RNAi reagents for inhibiting ataxia protein-2 (ATXN2) expression, compositions and methods of use thereof

By designing specific RNAi reagents, the problem of neuronal degeneration caused by ATXN2 protein amplification in SCA2 was solved, achieving selective inhibition of the ATXN2 gene and providing an effective method for treating SCA2 and ALS.

CN121127589APending Publication Date: 2025-12-12ARROWHEAD PHARMACEUTICALS INC
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202480032439.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-03-17
Filing Date
2024-03-15
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

There is currently no effective treatment for spinocerebellar ataxia type 2 (SCA2), and the polyglutamine bundle amplification of the ATXN2 protein leads to neuronal degeneration and cell death. There is also a lack of RNAi reagents that can selectively inhibit ATXN2 gene expression.

Method used

Specific RNAi reagents, including sense and antisense strands ranging from 15 to 49 nucleotides in length, were developed. These reagents are complementary to the ATXN2 gene and inhibit ATXN2 gene expression in vitro and in vivo through RNA interference mechanisms, thereby reducing ATXN2 protein expression. They are then delivered to central nervous system cells using pharmacokinetic modulators.

Benefits of technology

It achieves selective and effective inhibition of ATXN2 gene expression, reduces ATXN2 protein, provides a therapeutic approach for SCA2 and other neurodegenerative diseases such as ALS, and reduces disease symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_4
    Figure SMS_4
  • Figure SMS_5
    Figure SMS_5
Patent Text Reader

Abstract

RNAi agents, compositions including the RNAi agents, and methods for inhibiting the ataxia protein-2 (ATXN2) gene are described. The ATXN2 RNAi reagents and RNAi reagent conjugates disclosed herein inhibit the expression of the ATXN2 gene. Also described are pharmaceutical compositions comprising one or more ATXN2 RNAi agents, optionally in conjunction with one or more additional therapeutic agents. The delivery of the ATXN2 RNAi agents to the central nervous system (CNS) tissue in vivo provides inhibition of ATXN2 gene expression and reduction of ATXN2 activity, which can provide therapeutic benefits to subjects, including human subjects, for the treatment of various diseases, including spinal cerebellar ataxia type 2 (SCA2) or amyotrophic lateral sclerosis (ALS).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references to related applications This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 490,866, filed March 17, 2023, the contents of which are incorporated herein by reference in their entirety.

[0002] sequence list This application contains a sequence list that has been submitted in XML format and is incorporated herein by reference in its entirety. The XML copy is named 30701-WO_SEQLIST.xml, created on March 7, 2024, and is 5257 kb in size. Invention Field

[0003] This disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents, compositions including ATXN2 RNAi agents, for inhibiting the expression of the ataxia protein-2 (“ATXN2”) gene, and methods of using the same. Background of the Invention Spinocerebellar ataxia type 2 (SCA2) is an autosomal dominant neurodegenerative disease caused by factors primarily affecting the cerebellum. ATXN2 CAG repeat amplification in exon 1 of the gene causes this. CAG repeat amplification leads to polyglutamine bundle expansion and toxic gain of function in the ATXN2 protein (Scoles & Pulst, 2018). SCA2 is characterized by progressive ataxia with a 10-year survival rate of 73% (Diallo et al., 2018). The ATXN2 gene typically contains 22 or fewer CAG repeats, but in individuals with SCA2, the number of CAG repeats in the ATXN2 gene is amplified to 33 or more. The amplified CAG repeats generate polyglutamine (poly-Q) bundle expansion in the ATXN2 protein, which leads to toxic gain of function, particularly in neuronal populations crucial for motor control and coordination, causing cell dysfunction and death. The cerebellum, a brain region that plays a key role in motor coordination, is particularly affected in SCA2. Progressive neuronal degeneration in the cerebellum and brainstem results in characteristic symptoms of SCA2, including ataxia, dysarthria, and oculomotor abnormalities. The exact mechanism by which the amplified ATXN2 protein induces cell death is under investigation, but it may involve disruption of RNA metabolism. Ataxia-protein-2 (SCA2) is a protein encoded by the ATXN2 gene. Mutations in the ATXN2 gene are known to cause SCA2 in humans. SCA2 is a progressive, degenerative disease that is often fatal and currently has no available treatment. Patients affected by SCA2 may experience progressive cerebellar ataxia, slow saccadic eye movements, and other neurological symptoms such as neuropathy.

