Multifunctional talaromyces fungus rb-2 for preventing and controlling ginger stem base rot and application thereof

Abstract

The application discloses a multifunctional talaromyces fungus RB-2 for preventing and controlling ginger stem base rot and an application thereof, and belongs to the technical field of microorganisms. The talaromyces fungus RB-2 is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20251722, and the preservation date is July 28, 2025. The application isolates and purifies a talaromyces strain RB-2 with the growth inhibition effect on pathogenic bacteria, the strain RB-2 has significant antagonistic activity on the pathogenic bacteria group Pythium aphanidermatum and various economic crop pathogenic bacteria, and has the potential to be developed into a biocontrol agent. The talaromyces strain RB-2 has the abilities of dissolving phosphorus and promoting growth, can significantly promote the growth of ginger, has the potential to prepare a soil conditioner and a microbial fertilizer, and can improve the soil microecology and enhance the crop productivity.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a multifunctional basidiomycete fungus RB-2 for controlling stem base rot in ginger and its applications. Background Technology

[0002] Ginger (Zingiber officinale Roscoe) is an important and efficient economic crop with high yields and good economic benefits, and has become an important industry for promoting rural revitalization. As a plant with both medicinal and edible uses, ginger is not only a widely used condiment, but also a commonly used medicinal material in traditional Chinese medicine, possessing various biological activities such as anti-oxidation, anti-cancer, anti-inflammatory, and antibacterial properties.

[0003] With increasing years of continuous cropping, excessive application of nitrogen fertilizer during ginger cultivation can easily lead to soil acidification, exacerbating soil-borne diseases. Ginger stem base rot, commonly known as "ginger neck rot," is a common and serious soil-borne fungal disease in ginger production. This disease mainly infects the base of the ginger stem and underground rhizomes, causing the plant to wilt, die, and even rot completely. The incidence rate in the field can reach 30%-70%, and severely affected fields may even experience total crop failure, resulting in significant economic losses.

[0004] Stem base rot pathogens can be transmitted through ginger seed and soil, making control difficult and becoming a key factor restricting the sustainable development of the ginger industry. Currently, chemical pesticides are commonly used for control, but long-term and excessive use of pesticides not only leads to increased drug resistance in pathogens but also pollutes water, air, and soil ecosystems. Some pesticide residues can also enter the human body through the food chain, endangering health.

[0005] Biological control is a rapidly developing green pest control strategy in recent years, mainly using beneficial microorganisms to inhibit the growth and spread of pathogens. Currently reported biocontrol bacteria include *Bacillus tequilensis*, *B. subtilis*, and *Aspergillus niger*. However, ginger stem rot is often caused by multiple pathogens, including *Pythium* spp. and *Fusarium* spp., and the dominant pathogens vary across different regions. Most reported biocontrol bacteria only have single growth-promoting or antagonistic functions, and are often specific to certain pathogens. Multifunctional strains with both growth-promoting and broad-spectrum antagonistic functions are still scarce, making it difficult to meet the needs of green agriculture development. Summary of the Invention

[0006] The purpose of this invention is to provide a multifunctional *Basilaria* fungus RB-2 for controlling ginger stem base rot and its applications, thereby addressing the problems existing in the prior art. This invention isolates and purifies a *Basilaria* strain RB-2 with inhibitory effects on pathogen growth. This strain RB-2 exhibits significant antagonistic activity against *Pythium spp.*, the pathogen causing ginger stem base rot, and various pathogens affecting economic crops, demonstrating its potential for development into a biocontrol agent. Furthermore, the *Basilaria* strain RB-2 of this invention possesses phosphorus-solubilizing and growth-promoting abilities, significantly promoting ginger growth and possessing the potential to prepare soil conditioners and microbial fertilizers to improve soil microecology and enhance crop productivity.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a multifunctional genus of fungus, *Talaromycesliani* RB-2, for the control of stem base rot in ginger. The fungus RB-2 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCCNO: M20251722 and deposit date of July 28, 2025.

[0009] The present invention also provides the application of the above-mentioned Basilaria genus fungus RB-2 in the preparation of biocontrol agents.

