol precipitation, with the volume controlled at about 20 μL.

[0119] The linearized plasmid was electroporated into competent Pichia pastoris GS115-HCPB-PPKEX2 cells (from strain CGMCC No. 25815). The electroporated bacterial culture was plated on MD plates for His-positive bacteria screening. Theoretically, 1-10% of His+ transformants will have more than one copy insertion. If the frequency of multiple copy insertion is 1%, then 1000 His+ transformants will need to be screened to obtain 10 His-positive bacteria. Therefore, it is necessary to select a large number of single colonies for verification and screening to identify resistant colonies.

[0120] The screening steps are as follows:

[0121] Spread 200 μL of the solution onto an MD plate and incubate at 30°C for 2 days. The cells growing on the MD plate are assumed to be His+ transformants. Wash the bacterial cells on the MD plate with sterile water and collect them into sterile EP tubes. After measuring OD600, analyze the bacterial culture at 5*10⁻⁶ ppm. 5 The bacteria were spread onto YPDG (500 μg / mL, 1 mg / mL, G418) plates, incubated at room temperature for 10 min, and then incubated upside down at 30°C for 2-5 days until single colonies (positive transformants) appeared. The high-concentration antibiotic plates produced single colonies with higher copy numbers than the low-concentration antibiotic plates, yielding high-copy recombinant engineered bacteria, named GS115-HCPB-PPKEX2 / pPIC9K-715 and GS115-HCPB-PPKEX2 / pPIC9K-719.

[0122] The high-copy recombinant engineered bacteria were sent to the China General Microbiological Culture Collection Center (CGMCC), with accession numbers CGMCC No. 31991 and CGMCC No. 31992, respectively. Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Accession date: September 18, 2024; Classification and name: *Pichia pastoris* *Komagataella phaffii*.

[0123] Sixteen single colonies of each sequence were picked and placed in 200ml LYPD medium in a 96-well plate. The plates were incubated at 30°C for 24 hours. 80μL of the bacterial culture was used to extract the template, and 2μL of the extracted template was added to a PCR tube. Polymerase chain reaction was performed by PCR. After the reaction, nucleic acid electrophoresis was used to verify the target band.

[0124] The primers used in the above PCR reaction are:

[0125] 5'AOX:GACTGGTTCCAATTGACAAGC (SEQ ID No. 9);

[0126] 3'AOX:GCAAATGGCATTCTGACATCC (SEQ ID No. 10);

[0127] The PCR reaction conditions were: 94℃ for 5 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min 15 s, repeated 30 times.

[0128] The results of nucleic acid electrophoresis verification are shown in Figure 1. As can be seen from Figure 1, the product size is 1900-2200bp, and there are two close target bands in the 719 target sequence. There are a few samples without target bands. Positive strains with the correct target bands in the nucleic acid electrophoresis image were selected for the next step of the experiment.

[0129] S4. Induced expression and identification of recombinant collagen:

[0130] Engineered bacteria GS115-HCPB-PPKEX2 / pPIC9K-715 and GS115-HCPB-PPKEX2 / pPIC9K-719, whose colonies were verified by PCR, were inoculated into 15 mL of BMGY medium and cultured at 28-30℃ and 220 rpm until the OD600 reached 2-15 (16-24 h). The cells were collected by centrifugation at 1500-3000g for 5 min at room temperature, resuspended in BMGY medium to an OD600 of approximately 10, and cultured for another 3 days at 28-30℃ and 220 rpm. 0.5% methanol was added every 24 h for 72 h of induction. Samples were then collected, and the supernatant was collected by centrifugation at 9000g for 5 min at room temperature. The collected expression supernatant was mixed with 2× loading buffer (Coomassie Brilliant Blue, denaturing agent DTT, SDS buffer), heated in a 100℃ metal bath for 5 min, and then subjected to Tricine protein gel electrophoresis using a precast GLASSgel. The results are shown in Figure 2. The results indicate that the target band can be efficiently secreted and expressed extracellularly, with a molecular weight consistent with the epigenetic migration characteristics of collagen, and no degradation was observed.