[0005] ATXN2 CAG expansions are also associated with Parkinson's disease and amyotrophic lateral sclerosis (ALS), which can be indistinguishable from the idiopathic forms of these diseases. Because of the role of ATXN2 in SCA2 and other neurodegenerative disorders, there is a need for therapeutic compounds that can inhibit ATXN2 expression in humans. SUMMARY There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents, that are capable of selectively and effectively inhibiting expression of the ATXN2 gene, including use as therapeutic or pharmaceutical agents. Further, there is a need for novel compositions of ATXN2-specific RNAi agents for treating diseases or disorders associated with mutant ATXN2 expression and / or disorders that can be at least partially mediated by a reduction in ATXN2 gene expression and / or ATXN2 protein expression.

[0007] The nucleotide sequences and chemical modifications of the ATXN2 RNAi agents disclosed herein, and their combination with certain specific pharmacokinetic and pharmacodynamic (PK / PD) modulators suitable for selective and effective delivery of the ATXN2 RNAi agents to relevant CNS cells in vivo, are different from those previously disclosed or known in the art. The ATXN2 RNAi agents disclosed herein provide highly potent and effective inhibition of ATXN2 gene expression.

[0008] In general, the present disclosure features ATXN2 gene-specific RNAi agents, compositions including ATXN2 RNAi agents, and methods of using the ATXN2 RNAi agents and compositions including ATXN2 RNAi agents described herein for inhibiting ATXN2 gene expression in vitro and / or in vivo. The ATXN2 RNAi agents described herein are capable of selectively and effectively reducing expression of the ATXN2 gene, thereby reducing expression of the ATXN2 protein.

[0009] The ATXN2 RNAi agents can be used in methods of therapeutic treatment (including prophylactic or preventative treatment) of various central nervous system diseases and neurodegenerative diseases (including SCA2 and ALS).

[0010] In one aspect, the disclosure features an RNAi agent for inhibiting expression of an ATXN2 gene, wherein the RNAi agent comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand can be partially complementary, substantially complementary, or fully complementary to each other. The sense strand of the RNAi agent described herein can be 15 to 49 nucleotides in length. The antisense strand of the RNAi agent described herein can each be 18 to 49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 18 to 26 nucleotides in length. The sense strand and the antisense strand can be the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strand is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strand is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. Upon delivery to a cell expressing ATXN2, e.g., endothelial cells, neurons, microglia, and astrocytes, the RNAi agents described herein inhibit expression of one or more ATXN2 gene variants in vivo and / or in vitro.

[0011] The ATXN2 RNAi agents disclosed herein target the human ATXN2 gene (see, e.g., SEQ ID NO: 1). In some embodiments, the ATXN2 RNAi agents disclosed herein target a portion of the ATXN2 gene having a sequence disclosed in Table 1.

[0012] In another aspect, the disclosure features compositions, including pharmaceutical compositions, comprising one or more disclosed ATXN2 RNAi agents capable of selectively and effectively reducing expression of an ATXN2 gene. Compositions comprising one or more ATXN2 RNAi agents described herein can be administered to a subject, e.g., a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with ATXN2 mutant protein activity.

[0013] Examples of sense strands and antisense strands of ATXN2 RNAi agents that can be used in ATXN2 RNAi agents are provided in Tables 3, 4, 5, and 6. Examples of duplexes of ATXN2 RNAi agents are provided in Tables 7, 8, 9A, and 10. Examples of 19-nucleotide core segment sequences that can be comprised by, or can be included in, the sense and antisense strands of certain ATXN2 RNAi agents disclosed herein are provided in Table 2.