[0010] The present invention also provides a biocontrol agent comprising the above-mentioned *Basilaria* fungus RB-2, mycelium, conidia, ascospores and / or its fermentation products.

[0011] The present invention also provides the application of the above-mentioned *Basilaria* fungus RB-2 or the above-mentioned biocontrol agent in inhibiting the growth of pathogens, wherein the pathogens include *Pythium myriotylum*, *Colletotrichum spp.*, *Fusarium graminearum*, *Fusarium oxysporum*, *Stagonosporopsis pogostemonis*, and *Colletotrichum gloeosporioides*.

[0012] The present invention also provides the application of the above-mentioned Basilaria genus fungus RB-2 or the above-mentioned biocontrol agent in the prevention and control of plant diseases.

[0013] Furthermore, the plant diseases include ginger stem base rot, pepper anthracnose, corn stem base rot, ginger wilt, Sichuan pepper leaf spot, and tea anthracnose.

[0014] The present invention also provides a method for preventing and controlling plant diseases, comprising the step of applying the above-mentioned *Basilaria* fungus RB-2 or the above-mentioned biocontrol agent to plants; the plant diseases include ginger stem base rot, pepper anthracnose, corn stem base rot, ginger wilt, Sichuan pepper leaf spot, and tea anthracnose.

[0015] Optionally, the method of application includes root drenching.

[0016] The present invention also provides the application of the above-mentioned Basilaria genus fungus RB-2 or the above-mentioned biocontrol agent in promoting plant growth.

[0017] The present invention also provides the application of the above-mentioned Basilaria genus fungus RB-2 or the above-mentioned biocontrol agent in soil phosphorus dissolution.

[0018] The present invention discloses the following technical effects:

[0019] This invention isolates and purifies a *Colletotrichum* strain RB-2 that inhibits the growth of pathogens. Strain RB-2 exhibits significant antagonistic activity against *Pythium myriotylum*, the pathogen causing stem rot in ginger. It also shows strong inhibitory effects on various economic crop pathogens, including *Colletotrichum gloeosporioides* (tea anthracnose), *Colletotrichum spp.* (pepper anthracnose), *Fusarium graminearum* (corn stem rot pathogen), *Fusarium oxysporum* (ginger wilt pathogen), and *Stagonosporopsis pogostemonis* (Sichuan pepper leaf spot pathogen), demonstrating its potential for development into a biocontrol agent. Furthermore, strain RB-2 possesses phosphorus-solubilizing and growth-promoting abilities, significantly enhancing ginger growth and showing potential for preparing soil conditioners and microbial fertilizers to improve soil microecology and enhance crop productivity. The strains of this invention have multiple functions, including inhibiting pathogens, dissolving phosphorus in soil, and promoting crop growth, providing an environmentally friendly microbial resource and solution for agricultural production. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1The inhibitory effect of strain RB-2 on plant pathogens is shown in Figure A. In this figure, A represents the antagonistic effect of RB-2 on six plant pathogens during plate confrontation culture, and B represents the antagonistic effect of RB-2 fermentation broth on six plant pathogens.

[0022] Figure 2 A multigene phylogenetic tree constructed based on the ITS, Rpb2, and BenA sequences of strain RB-2; T denotes the type strain, and the scale bar is 0.05 per nucleotide substitution rate.

[0023] Figure 3 Images show the plate colony diagram and microscopic morphology of strain RB-2; where A is the colony morphology on a PDA plate; B is the morphology of the reverse side of the colony; C is the hyphae under a microscope; D is the immature ascocarp under a microscope; E is the ascocarp and released ascospores under a microscope; F is the ascospores under a microscope; GH is the conidiophores under a microscope; I is the conidia under a microscope; CI is a scale bar of 50 μm.