[0131] The target bands of 715 and 719 were cut from the Tricine pre-gel of GLASS gel and digested with trypsin. Nano-HPLC-MS / MS mass spectrometry was used to detect the trypsin-digested peptides of recombinant collagen (this was performed by Suzhou Putai Biotechnology Co., Ltd.). The detected peptides were compared with the theoretical sequences, and the results are shown in Figure 3. Protein gel mass spectrometry identification of the target bands showed that the similarity to the theoretical amino acid sequence of the protein gel was over 85%.

[0132] S5. High-density fermentation and purification experiment:

[0133] (1) The recombinant engineered bacteria selected in step 3 were subjected to high-density fermentation experiments to express and produce 715 and 719 collagen on a large scale, and a fermentation broth containing recombinant collagen was obtained.

[0134] The seed culture medium YPG consisted of 10 g / L yeast extract, 20 g / L peptone, and 10 g / L glycerol.

[0135] Fermentation medium: NH4H2PO4 190.4g / L, KH2PO4 10.06g / L, CaSO4·2H2O 1.18g / L, K2SO4 18.2g / L, MgSO4·7H2O 14.9g / L, glycerol 40g / L; After the fermentation medium was sterilized at high temperature, PTM1 was added after the temperature dropped to room temperature, and the pH was adjusted to 5.0 with ammonia.

[0136] Feeding medium: 50% w / v glycerol, with 12 mL PTM1 micronutrients per liter;

[0137] Induction medium: 100% methanol, with 12 mL of trace elements added per liter;

[0138] PTM1: Sterilize by filtration through a 0.22μm filter membrane and store at 4℃.

[0139] The batch culture and induction expression conditions for the engineered strain were as follows: A fed-batch culture method was used at a temperature of 30℃. The engineered strain was inoculated into a 1L shake flask containing 200mL of seed culture medium (YPG) and cultured at 220rpm and 30℃ for 18-20 hours until OD600 = 2-10. A 5L fermenter (Baoxing Biotechnology) was used, containing 2L of fermentation medium. 2% glycerol was sterilized separately. Before inoculation, the fermentation speed was adjusted to 300rpm, aeration rate to 4L / min, and temperature to 30℃. The pH was adjusted to 4.5 using a concentrated ammonia solution. Then, 0.9mL of LPTM1 was inoculated first, followed by 200mL of the prepared seed culture (flame ring inoculation). The dissolved oxygen electrode was then calibrated, and fermentation began. When the dissolved oxygen level first dropped to 30%, the dissolved oxygen cascade speed function was used to maintain 30%. The fermentation continued until the glycerol was depleted, the dissolved oxygen rebounded, and the dissolved oxygen level exceeded 70% (OD600 = 2-10). 600 (Value approximately 20), cancel dissolved oxygen cascade speed, increase stirring speed to 650 rpm, and use 30% glycerol for continuous feeding, adding 80 mL of glycerol. Stop glycerol feeding, and after dissolved oxygen rebounds to above 70%, set pH 4 and temperature 29℃, and use a mixed carbon source of methanol and glycerol (methanol: 50% glycerol = 7:3) for induction culture. Manually add 5 mL, and after dissolved oxygen rebounds to above 70%, set the feeding rate to 8 mL / h, increase to 10 mL / h after one hour, and then increase again to 20 mL / h after another hour. When the dissolved oxygen value drops below 30%, stop feeding and wait for dissolved oxygen to rebound. After dissolved oxygen rises back to 30%, resume continuous feeding. Induction lasts 40–60 hours. When UV measurement shows no significant increase or decrease in protein concentration, the culture can be removed from the tank.

[0140] UV protein quantification formula: C(mg / mL)=0.144*(A215-A225), A215<1.5.

[0141] The fermentation supernatant was collected and processed into a pre-cast glass gel containing tricine (16.5%, Shanghai Wansheng Haotian) for protein electrophoresis. The sample volume was 5 μL, and the results are shown in Figure 4. As can be seen from the figure, under high-density fermentation conditions, each collagen sequence showed almost only the target band after induction, with the main band accounting for over 85% of the total.

[0142] (2) Purification:

[0143] Buffer A: 20 ml M KH2PO4, pH 4.0;

[0144] Buffer B: 20mM KH2PO4, 1M NaCl, pH 4.0.