[0014] In another aspect, the disclosure features methods for delivering an ATXN2 RNAi agent to neurons, astrocytes, microglia, and endothelial cells of a subject (e.g., a mammal) in vivo. Compositions for use in such methods are also described herein. In some embodiments, methods for delivering an ATXN2 RNAi agent to central nervous system cells (neurons, astrocytes, microglia, and endothelial cells) of a subject in vivo are disclosed herein. In some embodiments, the subject is a human subject.

[0015] The methods disclosed herein include administering one or more ATXN2 RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more ATXN2 RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be, but is not limited to, for example, intrathecal, intracerebroventricular, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by intrathecal injection or intracerebroventricular injection.

[0016] In some embodiments, it is desirable for the ATXN2 RNAi agents described herein to inhibit expression of the ATXN2 gene in central nervous system cells.

[0017] One or more ATXN2 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. In some embodiments, the ATXN2 RNAi agents are delivered to cells or tissues by covalently linking the RNAi agent to a targeting group or a lipid moiety.

[0018] PK / PD modulators can be linked to the 3’ or 5’ end of the sense or antisense strand of the ATXN2 RNAi agent. In some embodiments, the PK / PD modulator is linked to the 3’ or 5’ end of the sense strand. In some embodiments, the PK / PD modulator is linked to the 5’ end of the sense strand. In some embodiments, the PK / PD modulator is linked internally to a nucleotide on the sense and / or antisense strand of the RNAi agent. In some embodiments, the PK / PD modulator is linked to the RNAi agent via a linker.

[0019] In another aspect, the disclosure features a composition including one or more ATXN2 RNAi agents having the duplex structure disclosed in Tables 7, 8, 9A, and 10.

[0020] The use of ATXN2 RNAi agents provides methods for the therapeutic (including prophylactic) treatment of diseases or conditions for which a reduction in ATXN2 protein activity can provide a therapeutic benefit. The ATXN2 RNAi agents disclosed herein can be used to treat various neurodegenerative diseases, including SCA2 and ALS. Such methods of treatment include administering an ATXN2 RNAi agent to a human or animal having elevated or mutant ATXN2 protein or ATXN2 protein activity above a desired level.

[0021] As used herein, the terms “oligonucleotide” and “polynucleotide” mean a polymer of linked nucleosides, which can each independently be modified or unmodified.

[0022] As used herein, “RNAi agent” (also referred to as “RNAi trigger”) means a chemical composition of matter that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can act through an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway machinery of a mammalian cell (the RNA-induced silencing complex or RISC)), or through any alternative mechanism or pathway. While it is believed that, as the term is used herein, an RNAi agent acts primarily through an RNA interference mechanism, the disclosed RNAi agents are not bound or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: small (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA to be targeted (i.e., the ATXN2 mRNA). The RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0023] As used herein, when referring to expression of a given gene, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” mean that the expression of the gene, as measured by the level of RNA transcribed from the gene, or the level of polypeptide, protein, or protein subunit translated from the mRNA, in a cell, population of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, population of cells, tissue, organ, or subject is treated with an RNAi agent described herein, as compared to a second cell, population of cells, tissue, organ, or subject that is not so treated.

[0024] As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides described using standard nomenclature with consecutive letters.

[0025] As used herein, a "base," "nucleotide base," or "nucleobase" is a heterocyclic pyrimidine or purine compound of which it is a component of a nucleotide, and includes the primary purine bases adenine and guanine, as well as the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, wobble bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases, including phosphoramidite compounds comprising modified nucleobases, is known in the art.