[0024] Figure 4 The potted plant control effect of strain RB-2 against the pathogen of ginger stem rot;

[0025] Figure 5 The growth-promoting effect of strain RB-2 on ginger;

[0026] Figure 6 The image shows the phosphate-solubilizing zone of strain RB-2 on a plate; where AB represents the front and back sides of the inorganic phosphorus medium, and CD represents the front and back sides of the organic phosphorus medium. Detailed Implementation

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0029] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0030] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0031] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0032] Example 1: Isolation, purification, and identification of strain RB-2

[0033] 1. Materials and Methods

[0034] 1.1 Test pathogens

[0035] The pathogenic fungus *Pythium myriotylum*, which causes stem rot in ginger, was donated by Professor Lü Yao of Shandong Agricultural University. *Colletotrichum spp.*, the pathogenic fungus of *F. graminearum*, and the pathogenic fungus of *F. graminearum*, both pathogenic fungi of stem rot in pepper, were donated by the laboratory of Researcher Wu Shiping of the Institute of Plant Protection, Guizhou Academy of Agricultural Sciences. *F. oxysporum*, the pathogenic fungus of *S. pogostemonis*, and *C. gloeosporioides*, the pathogenic fungus of *C. gloeosporioides*, were isolated and identified by the Guizhou Provincial Key Laboratory of Agricultural Microbiology.

[0036] 1.2 Tested ginger varieties

[0037] The ginger variety "Qianjiang No. 2" was bred by the Spice Research Group of the Guizhou Provincial Oil Crops Research Institute.

[0038] 1.3 Culture medium formulation

[0039] Potato Dextrose Agar (PDA) (g / L): Wash 200g of potatoes, cut them into pieces, cook them, and filter them. Add 20g of glucose and 15g of agar powder to distilled water to a final volume of 1000mL. Sterilize at 115℃ for 20min. The pH should be left to stand at room temperature.

[0040] Potato Dextrose Broth (PDB) (g / L): Wash 200g of potatoes, cut them into pieces, cook them, filter them, add 20g of glucose, add distilled water to make up to 1000mL, sterilize at 115℃ for 20min, and leave the pH at its natural setting.

[0041] V8 fruit juice medium: Take 200 mL of distilled water, add 6 g of agar, and autoclave at 121℃ for 15 min. In a clean bench, take 200 mL of V8 fruit juice medium (2× solution) and heat in a water bath at 50-60℃ for 30 minutes. Mix the two solutions thoroughly and pour into petri dishes promptly.

[0042] Inorganic phosphorus medium (g / L): 10g glucose, 0.5g (NH4)2SO4, 0.3g NaCl, 0.3g KCl, 0.3g MgSO4, 0.03g MnSO4, 0.03g FeSO4·7H2O, 0.5g yeast extract, 3g Ca3(PO4)2, 15g agar powder, add distilled water to a final volume of 1000mL, pH 6.8-7.0. Sterilize at 121℃ for 20min before use.

[0043] Organic phosphorus medium (g / L): 10g glucose, 0.5g (NH4)2SO4, 0.3g NaCl, 0.3g KCl, 0.3g MgSO4, 0.03g MnSO4, 0.03g FeSO4·7H2O, 0.4g yeast extract, 0.2g lecithin, 5g CaCO3, 15g agar powder, add distilled water to a final volume of 1000mL, pH 7.0-7.2. Sterilize at 121℃ for 20min before use.

[0044] 2. Experimental Methods

[0045] 2.1 Collection of rhizosphere soil

[0046] Rhizosphere soil samples were collected from the ginger planting base of the Guizhou Provincial Oilseed Research Institute in Jinzhu Town, Guiyang City, Guizhou Province (latitude and longitude: 26°30'18"N", 106°39'15"E) on August 10, 2023. The "five-point sampling method" was used to collect the ginger rhizosphere soil. Sampling points were set near the roots of the plants. After removing the top 2-5cm of soil, approximately 200 grams of soil from around the plant roots was collected, mixed, and placed in a sterile sampling bag. The collected soil samples were brought back to the laboratory and stored at 4°C for later use.

[0047] 2.2 Isolation of rhizosphere microorganisms

[0048] (1) Weigh 10g of ginger rhizosphere soil and put it into a conical flask containing 90mL of sterile distilled water with glass beads to prepare a soil suspension. Place it in a shaker (150r / min, room temperature) and shake for 20min. After the suspension is completed, let it stand for 1min.