[0145] Collect the fermentation broth from step (1), centrifuge at 2000g, 30min, and 4℃ to separate the cells and fermentation supernatant. Equilibrate the cation exchange medium (UniGel-80sp from Suzhou Nanomicro, loaded onto an XK50 / 30 column from Lishui Technology, using a GEAKTA Pure protein separation chromatography purification system) with buffer A until the absorbance and conductivity of A215 remain constant. Then, set the flow rate to 100us / cm and load the sample at a volume of 0.5L / time. Detect the UV absorbance of A215. When it rises, start loading the sample. When the absorbance of A215 decreases, stop loading the sample until the UV absorbance and conductivity reach their minimum and no longer change. After loading, close the loading and equilibrate the cation exchange medium with buffer A again. Collect the eluent, and after identifying the components, dialyze them (dialysate is ultrapure water). Then concentrate and freeze-dry to collect the lyophilized collagen sponges, i.e., 715 and 719.

[0146] The purified lyophilized sponge was dissolved in ultrapure water and subjected to protein electrophoresis, as shown in Figure 5. It can be seen from the figure that bands 715 and 719 are clear and the content of the target band is high.

[0147] Example 2: Cell adhesion activity experiment of recombinant collagen

[0148] In this embodiment, natural collagen was used as a control, and 715 and 719 collagen (recombinant type VII collagen with amino acid sequences as shown in SEQ ID No. 1 and SEQ ID No. 3) were used as examples to examine the cell adhesion activity of the recombinant type VII collagen described in this invention.

[0149] The specific steps are as follows:

[0150] (1) Material preparation: Mouse embryonic fibroblasts NIH / 3T3 (cell line from the Chinese Academy of Sciences Cell Bank (SCSP-515), culture and passage methods were performed according to the cell instructions). 715 and 719 collagen lyophilized sponges and positive-positive natural collagen (Sigma, catalog number C7774-5MG) were also prepared.

[0151] The positive control natural collagen was processed as follows: 5 mL sterile centrifuge tubes were weighed, human collagen was added in a laminar flow hood and weighed again, the weight was reduced to obtain the sample amount, dissolved in ultrapure water and acetic acid was added to pH 3.0 (concentration 5 mg / mL) to obtain a milky white solution. The protein concentration was determined using the empirical formula for UV protein quantification: C (mg / mL) = 0.144 * (A215 - A225). When using, the concentration was diluted to 0.5 mg / mL with serum-free DMEM medium and filtered through a 0.22 μm sterile filter for sterilization. (2) Coating preparation:

[0152] Add 100 μL of sample (standard / sample / blank control) to each well of a 96-well plate. Standard: Positive control natural collagen 0.5 mg / mL (Sigma, catalog number C7774-5MG); Sample: 715 and 719 collagen 0.5 mg / mL; Blank control: D-PBS phosphate buffer.

[0153] Four wells were prepared by coating each sample as described above, and incubated at 37°C in a 5% CO2 (v / v) incubator for 1-4 hours. Excess coating solution was removed from the wells, and 100 μL of 1% BSA-PBS solution was added. The cells were then incubated at 37°C in a 5% CO2 incubator for 1 hour. After removing the liquid from the wells, the cells were washed three times with D-PBS, and the washing solution was discarded. Hoechst-33342 fluorescent staining agent (10%) was premixed with complete culture medium, and NIH / 3T3 cells were diluted to 5 × 10⁻⁶ cells using this solution. 4 Cells / mL. Add 100 μL of cells to the wells, cover with aluminum foil, and incubate at 37°C and 5% CO2 for 1 h.

[0154] The specific testing steps are as follows:

[0155] At least 4×4 digital tiled images (fluorescence) of each well in three wells were captured using an inverted microscope. Each well was filled with D-PBS to form an "inverted meniscus," air bubbles were removed, and the wells were sealed with a sealing film. The plates were centrifuged at 300 g relative centrifugation (RCF) at 22°C (inverted) for 5 min. After centrifugation, the sealing film was discarded, and the supernatant was removed from the wells. The plates were washed once with D-PBS, and then 100 μL of D-PBS was added. For each of the three wells, a total of 25 fluorescent tiled digital images were captured (at least a 4×4 matrix is ​​recommended, with 10% tile overlap). The cell count was calculated to be approximately 2400 to 3600 cells per sample (800–1200 cells / well × 3 wells). Three replicate samples were measured. The fourth well was used to adjust microscope parameters and its measurements were not used. The measurement results are shown in Figure 6.