[0026] As used herein, and unless otherwise specified, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., the sense strand or a targeting mRNA of an RNAi agent) in relation to a second nucleobase or nucleotide sequence (e.g., the antisense strand or a single-stranded antisense oligonucleotide of an RNAi agent) means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pairing hydrogen bonds under mammalian physiological conditions (or otherwise appropriate in vivo or in vitro conditions)) and form a duplex or double helix structure with an oligonucleotide comprising the second nucleotide sequence under certain standard conditions. One of ordinary skill in the art will be able to select the most appropriate set of conditions for hybridization testing. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics at least to the extent that the above-mentioned hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, a and Af as defined herein are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0027] As used herein, "fully complementary" or "completely complementary" means that in a hybridizing pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in the contiguous sequence of a first oligonucleotide hybridize with the same number of bases in the contiguous sequence of a second oligonucleotide. The contiguous sequence can comprise all or a portion of the first nucleotide sequence or the second nucleotide sequence.

[0028] As used herein, "partially complementary" means that in a hybridizing pair of nucleobase or nucleotide sequence molecules, at least 70% but not all of the bases in the contiguous sequence of a first oligonucleotide hybridize with the same number of bases in the contiguous sequence of a second oligonucleotide. The contiguous sequence can comprise all or a portion of the first nucleotide sequence or the second nucleotide sequence.

[0029] As used herein, “substantially complementary” means that at least 85% but not all of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide in a hybridizing pair of nucleobase or nucleotide sequence molecules. The contiguous sequence can comprise all or a portion of the first or second nucleotide sequence.

[0030] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used in reference to nucleobase or nucleotide matches between a sense strand and an antisense strand of an RNAi agent, or between an antisense strand of an RNAi agent and an ATXN2 mRNA sequence.

[0031] As used herein, the term “substantially identical” or “substantial identity,” when applied to nucleic acid sequences, means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity, or more, such as at least 90%, at least 95%, or at least 99% identity, when compared to a reference sequence. The percent identity of sequence is determined by comparing two optimally aligned sequences over a comparison window. The percent identity is calculated by determining the number of positions at which the identical type of nucleic acid base occurs in both sequences within the window of comparison, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent of sequence identity. The present application disclosed herein encompasses nucleotide sequences that are substantially identical to the nucleotide sequences disclosed herein.

[0032] As used herein, the terms “treat,” “treatment,” and the like, mean methods or steps taken to provide relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” can include prevention, management, prophylactic treatment, and / or inhibition or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0033] As used herein, the phrase “introduced into a cell,” when referring to an RNAi agent, means that the RNAi agent is functionally delivered into the cell. The phrase “functionally delivered” means that the RNAi agent is delivered to the cell in a manner such that the RNAi agent has the intended biological activity, e.g., sequence-specific inhibition of gene expression.

[0034] As used herein, the use of the symbol is intended to mean that any one or more groups can be attached thereto, within the scope of the application as described herein.

[0035] As used herein, the term "isomers" refers to compounds having the same molecular formula but different structural arrangements of atoms. The isomers that are not mirror images of each other are termed "diastereomers." The isomers that are mirror images of each other are termed "enantiomers," or sometimes "optical isomers." A carbon atom bonded to four non-identical substituents is termed a "chiral center."

[0036] As used herein, for each structure in which there is an asymmetric center and, therefore, the potential for enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optical and racemic mixtures thereof, unless otherwise specified in the structure. For example, a structure disclosed herein is intended to encompass diastereomers as well as mixtures of single stereoisomers.

[0037] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. When used in the claims, the phrase "consisting essentially of" will limit the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the invention.

[0038] As will be readily understood and appreciated by those of ordinary skill in the art, the compounds and compositions disclosed herein can have certain atoms (e.g., N, O, or S atoms) that are either protonated or deprotonated, depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein contemplate certain functional groups, such as OH, SH, or NH, that can be either protonated or deprotonated. As will be readily understood by those of ordinary skill in the art, the disclosure herein contemplates encompassing the disclosed compounds and compositions regardless of their protonated state based on the environment (e.g., pH). Accordingly, the compounds described herein having labile protons or basic atoms are also to be understood to represent the salt forms of the corresponding compounds. The compounds described herein can be in the form of a free acid, a free base, or a salt. The pharmaceutically acceptable salts of the compounds described herein are to be understood to be within the scope of the present invention.