[0049] (2) Prepare a graded dilution suspension of soil, and use sterile distilled water to dilute the soil suspension to a concentration of 10. -2 10 -3 10 -4 10 -5 .

[0050] (3) Preparation of PDA plates: Add 100 μL of kanamycin and 200 μL of streptomycin to each 200 mL of PDA medium after cooling to about 50°C. Take 100 μL of each diluted suspension and spread it onto the PDA medium. After drying, seal and number the plates. Then, incubate them in a 28°C incubator for 3-5 days. After the colonies grow, purify them 2-3 times and preserve the purified strains.

[0051] 2.3 Antagonism Test

[0052] 2.3.1 Flat Plate Standoff Test

[0053] The experimental strains to be tested were inoculated onto PDA culture plates for activation. After incubation at 28°C for 7 days, pathogenic bacteria and test bacterial cakes were taken separately using a punch. Pathogenic bacteria were inoculated at the center of the culture medium, and test strains were inoculated at two equidistant points 2 cm away from the pathogen (two-point confrontation method). A control group with only pathogenic bacteria inoculated was also set up. Each group had 3 replicates. The culture was placed at 28°C for 7 days. After incubation, the colony diameter of the pathogenic bacteria was measured (Pythium spp. was cultured for 3 days), and the inhibition rate was calculated.

[0054] Inhibition rate (%) = (Coronavirus colony diameter of control pathogen - Coronavirus colony diameter of treated pathogen) / (Coronavirus colony diameter of control pathogen) × 100%.

[0055] 2.3.2 Fermentation broth antagonism test

[0056] The test strain was inoculated onto PDA medium and cultured for approximately 6 days. Three 5mm diameter mycelial discs were taken from the confluent culture plate and inoculated into 200 mL of PDB liquid medium. The plates were then shaken at 28°C and 200 rpm for 5 days. Spores and mycelia were removed by filtration through eight layers of sterile gauze. The supernatant was then filtered through a 0.22 μm filter membrane to obtain a sterile fermentation filtrate. 10 mL of the sterile filtrate of the test strain was added to 90 mL of PDA medium cooled to approximately 50°C, mixed thoroughly, and poured onto plates. The pathogen was inoculated into the center of the plate and incubated at 28°C for 6 days (including 3 days for *Pythium spp.*). The colony radius of the pathogen was measured using the cross-hatching method to calculate its antibacterial effect. Data were processed using WPS software, and DPS analysis was used to analyze the significance of differences between different treatments.

[0057] 2.4 Classification and identification of the test strains

[0058] (1) DNA extraction: After the activated experimental strain has grown to cover the culture plate, the hyphae are scraped off with a sterile scalpel and collected into a sterile centrifuge tube. Genomic DNA is extracted using the 2% CTAB method.

[0059] (2) PCR amplification: including amplification of the ribosomal RNA transcriptional spacer region (ITS), the β-tubulin gene (BenA), and the second large subunit of RNA polymerase II (RPB2) gene.

[0060] The PCR reaction system (25 μL) consisted of: 12.5 μL of 2×Taq Master Mix (Beijing Kangrun Chengye Biotechnology Co., Ltd.), 1 μL of DNA template, 1 μL each of forward and reverse primers (primer sequences are shown in Table 1), and 9.5 μL of ddH2O.

[0061] The PCR amplification conditions for ITS and BenA genes were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.

[0062] The PCR amplification conditions for the RPB2 gene were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 45 s, 72℃ extension for 2 min, 30 cycles; 72℃ extension for 10 min.

[0063] After the amplification products were detected by 1.2% agarose gel electrophoresis, they were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0064] Table 1. Related genes and primer sequences

[0065]

[0066] (3) The sequencing results were compared with the ITS sequences in NCBI's GenBank. Strains with high sequence similarity were selected as reference sequences. BioEdit software was used for sequence alignment and manual correction. The processed data were compared with the sequencing sequences using MEGA6.0 software and the molecular phylogenetic tree was constructed using the Neighbor-Joining Tree method.