[0156] As shown in Figure 6 of the adhesion experiment of NIH / 3T3 and HaCat cells, the coated samples exhibited stronger adhesion than the blank control group. The difference was even more pronounced in the NIH / 3T3 cells compared to the blank control group. This is because the 715 sequence contains active binding sites for whitening and other effects, as well as an active binding site for complement C1s. Complement C1s is a catalytically active subunit in the classical activation pathway and has a significant effect on promoting cell adhesion. The adhesion experiment results show that 719 has a good promoting effect on cell adhesion.

[0157] The 719 sequence has similar efficacy to 715 and contains a binding site for matrix metalloproteinase-12 (MMP-12). MMP-12 is an important enzyme protein in the degradation of the extracellular matrix, enabling leukocytes, fibroblasts, and tumor cells to penetrate the matrix and participate in inflammatory responses and tissue repair by degrading matrix proteins. Targeting matrix metalloproteinases (MMPs) as therapeutic targets, the design and search for antagonistic drugs against MMPs, especially drugs that can selectively inhibit MMPs or competitively bind to MMPs, has been a hot topic in cancer treatment in recent years. The active binding site in the 719 peptide can competitively bind to MMP-12, thereby inhibiting the penetration of leukocytes, fibroblasts, and tumor cells into the matrix. Therefore, the recombinant type VII collagen described in this invention exhibits cell adhesion similar to that of natural collagen.

[0158] Example 3: Recombinant collagen cell migration experiment

[0159] In this embodiment, NIH / 3T3 cells, identical to those in Example 2, were used to examine the cell migration ability of 715 and 719 collagen lyophilized sponges and positive control natural collagen (Sigma, catalog number C7774-5MG).

[0160] (1) Experimental preparation: First, use a marker pen to draw horizontal lines evenly on the back of the 6-well plate, approximately every 0.5cm to 1cm, passing through the holes. Three lines should pass through each hole. Add approximately 5×10⁻⁶ ppm of the mixture into the holes. 5 Each cell.

[0161] (2) Scratch assay: On the second day of cell culture, use a pipette tip to make a scratch as perpendicular as possible to the horizontal line on the back of the cell, ensuring the pipette tip is vertical and not tilted. Then wash the cells three times with PBS to remove the scratched cells. Add serum-free culture medium containing the test sample as the experimental group, with a concentration of 0.05% (w / v). Incubate at 37°C in a 5% CO2 incubator. Take samples and photographs at 0 and 24 hours of culture.

[0162] (3) Data Processing: The scratch area of ​​each image was calculated using ImageJ image processing software. The cell migration rate of each group was calculated by dividing the total area of ​​migrating cells in the fixed scratch area by the initial area of ​​the fixed scratch area. A graph was plotted with time on the horizontal axis and the migration area ratio on the vertical axis (unit: %), and the photos of the experimental group and the control group at the initial 0 and the end of the experiment were compared. One-way ANOVA was used to analyze the differences in data between the experimental groups, and the chi-square test was used. The experimental results are shown in Figures 7 and 8.

[0163] As shown in Figures 7 and 8, after 24 hours of migration experiments with NIH / 3T3 and HaCat cells, sample group 715 exhibited a higher cell migration rate, while sample group 719 showed a superior cell migration-promoting effect compared to the blank control group and similar to the positive control group. This indicates that as cells continue to grow over time, the promoting effect of the experimental group samples on cell migration is more pronounced under physiological conditions, effectively promoting the migration of cells to biological materials.

[0164] Example 4: Investigation of the ability to inhibit cellular tyrosinase activity

[0165] Melanin is a high-molecular-weight biological pigment synthesized by melanocytes and distributed in the dermis of the skin. The quantity and quality of melanin in the skin are important factors determining skin color. Melanin synthesis is mainly regulated by tyrosinase, which is the rate-limiting enzyme in the initiation reaction of melanin synthesis in organisms. In this embodiment, mouse melanoma cells B16 (derived from C57BL / 6J mouse melanoma, catalog number: CM3076) were used as the research object to determine the inhibition rate of intracellular tyrosinase activity by the recombinant type VII collagen described in this invention, thereby evaluating the whitening effect of the recombinant type VII collagen.

[0166] The specific steps are as follows:

[0167] In this embodiment, the blank control was cell culture medium and cells without the sample, the positive control was 100 μg / mL α-arbutin, and the experimental groups were 0.01%, 0.03%, and 0.1% of recombinant type VII collagen 715 and 719.