[0039] As used herein, the term "linked" or "conjugated" when referring to a linkage between two compounds or molecules means that the two compounds or molecules are joined by a covalent bond. Unless otherwise specified, as used herein, the terms "linked" and "conjugated" can refer to a linkage between a first compound and a second compound with or without any intervening atoms or groups of atoms.

[0040] As used herein, the term "comprising" is used herein to mean "including", "consisting of", and "consisting essentially of, and can be used interchangeably with the phrase "including but not limited to". Unless the context clearly indicates otherwise, the term "or" as used herein is intended to mean the term "and / or", and can be used interchangeably with the term "and / or".

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0042] Other objects, features, aspects and advantages of the present application will become apparent to one skilled in the art from the following detailed description, accompanied by the accompanying drawings, and from the claims. DETAILED DESCRIPTION RNAi agents Described herein are RNAi agents (referred to herein as ATXN2 RNAi agents or ATXN2 RNAi triggers) for inhibiting the expression of the ATXN2 (or ATXN2) gene. Each ATXN2 RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense and antisense strands can each be 15 to 49 nucleotides in length. The antisense sense strands can be 18 to 30 nucleotides in length. The antisense strands can be the same length, or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 18 to 27 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the sense strand of the RNAi agent is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the antisense strand of the RNAi agent is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30. In some embodiments, the double stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0044] Examples of nucleotide sequences used to form ATXN2 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of duplexes comprising the sense and antisense strand sequences in Tables 2, 3, 4, 5, 6 are shown in Tables 7, 8, 9A, and 10.

[0045] In some embodiments, the region of perfect complementarity, substantial complementarity, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5’ end of the antisense strand (e.g., the region can be separated from the 5’ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

[0046] The sense strand of an ATXN2 RNAi agent described herein includes at least 15 contiguous nucleotides that are at least 85% identical to a core segment sequence (also referred to herein as a “core segment” or “core sequence”) of the same number of nucleotides in an ATXN2 mRNA. In some embodiments, the sense strand core segment sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core segment sequence in the antisense strand, and thus, the sense strand core segment sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length present in an ATXN2 mRNA target (sometimes referred to, for example, as a target sequence). In some embodiments, the sense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core segment is 17 nucleotides in length. In some embodiments, the sense strand core segment is 19 nucleotides in length.

[0047] The antisense strand of an ATXN2 RNAi agent described herein includes at least 16 contiguous nucleotides that are at least 85% complementary to a core segment of the same number of nucleotides in an ATXN2 mRNA and a core segment of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in an ATXN2 mRNA target (e.g., a target sequence). In some embodiments, the antisense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core segment is 19 nucleotides in length. In some embodiments, the antisense strand core segment is 17 nucleotides in length. The sense strand core segment sequence can be the same length as the corresponding antisense core sequence, or it can be a different length.

[0048] The sense strand and the antisense strand of the ATXN2 RNAi agent anneal to form a duplex. The sense strand and the antisense strand of the ATXN2 RNAi agent can be partially complementary, substantially complementary, or fully complementary to each other. Within the region of complementary duplex, the sense strand core segment sequence is at least 85% complementary or 100% complementary to the antisense core segment sequence. In some embodiments, the sense strand core segment sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core segment sequence (i.e., the sense and antisense core segment sequences of the ATXN2 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired). In some embodiments, the antisense strand of the ATXN2 RNAi agents disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of the ATXN2 RNAi agents disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0049] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3’-end, the 5’-end, or both the 3’- and 5’-ends of the core segment sequence. The additional nucleotides of the antisense strand, if present, can or can not be complementary to the corresponding sequence in the ATXN2 mRNA. The additional nucleotides of the sense strand, if present, can or can not be identical to the corresponding sequence in the ATXN2 mRNA. The additional nucleotides of the antisense strand, if present, can or can not be complementary to the additional nucleotides of the corresponding sense strand, if present.