[0067] (4) Morphological observation: The strains isolated above were transferred to PDA medium and inserted into sterilized coverslips at 45° using the slide insertion method. The strains were then placed in a constant temperature incubator at 28°C for 3-7 days. The colony morphology was observed, and the sporulation structure, spore morphology and size, hyphae morphology, etc., were observed under a microscope. The classification status was determined by combining the results of molecular systematics.

[0068] 3. Experimental Results

[0069] 3.1 Antagonism Test Results

[0070] A bacterial strain, named RB-2, was isolated and purified from the rhizosphere soil of a ginger planting base in Guizhou Province. Plate antagonism tests showed that strain RB-2 exhibited inhibition rates of 87.78%, 76.64%, 67.74%, 81.26%, 80.89%, and 80.67% against the pathogens of ginger stem base rot, Sichuan pepper leaf spot, ginger wilt, tea anthracnose, corn stem base rot, and pepper anthracnose, respectively (see Table 2). Figure 1 The antagonistic experiment results of the fermentation broth of strain A showed that the inhibition rates against the above six pathogens were 71.85%, 30.32%, 32.44%, 30.40%, 26.66%, and 37.78%, respectively (Table 3 and). Figure 1 (B).

[0071] Table 2. Inhibitory effect of RB-2 strain on pathogens in plate confrontation culture.

[0072]

[0073] Table 3. Inhibitory effect of fermentation broth of strain RB-2 on pathogens.

[0074]

[0075] 3.2 Molecular biological identification results of strain RB-2

[0076] 3.2.1 Sequencing sequence of RB-2 strain

[0077] RB-2ITS sequence, SEQ ID NO.7:

[0078] TCGAGTGCGGGTCCTCGCGGCCCACCTCCCACCCTTGTCTCCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCGCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCG CCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCACATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAAGGCGGGAGGAAAAAAAGCCGGA。

[0079] RB-2 BenA sequence, SEQ ID NO.8:

[0080] ATTGTCGCGACAACACGCTGACTTTTCCAGGCAAATCATCTCTGCTGAGCACGGTCTCGATGGCTCTGGTGTGTAAGTATTGCACGATTCGACTCCAGCTACGATCCGACGATATCTGATAATCAACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGTGCGTCAACCAATCCATCGTATAAACGGAACAAAGCTCATACTGGTGTAGGCCTCCGGCAACAAATACGTTCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCTGGTCCCTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCATAACCTTTAAGG。

[0081] RB-2 RPB2 sequence, SEQ ID NO.9:

[0082] CAGTCGATACACCTTTGCCTCTACTTTGTCTCATTTAAGACGTACCAATACGCCTATTGGCCGTGATGGGAAAATCGCCAAGCCTCGTCAGCTACATAACACTCACTGGGGTCTGGTTTGTCCTGCCGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAAAACTTGGCTTTGATGTGTTCTATCACTGTGGGTTCTCCTAGCGAGCCTATTGTTGATTTCATGATTCAACGAAACATGGAAGTGCTTGAAGAATTCGAACCGCTAGTTACACCTCATGCCACTAAGGTCTTTGTCAATGGTGTTTGGGTTGGTGTGCATCGTGACCCGGCTCATTTGGTCAGCACTGTCCAGTCACTACGCCGACGGAATATGATTTCCCACGAAGTCAGCTTAGTTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTTTGTCGACCACTTTTCGTCATTGACAACGATCCACGAAGTGAAAACTGCGGATCTTTGGTGCTCAACAAAGACCATATTCGCAGACTTGAAGCAGACCGCGAGCTTCCACCAGACCTCGACCCCGAAGAACGAAGAGAACAGTACTACGGCTGGGAGGGTCTCGTCAAATCGGGAGTCATTGAGTATGTTGATGCTGAAGAGGAGGAAACCATTATGATTGCCATGTCTCCGGAAGATCTCGAAATTTCAAAACAACTACAAGCCGGTTATGCTCTGCCTGAGGACAACAGTGATCCGAATAAGCGTGTCCGGTCTGTTCTGAGTCAGCGGGCGCATATCTGGACTCACTGCGAAATTCACCCAAGTATGATTCTTGGTATTTGCGCCAGTATCATTCCATTCCCCGATCAC。