[0168] B16 cells were fed at a rate of 1×10 4 In 96-well cell culture plates, cells were seeded at a density of 100 μg / mL. After 24 hours, the plates were washed with PBS and the experimental samples were replaced with samples diluted with 1640 medium. The blank control group was treated with the same volume of 1640 medium, while the positive control group was treated with 100 μg / mL α-arbutin and 1640 medium. Each concentration was used in triplicate. After 72 hours of incubation, the supernatant was discarded, and the cells were washed once with PBS. Then, 100 μL of PBS containing 1% Triton X-100 was added to each well. The plates were incubated at -80°C for 30 minutes, followed by incubation at 37°C to induce complete cell lysis. After 20 minutes, 50 μL of 1×10⁻⁶ ppm PBS was added to each well. -2 The absorbance of L-DOPA (mol / L) was measured at 492 nm after incubation at 37 °C for 30 min.

[0169] The tyrosinase activity inhibition rate is calculated as (1 - absorbance of sample group / absorbance of control group) * 100%.

[0170] GraphPadPrism software was used for statistical analysis to determine the significance of the difference (P-value). The inhibition rate of tyrosinase activity in the positive control was 11.43% ± 3.57%, which was significantly different from that in the blank control (P-value 0.00516), indicating that the experimental system was effective. Recombinant type VII collagen 715 had no inhibitory effect on tyrosinase activity at the tested concentrations of 0.01%, 0.03%, and 0.1%. 719 had an inhibitory effect on tyrosinase activity at the tested concentrations of 0.01%, 0.03%, and 0.1%.

[0171] As shown in Figure 9, the tyrosinase activity inhibition rate in the positive control group was 46.12% ± 6.61%, which was significantly different from the blank control (P < 0.001), indicating the effectiveness of the experimental system. The tyrosinase activity inhibition rates of 719 at 0.01% test concentration were 24.42% ± 9.08%, at 0.03% test concentration were 34.50% ± 4.08%, and at 0.1% test concentration were 42.64% ± 6.40%, all higher than the blank control. Using GraphPadPrism software, the t-test analysis of the tyrosinase activity inhibition rates of the blank control, positive control, and experimental samples showed that 719 had a significant inhibitory effect on tyrosinase.

[0172] In summary, the recombinant type VII collagen of this invention can reduce excessive melanin production and deposition by inhibiting the activity of tyrosinase, thereby achieving a whitening effect, and can be used to prepare products with whitening function.

[0173] Example 5: Investigation of melanin synthesis inhibition rate

[0174] This embodiment uses mouse melanoma cells B16 as the research object to determine the inhibitory effect of the recombinant type VII collagen of the present invention on melanin synthesis, thereby evaluating the whitening effect of the recombinant type VII collagen of the present invention.

[0175] The specific steps are as follows:

[0176] Blank control: Cell culture medium and cells without samples;

[0177] Positive control: 100 μg / mL α-arbutin;

[0178] Experimental groups: 0.01%, 0.03%, and 0.1% of recombinant type VII collagen 715 and 719.

[0179] B16 cells were fed at a rate of 1×10 4In 6-well cell culture plates, cells were seeded at a specific density and cultured for 24 hours. After removing the culture medium, the cells were washed with PBS and replaced with samples diluted with 1640 medium (containing 2% serum) at different concentrations. Each concentration was used in triplicate. After culturing in a cell incubator for 72 hours, the supernatant was discarded. 500 μL of trypsin was added to each well for 1-2 minutes of digestion, followed by the addition of complete culture medium to terminate the digestion. The cells were then mixed by pipetting, and the cell suspension was collected in centrifuge tubes. A small amount was taken for cell counting to ensure that the cell numbers in the blank control group, positive control group, and experimental group were similar, thus eliminating the difference in melanin content caused by differences in baseline cell numbers. This ensured that the melanin content of each experimental component was compared at the same or similar cell number level.

[0180] After digesting cells with 1 mL of trypsin, centrifuge at 3000 r / min for 10 min, discard the supernatant, add 1 mL of 1 mol / L NaOH aqueous solution containing 10% (v / v) DMSO, seal the centrifuge tube with sealing film, heat in an 80℃ water bath for 30 min, and measure the absorbance at 405 nm. The melanin synthesis inhibition rate is calculated as (1 - absorbance of sample group / absorbance of control group) * 100%.