[0050] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5’ and / or 3’ end of a sense strand core segment sequence and / or an antisense strand core segment sequence. The extension nucleotides on the sense strand can or can not be complementary to the nucleotides (or core segment sequence nucleotides or extension nucleotides) in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand can or can not be complementary to the nucleotides (or core segment nucleotides or extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain a 3’ and 5’ extension. In some embodiments, one or more 3’ extension nucleotides of one strand base pair with one or more 5’ extension nucleotides of the other strand. In other embodiments, one or more 3’ extension nucleotides of one strand do not base pair with one or more 5’ extension nucleotides of the other strand. In some embodiments, an ATXN2 RNAi agent has an antisense strand containing a 3’ extension and a sense strand containing a 5’ extension. In some embodiments, the extension nucleotides are unpaired and form overhangs. As used herein, an “overhang” refers to one or more segments of unpaired nucleotides located at the terminal end of a sense strand or an antisense strand that do not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.

[0051] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand having a 3’ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an ATXN2 RNAi agent comprises an antisense strand having a 3’ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding ATXN2 mRNA sequence. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding ATXN2 mRNA sequence.

[0052] In some embodiments, an ATXN2 RNAi agent comprises a sense strand having a 3’ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the ATXN2 mRNA sequence. In some embodiments, the 3’ sense strand extension comprises or consists of one of the following sequences, without limitation: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5’ to 3’).

[0053] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the ATXN2 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise a nucleotide corresponding to or identical to a nucleotide in the ATXN2 mRNA sequence.

[0054] Examples of sequences used to form ATXN2 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the sequence of any sequence in Table 2, 3, or 10. In certain embodiments, the antisense strand of an ATXN2 RNAi agent comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the sequence of nucleotides (5' end 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any sequence in Table 2 or 3. In some embodiments, the sense strand of an ATXN2 RNAi agent comprises the sequence of any sequence in Table 2, 4, 5, or 6. In some embodiments, the sense strand of an ATXN2 RNAi agent comprises the sequence of nucleotides (5' end 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any sequence in Table 2, 4, 5, or 6. In certain embodiments, the sense strand of an ATXN2 RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 4, 5, 6, or 10.

[0055] In some embodiments, the sense strand and the antisense strand of an RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense strand and the antisense strand of an RNAi agent described herein contain a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form a blunt end. In some embodiments, neither end of an RNAi agent is a blunt end. As used herein, a "blunt end" refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0056] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form a frayed end. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang), but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides can be on the sense strand or the antisense strand, resulting in a 3' or 5' overhang. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, when present, overhangs are at the 3' terminal end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0057] The ATXN2 RNAi agents disclosed herein can also be composed of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the ATXN2 RNAi agent are modified nucleotides. The ATXN2 RNAi agents disclosed herein can further comprise one or more modified internucleoside linkages, such as one or more phosphorothioate linkages. In some embodiments, the ATXN2 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, the 2'-modified nucleotides are combined with modified internucleoside linkages.

[0058] In some embodiments, the ATXN2 RNAi agents are prepared or provided as a salt, a mixed salt, or as a free acid. In some embodiments, the ATXN2 RNAi agents are prepared as a pharmaceutically acceptable salt. In some embodiments, the ATXN2 RNAi agents are prepared as a pharmaceutically acceptable sodium salt. Such forms, which are well known in the art, are within the scope of the application disclosed herein.

[0059] Modified nucleotides When used in various oligonucleotide constructs, modified nucleotides can preserve the activity of the compounds in cells, while increasing the serum stability of these compounds, and can also minimize the potential to activate interferon activity in humans upon administration of the oligonucleotide constructs.