[0083] 3.2.2 Molecular phylogenetic identification results

[0084] The ITS, BenA, and RPB2 sequences of strain RB-2 were aligned using NCBI. The results showed high sequence similarity to some species in *Talaromyces*. Therefore, sequences from closely related *Talaromyces* species were selected (see Table 4). After alignment of ITS, BenA, and RPB2 sequences, they were assembled, and a phylogenetic tree was constructed using the neighbor-joining tree method (see Table 4). Figure 2 The results showed that strain RB-2 clustered into a single branch with the standard strains of *Talaromyces liani*, CBS225.66 and *T. liani NRRL 1009, with 99% support. Morphological observation revealed that after 7 days of cultivation in PDA medium, RB-2 colonies were golden yellow with a diameter of 67-69 mm. Microscopic observation showed that its hyphae were septate and produced a large number of yellow ascocarps. The ascospores were elliptical or nearly spherical, and the conidiophores were mostly arranged in single or double whorls. The conidia were elliptical (see...). Figure 3 Based on a combination of polygenic systematics and morphology, RB-2 was identified as a fungus of the genus *Talaromyces liani*.

[0085] The strain RB-2 (Talaromyces liani) was deposited at the China Center for Type Culture Collection (CCTCC) on July 28, 2025, with accession number CCTCC NO: M 20251722, at Wuhan University, Wuhan, China.

[0086] Table 4. Close relatives of the genus *Basilaria* used in the phylogenetic analysis and their GenBank numbers.

[0087]

[0088]

[0089] Example 2: Functional verification of strain Talaromyces lianiRB-2

[0090] 1. Test Methods

[0091] 1.1 Indoor potted disease control experiment of ginger seedlings

[0092] (1) Place ginger seeds in a biochemical incubator at 25℃ and 90% relative humidity to germinate. After germination, sow them in flower pots with an upper diameter of 15cm, a bottom diameter of 10.5cm, and a height of 12.5cm. The potting substrate is 1 / 4 peat moss + 1 / 4 cow manure + 1 / 2 original soil. Mix them evenly and then fill the pots with one seedling per pot. Place them in a greenhouse with natural light and water them once every 2 days. After 60 days of growth, select ginger seedlings with uniform growth for inoculation experiments.

[0093] (2) Preparation of Pythium spore suspension

[0094] Using a punch, a 5mm mycelial cake was taken from the edge of a activated *Pythium spp.* colony and inoculated onto a V8 juice agar plate. The plate was incubated at 28°C for 7 days. The spores were then filtered through gauze to prepare a spore suspension. Spores were counted using a hemocytometer, and the concentration of the spore suspension was adjusted to 1×10⁻⁶ with sterile water. 7 cfu / mL.

[0095] (3) Preparation of biocontrol bacteria

[0096] From the edge of a purified 5-day cultured biocontrol bacterium RB-2 colony, use a sterile punch to create 5mm diameter mycelial discs. Inoculate these discs into PDB medium at a rate of 1-3 5mm diameter discs per 100mL of medium. Incubate at 28℃ with shaking at 180rpm for 7 days. Afterward, break up the mycelia, mix thoroughly, and adjust the bacterial suspension concentration to 1×10⁻⁶ using PDB medium. 5 cfu / mL.

[0097] (4) Inoculation trial

[0098] Treatment Group 1 (Pathogen Group): Ginger seedlings were pricked at the base of the stem to create uniform wounds, and 500 μL of a 1×10⁻⁶ solution was injected. 7 A suspension of Pythium spores at cfu / mL was prepared, and 50 mL of sterile PDB liquid culture medium was simultaneously poured into the roots of ginger seedlings.