[0181] The significance of the differences was analyzed by p-value using GraphPadPrism software. The t-test method was used to analyze the melanin synthesis inhibition rate of the blank control, positive control and experimental samples. The significance of the differences is shown in Figure 10.

[0182] As shown in Figure 10a, the melanin synthesis inhibition rate of the positive control was 36.58% ± 4.72%, which was significantly different from the blank control (P value 0.00017), indicating that the experimental system was effective. The melanin synthesis inhibition rate of recombinant type VII collagen 715 was 27.63% ± 9.64% at 0.01% of the test concentration, 35.41% ± 10.28% at 0.03% of the test concentration, and 45.33% ± 5.30% at 0.1% of the test concentration, all of which were higher than that of the blank control.

[0183] As shown in Figure 10b, the positive control (100 μg / mL α-arbutin) exhibited a melanin synthesis inhibition rate of 17.92% ± 10.37%, which was significantly different from the blank control (P = 0.04022), indicating the effectiveness of the experimental system. Recombinant type VII collagen 719 showed a melanin synthesis inhibition rate of 12.37% ± 6.45% at a 0.03% test concentration and 27.06% ± 7.02% at a 0.1% test concentration, both higher than the blank control, while showing no inhibitory effect on melanin synthesis at a 0.01% test concentration.

[0184] Therefore, the recombinant type VII collagen 715 described in this invention can inhibit melanin synthesis to achieve a whitening effect at the tested concentrations of 0.01%, 0.03%, and 0.1%, with significant differences marked in the figure. The 0.1% concentration showed the best inhibitory effect. 719 also showed an inhibitory effect on melanin synthesis at the tested concentrations of 0.03% and 0.1%, and compared with the blank control group, the 0.1% concentration had a significant inhibitory effect on melanin. Collagen 715 and 719 can inhibit melanin synthesis to achieve a whitening effect and can be used to prepare products with whitening functions.

[0185] Example 6: Detection of the antioxidant capacity of recombinant type VII collagen

[0186] DPPH free radicals are stable nitrogen-centered free radicals with a single electron. Their alcoholic solution is purple and exhibits strong absorption at 515 nm. In the presence of antioxidants, DPPH free radicals are scavenged, resulting in a lighter solution color and a decrease in absorbance at 515 nm. Within a certain range, the change in absorbance is directly proportional to the degree of free radical scavenging. DPPH free radicals are an important indicator of antioxidant capacity. This example investigated the DPPH free radical scavenging rate of recombinant type VII collagen to evaluate its antioxidant capacity. The specific investigation steps are as follows:

[0187] (1) Sample and reagent preparation:

[0188] Reagents were prepared according to the DPPH free radical scavenging ability assay kit (colorimetric method, purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number: D799007-0050). Recombinant type VII collagen 715 and 719 were prepared into sample solutions with concentrations of 5 mg / mL and 10 mg / mL using the extraction buffer provided with the kit.

[0189] Reagent 1: Anhydrous ethanol.

[0190] Reagent 2: (Place a 0.6 mL EP tube in an 8 mL reagent bottle) Add 6.08 mL of Reagent 1 and shake to dissolve before use.

[0191] Working solution: Prepare the working solution according to the required amount for the experiment, using the ratio of Reagent 2: Reagent 1 (V:V) = 4:21. Prepare and use immediately.

[0192] Reagent 3: 10 mg Vitamin C, store at 4°C. Add 1 mL of extract just before use, shake well to dissolve; prepare a 10 mg / mL Vitamin C solution for the positive control.

[0193] (2) Reagent addition:

[0194] Blank tube: 25 μL of extraction buffer plus 975 μL of working solution;

[0195] Experimental group: 25 μL of sample solution was added to 975 μL of working solution to obtain experimental groups of different concentrations of recombinant type VII collagen 715 and 719;

[0196] Positive control group: 5 mg / mL and 1 mg / mL vitamin C solutions were added to 975 μL of working solution;

[0197] Standard group: Vitamin C solutions with concentrations of 0.3, 0.25, 0.125, 0.0625, 0.03125, and 0.015625 mg / mL were prepared using the extract. 25 μL of each vitamin C solution was taken and mixed with 975 μL of the working solution to obtain the standard group.