[0060] In some embodiments, the ATXN2 RNAi agent contains one or more modified nucleotides. As used herein, a“modified nucleotide” is a nucleotide other than a ribonucleotide (2’-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, a modified nucleotide can include, but is not limited to, a deoxyribonucleotide, a nucleotide mimic, an abasic nucleotide, a 2’-modified nucleotide, an inverted nucleotide, a nucleotide comprising a modified nucleobase, a bridged nucleotide, a peptide nucleic acid (PNA), a 2’,3’-seco nucleotide mimic (an unlocked nucleobase analog), a locked nucleotide, a 3’-O-methoxy (2’ internucleosidic linkage) nucleotide, a 2’-F- arabinonucleotide, a 5’-Me, 2’-fluoro nucleotide, a morpholino nucleotide, a vinyl phosphonate deoxyribonucleotide, a vinyl phosphonate-containing nucleotide, and a cyclopropyl phosphonate-containing nucleotide. 2’-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2’ position of the five-membered sugar ring) include, but are not limited to, 2’-O-methyl nucleotides (also referred to herein or in the art as 2’-methoxy nucleotides), 2’-fluoro nucleotides (also referred to herein or in the art as 2’-deoxy-2’-fluoro nucleotides), 2’-deoxy nucleotides, 2’-methoxyethyl (2’-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2’-MOE nucleotides), 2’-amino nucleotides, and 2’-alkyl nucleotides. All positions in a given compound need not be uniformly modified. Rather, a plurality of modifications can be incorporated in a single ATXN2 RNAi agent, or even in a single nucleotide thereof. The sense and antisense strands of the ATXN2 RNAi agent can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0061] Modified nucleobases include synthetic and naturally occurring nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, such as 2- aminopropyladenine, 5-propynyluracil or 5-propynylcytosine, 5-methylcytosine (5-me-C), 5- hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6- methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2- methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5- propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0062] In some embodiments, the 5' and / or 3' end of the antisense strand can include an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Patent No. 5,998,203.) In some embodiments, an abasic residue can be placed internally within a nucleotide sequence. In some embodiments, an Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, a UUAb, UAb or Ab is added to the 3' end of the sense strand. In some embodiments, an abasic (deoxyribo) residue can be replaced with a ribitol (abasic ribose) residue.

[0063] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (i.e., unmodified) in both the sense strand and the antisense strand. As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are set forth in Table 11 herein.

[0064] Modified internucleoside linkages In some embodiments, one or more nucleotides of the ATXN2 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, without limitation, phosphorothioate groups (denoted herein as lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methyl- or 3’-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3’-amino phosphoramidate, aminoalkyl phosphoramidates, or thio-carbamate phosphoramidates), thioalkylphosphonates, thioalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3’-5’ linkages, 2’-5’ linked boranophosphate analogs, or boranophosphates having inverted polarity wherein the 3’-5’ linkage is linked to 5’-3’ or the 2’-5’ linkage is linked to 5’-2’. In some embodiments, the modified internucleoside linkages or backbones lack a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, without limitation, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. In some embodiments, the modified internucleoside backbones include, without limitation, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene

[0065] In some embodiments, the sense strand of an ATXN2 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an ATXN2 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an ATXN2 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an ATXN2 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0066] In some embodiments, the sense strand of an ATXN2 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 3’ end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5’ end of the sense strand nucleotide sequence and the other phosphorothioate linkage is at the 3’ end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are at the 5’ end of the sense strand and the other phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate internucleoside linkages between nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5’ and 3’ ends and an optionally present inverted abasic residue terminal cap. In some embodiments, the targeting ligand is connected to the sense strand via a phosphorothioate linkage.

[0067] In some embodiments, the antisense strand of an ATXN2 RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 5’ end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5’ end. In some embodiments, three phosphorothioate internucleoside linkages are between positions 1-4 from the 5’ end of the antisense strand and the fourth phosphorothioate internucleoside linkage is between positions 20-21 from the 5’ end of the antisense strand. In some embodiments, an ATXN2 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0068] Capping residues or moieties In some embodiments, the sense strand can include one or more capping residues or moieties, sometimes referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more terminal ends of the nucleotide sequence of an RNAi agent disclosed herein. In some cases, a capping residue can be an RNAi agent that provides certain beneficial properties, such as protection from exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31 (11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues as well as carbon chains, such as terminal C3H7 (propyl), C6H 13 ( hexyl), or C 12 H 25 (dodecyl) groups. In some embodiments, a capping residue is present at the 5' terminal end, the 3' terminal end, or both the 5' and 3' terminal ends of the sense strand. In some embodiments, the 5' end and / or the 3' end of the sense strand can include more than one inverted abasic deoxyribose moiety as a capping residue.