[0099] Treatment group 2 (pathogen + RB-2 group): 500 μL of a 1×10⁻⁶ concentration was injected by needle pricking the base of the ginger seedling stem. 7 A suspension of *Pythium spores* at cfu / mL was administered, along with 50 mL of a 1×10⁻⁶ solution at the base of ginger seedlings. 5 CFU / mL biocontrol bacterial solution;

[0100] Control group (CK): 500 μL of sterile water was injected into the base of the ginger seedling stem by needle, and 50 mL of PDB liquid culture medium was poured into the roots of the ginger seedling at the same time.

[0101] Each treatment consisted of 10 replicates. After inoculation, routine cultivation and management were carried out. The disease status of ginger seedlings was photographed and recorded 15 days after inoculation.

[0102] Disease severity index (DSI) statistics were performed according to the method of Liu Zhenwei et al. (2012). Disease incidence was recorded starting when the first diseased plant appeared. Disease severity grading standards: Grade 0, healthy plants with good growth and no diseased plants; Grade 1, 1-2 leaves turn yellow and wilt; Grade 2, 1 / 3 of the leaves of the whole plant wilt; Grade 3, 1 / 2 of the leaves of the whole plant wilt; Grade 4, 3 / 4 of the leaves of the whole plant wilt; Grade 5, the whole plant wilts or dies.

[0103] DSI = ∑(disease level × number of plants at that level) / (number of plants tested × highest representative value) × 100, disease incidence (%) = number of diseased plants / total number of plants × 100.

[0104] Disease prevention effect = (disease index of control group - disease index of treatment group) / disease index of control group × 100.

[0105] 1.2 Strains' growth promotion test

[0106] Ginger seedlings with uniform growth were selected for a growth-promoting experiment. Mycelial cakes of the biocontrol bacterium RB-2, activated on solid PDA medium, were inoculated into liquid PDB medium at a rate of 1-3 5mm diameter cakes per 100mL of medium. The cakes were then cultured on a shaker at 180 rpm and 28℃ for 7 days. The bacterial concentration was adjusted to 1×10⁻⁶ using PDB medium. 5 CFU / mL was kept on hand. The biocontrol bacteria fermentation liquid was applied to the roots of ginger seedlings using the root irrigation method, with 50 mL of biocontrol bacteria fermentation liquid applied to each seedling. An equal volume of uninoculated sterile PDB medium was applied to the roots as a control group (CK). After 30 days of routine planting and management, photos were taken and relevant indicators were measured.

[0107] 1.3 Determination of Phosphate Solubilization Ability of Strains

[0108] The fungi to be tested were inoculated onto inorganic phosphorus and organic phosphorus culture plates using the plate assay method, with five replicates for each medium. The plates were incubated at 28°C inverted for 7 days. The diameter of the colony (d) and the diameter of the phosphate-solubilizing zone (D) were determined using the cross-cross method, and the phosphate-solubilizing index (SPI) was calculated.

[0109] SPI = Diameter of phosphate lysate zone (D) / Diameter of colony (d).

[0110] 2. Test Results

[0111] 2.1 Potted plant control efficacy of strain RB-2 against ginger stem rot pathogen

[0112] The results are shown in Table 5 and Figure 4 Compared with the control group, strain RB-2 significantly reduced the disease index of ginger and achieved a disease prevention effect of 82.76% against ginger stem rot pathogen, demonstrating a significant control effect. This indicates that strain RB-2 has a good inhibitory effect on ginger stem rot pathogen.

[0113] Table 5. Results of pot experiment on the control efficacy of strain RB-2 against the pathogen causing ginger stem rot.

[0114] Group Disease incidence rate (%) Disease severity index (%) Disease prevention effect (%) CK 0 0 - Pathogens 60 58 - Pathogen + RB-2 10 10 82.76

[0115] 2.2 Growth-promoting effect of strain RB-2 on ginger

[0116] The results are shown in Table 6 and Figure 5 Compared with the control group, the root irrigation treatment group of strain RB-2 showed an increase of 28.20% in plant height, 100% in the number of branches, 20.91% in the number of leaves on the main stem, 35.31% in the diameter of the main stem, 40.45% in the weight of stems and leaves, 85.39% in the weight of roots, and 40.45% in the weight of ginger rhizomes. Compared with the control group, all other indicators of ginger rhizomes in the treatment group were significantly different (P<0.05), and the growth promotion rate of fresh ginger weight reached 43.74%±1.5663%.