[0198] (3) Detection:

[0199] Preheat the spectrophotometer for at least 30 minutes and adjust the wavelength to 515 nm. Add all the solution to the detection wells, mix well, and let stand at room temperature in the dark for 30 minutes. Measure the absorbance at 515 nm. Zero the sample with anhydrous ethanol before measurement; the blank tube only needs to be measured 1-2 times. The experimental results are shown in Table 1.

[0200] Table 1. DPPH free radical scavenging rate of recombinant type VII collagen

[0201]

[0202] As can be seen from Table 1, the main function of sequences 715 and 719 is whitening, with little effect on antioxidant properties. Compared with existing antioxidants such as vitamin C, small molecule collagen peptides are more multifunctional, synthesized in vitro using biotechnology, and have better biosafety and immunogenicity.

[0203] Example 7:

[0204] Under the experimental conditions of this embodiment, recombinant 715 and 719 collagen were used as samples to investigate the cytotoxicity of the recombinant type VII collagen described in this invention. Following the method provided in standard YY / T1849-2022 for recombinant collagen, the biological function of the recombinant type VII collagen was tested using mouse melanoma cells B16 (derived from C57BL / 6J mouse melanoma, catalog number: CM3076).

[0205] The specific investigation steps are as follows:

[0206] Blank control: Cell culture medium and cells without samples;

[0207] Positive control: 100 μg / mL α-arbutin;

[0208] Experimental groups: 0.01%, 0.03%, and 0.1% of recombinant type VII collagen 715 and 719.

[0209] (1) Test equipment and consumables

[0210] B16 (mouse melanoma cells), 1640 medium

[0211] 96-well cell culture plate, 6-well cell culture plate, microplate reader, CCK-8 reagent kit

[0212] (2) Test methods

[0213] Cytotoxicity assay: B16 cells were inoculated at 1×10⁻⁶. 4 The cells were seeded into 96-well cell culture plates at a specific density. After 24 hours, the plates were washed with PBS and the samples were replaced with different concentrations diluted with 1640 medium, with three replicates for each concentration. After 72 hours of cell culture, CCK-8 was added, and cytotoxicity was detected using a microplate reader at 450 nm. The results are shown in Figure 11.

[0214] CCK-8 assay results: Cell viability (%) = (As-Ab) / (Ac-Ab) × 100%

[0215] As is the absorbance of the sample to be tested, Ab is the absorbance of the blank sample group, and Ac is the absorbance of the negative sample group.

[0216] As shown in Figure 11, 715 and 719 at concentrations of 0.1%, 0.03%, and 0.01% had no effect on cell viability and their absorbance values ​​were similar to those of the positive control group, indicating no cytotoxicity. At concentrations of 0.03% and 0.01%, they promoted cell growth.

[0217] In summary, this invention has discovered recombinant type VII collagen with whitening effects through research, and used genetic engineering technology to increase the expression level of recombinant type VII collagen. The recombinant type VII collagen was expressed and produced using a Pichia pastoris expression system. The recombinant type VII collagen described in this invention is expressed in Pichia pastoris, can be efficiently secreted extracellularly, and is not easily degraded during purification, reducing the difficulty of purification. The recombinant type VII collagen has excellent whitening effects and is suitable for sensitive skin, without causing skin irritation, itching, or burning, demonstrating good practicality.

[0218] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A recombinant collagen type VII having whitening effect, characterized in that, The recombinant collagen VII contains binding sites of whitening sites; the whitening sites include one or more of MC1-R, MC4-R, GRM6, TRPM1 or MET. 2.The recombinant collagen VII with whitening effect according to claim 1, characterized in that, The recombinant collagen VII further contains binding sites of one or more of anti-aging, anti-wrinkle or soothing sites; The anti-aging, anti-wrinkle or soothing sites include one or more of TRPV1, IL1R1 or MT-CO2. 3.The recombinant collagen VII with whitening effect according to claim 1 or 2, characterized in that, The sequence of the recombinant collagen VII is as shown in i or ii: i, the amino acid sequence is as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 or SEQ ID No. 4; ii, a protein derived from i by substituting, deleting or adding one or more amino acids in the amino acid sequence of i and having human collagen activity.

4. A nucleic acid encoding the recombinant collagen type VII having whitening effect according to any one of claims 1 to 3, characterized in that, The nucleic acid sequence is as shown in SEQ ID No. 5-SEQ ID No.