[0117] Table 6 Effects of strain RB-2 on ginger growth

[0118] index CK control group RB-2 treatment group Compared to CK Plant height (cm) 30.5±3.06 <![CDATA[39.1±2.88 ** ]]> +28.20％ Number of branches 1±0.32 <![CDATA[2±0.67 ** ]]> +100％ Number of leaves on the main stem 8.6±0.52 <![CDATA[10.5±0.85 ** ]]> +22.09％ Main stem diameter (mm) 4.83±0.55 <![CDATA[5.84±0.76 ** ]]> +20.91％ Stem and leaf weight (g) 7.08±1.80 <![CDATA[9.58±1.06 * ]]> +35.31％ Weight of ginger (g) 4.4±1.50 6.18±1.54 +40.45％ Root weight (g) 1.78±0.30 <![CDATA[3.3±0.9 ** ]]> +85.39％

[0119] 2.3 Determination of Phosphate Solubilization Ability of Strains

[0120] After culturing for 7 days in inorganic and organic phosphorus media using the plate assay, the phosphorus solubility index (SPI) of strain RB-2 reached 1.1 and 1.2, respectively (see plate assay). Figure 6 This indicates that it has a high phosphorus solubility and the potential to improve soil fertility and promote plant growth.

[0121] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A versatile *Basilaria* fungus used to control stem base rot in ginger ( Talaromyces liani RB-2, characterized in that, The fungus RB-2 of the genus *Basilaria* is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20251722 and deposit date of July 28, 2025. The fungus RB-2 of the genus *Basilaria* has an inhibitory effect on the growth of pathogens, including... Pythium myriotylum , Colletotrichum spp .、 Fusarium graminearum , Fusarium oxysporum , Stagonosporopsis pogostemonis and Colletotrichum gloeosporioides .

2. The application of the *Basilaria* fungus RB-2 as described in claim 1 in the preparation of biocontrol agents, characterized in that, The biological agent can inhibit pathogens. Pythium myriotylum , Colletotrichum spp .、 Fusarium graminearum , Fusarium oxysporum , Stagonosporopsis pogostemonis and Colletotrichum gloeosporioides The growth of.

3. A biocontrol agent, characterized in that, The biocontrol agent contains the *Basilaria* fungus RB-2 as described in claim 1, mycelium, and / or fermentation products containing the *Basilaria* fungus RB-2.

4. The application of the *Basilaria* fungus RB-2 as described in claim 1 or the biocontrol agent as described in claim 3 in inhibiting the growth of pathogenic bacteria, characterized in that... The pathogens include Pythium myriotylum , Colletotrichum spp .、 Fusarium graminearum , Fusarium oxysporum , Stagonosporopsis pogostemonis and Colletotrichum gloeosporioides .

5. The application of the *Basilaria* fungus RB-2 as described in claim 1 or the biocontrol agent as described in claim 3 in the control of plant diseases, characterized in that, The plant diseases mentioned include ginger stem base rot, pepper anthracnose, corn stem base rot, ginger wilt, Sichuan pepper leaf spot, and tea anthracnose.

6. A method for preventing and controlling plant diseases, characterized in that, The method includes the step of applying the fungus RB-2 of the genus *Basilaria* as described in claim 1 or the biocontrol agent as described in claim 3 to plants; the plant diseases include ginger stem base rot, pepper anthracnose, corn stem base rot, ginger wilt, Sichuan pepper leaf spot, and tea anthracnose.

7. The method according to claim 6, characterized in that, The application method includes root irrigation.

8. The application of the *Basilaria* fungus RB-2 as described in claim 1 or the biocontrol agent as described in claim 3 in promoting plant growth, characterized in that, The plant is ginger.

9. The application of the *Basilaria* fungus RB-2 as described in claim 1 or the biocontrol agent as described in claim 3 in soil phosphorus dissolution.

Images