8.

5. A recombinant expression vector, characterized in that, The recombinant expression vector contains the nucleic acid of claim 4.

6. A recombinant engineered bacterium, characterized in that, The nucleic acid of claim 4 or the recombinant expression vector of claim 4.

7. The recombineering bacteria of claim 6, wherein, The host cell of the recombinant engineering bacteria includes one of Pichia pastoris, Saccharomyces cerevisiae and Hansenula.

8. The recombineering bacteria of claim 7, wherein, The host cell is Pichia pastoris.

9. The recombineering bacteria of claim 8, wherein, The host cell is GS115-HCPB PPKEX2, and the preservation number is CGMCC No. 25815.

10. The recombineering bacteria of claim 6, wherein, The recombinant engineering bacteria are preserved in the China General Microbiological Culture Collection Center, and the preservation numbers are CGMCC No. 31991 and CGMCC No. 31992.

11. The method for preparing the recombinant collagen VII type having whitening efficacy according to any one of claims 1 to 3, characterized in that, The preparation method comprises: (1) selecting and designing the sequence of the recombinant collagen VII, and then constructing a collagen VII tandem sequence by using the recombinant collagen VII as a basic unit for tandem repetition; (2) constructing a recombinant plasmid for expressing the collagen VII tandem sequence, and linearizing the recombinant plasmid to obtain a linearized plasmid; (3) electrotransferring the linearized plasmid into a host cell, screening and verifying to obtain a high-copy recombinant engineering bacteria; (4) performing fermentation induction expression on the high-copy recombinant engineering bacteria, and then purifying to obtain the recombinant collagen VII.

12. The method of claim 11, wherein, In step (1), the recombinant collagen VII contains binding sites of whitening sites; the whitening sites include one of MC1-R, MC4-R, GRM6, TRPM1 or MET.

13. The method of claim 12, wherein, In step (1), the recombinant collagen VII contains binding sites of whitening sites. In step (1), the anti-aging, anti-wrinkle or soothing sites include one or more of TRPV1 or IL1R1.

14. The production method according to claim 12 or 13, characterized by, The sequence of the recombinant collagen VII is as shown in i or ii: i. the amino acid sequence is as shown in SEQ ID No. 1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4; ii. a protein derived from i by substituting, deleting or adding one or more amino acids in the sequence of i and having human collagen activity.

15. The method of claim 11, wherein, In step (1), the collagen tandem sequence comprises 8-10 basic units of recombinant collagen type VII, and a Kex2 enzyme or Ste13 enzyme recognition and cutting site between two adjacent basic units.

16. The method of claim 15, wherein, The recognition and cutting site comprises KR or RR double basic amino acid residues, and the double basic amino acid residues are followed by EA, EAEA or other amino acid residues that facilitate Kex2 enzyme or Ste 13 enzyme cutting.

17. The method of claim 11, wherein, In step (1), the nucleic acid of the collagen tandem sequence comprises the nucleotide sequence shown in SEQ ID No. 6 or SEQ ID No. 8, or a degenerate sequence thereof.

18. The method of claim 11, wherein, In step (2), the vector of the recombinant plasmid comprises pPICZαB, pFLDα, or pPIC9K, and the connection site is between XhoI and NotI.

19. The method of claim 18, wherein, The vector is pPIC9K.

20. The method of claim 11, wherein, In step (3), the host bacteria comprise one of Pichia pastoris, Saccharomyces cerevisiae, and Hansenula.

21. The method of claim 11, wherein, In step (3), the recombinant engineering bacteria are preserved in the China General Microbiological Culture Collection Center, and the preservation numbers are CGMCC No. 31991 and CGMCC No. 31992.

22. The recombinant collagen type VII prepared by the method of any one of claims 11-21.

23. The use of the recombinant collagen type VII of any one of claims 1-3 or the recombinant collagen type VII prepared by the method of any one of claims 11-21 in whitening, anti-aging, anti-wrinkle or soothing products.

24. A whitening, anti-aging, anti-wrinkle or soothing product, characterized in that, The products comprise the recombinant collagen type VII of any one of claims 1-3, or the collagen type VII encoded by the nucleic acid of claim 4, or the recombinant vector of claim 5, or the collagen type VII obtained by the method of any one of claims 11-21.