[0069] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near one or more terminal ends of the sense strand of the RNAi agent allows for enhanced activity or other desirable properties of the RNAi agent.

[0070] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the nucleotide sequence of the targeting ligand and the sense strand of the RNAi agent. The inverted abasic residues can be linked via phosphates, phosphorothioates (e.g., shown as (invAb)s herein), or other internucleoside linkages. In some embodiments, inclusion of one or more inverted abasic residues at or near one or more terminal ends of the sense strand of the RNAi agent can allow for enhanced activity or other desirable properties of the RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core segment sequence or the 3' end of the antisense strand sequence can include an inverted abasic residue. The chemical structure of an inverted abasic deoxyribose residue is shown in Table 11 below.

[0071] ATXN2 RNAi agents The ATXN2 RNAi agents disclosed herein are designed to target specific positions on the ATXN2 gene (e.g., SEQ ID NO: 1 (NM_001310123.1)). As defined herein, an antisense strand sequence is designed to target the ATXN2 gene at a given position on the gene when, when base paired with the gene, the 5' terminal nucleobase of the antisense strand is aligned with a position that is 21 nucleotides downstream (toward the 3' end) from the position on the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the ATXN2 gene at position 304 requires, when base paired with the gene, that the 5' terminal nucleobase of the antisense strand be aligned with position 324 of the ATXN2 gene.

[0072] As provided herein, the ATXN2 RNAi agent does not require that the nucleobase at position 1 (5'→ 3') of the antisense strand be complementary to the gene, provided that the antisense strand and the gene are at least 85% complementary (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary) across a core segment sequence spanning at least 16 contiguous nucleotides. For example, for the ATXN2 RNAi agent disclosed herein designed to target position 304 of the ATXN2 gene, the 5' terminal nucleobase of the antisense strand of the ATXN2 RNAi agent must align with position 324 of the gene; however, the 5' terminal nucleobase of the antisense strand can, but does not require, be complementary to position 324 of the ATXN2 gene, provided that the antisense strand and the gene transcript are at least 85% complementary (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary) across a core segment sequence spanning at least 16 contiguous nucleotides. As shown by the various examples disclosed herein, among other things, the gene through which the antisense strand of the ATXN2 RNAi agent specifically binds (e.g., is the ATXN2 RNAi agent designed to target the ATXN2 gene at position 127, at position 130, at position 136, or at some other position) is an important factor for the level of inhibition achieved by the ATXN2 RNAi agent. (See, e.g., Kamola et al., PLOS Computational Biology, 11(12), Figure 1 (2015)). The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015).

[0073] In some embodiments, the ATXN2 RNAi agents disclosed herein target the ATXN2 gene at or near the positions of the ATXN2 sequence set forth in Table 1. In some embodiments, the antisense strand of the ATXN2 RNAi agents disclosed herein comprises a core segment sequence that is fully complementary, substantially complementary, or at least partially complementary to the ATXN2 19-mer sequences disclosed in Table 1.

[0074] Table 1. ATXN2 19-mer mRNA target sequences (taken from Homo sapiens (human) ATAXIN-2 (ATXN2) transcript, GenBank NM_001310123.1 (SEQ ID NO: 1)) homo sapiens ATAXIN-2 (ATXN2) transcript, GenBank NM_001310123.1 (SEQ ID NO: 1) .

[0075] Homo sapiens ataxin-2 (ATXN2), GenBank NM_001310123.1 (SEQ ID NO: 1), gene transcript (3755 bases): 1 cccgagaaag caacccagcg cgccgcccgc tcctcacgtg tccctcccgg ccccggggcc 61 acctcacgtt ctgcttccgt ctgacccctc cgacttccga tttcttttga tggaatctat 121 gcaaatatga ggatggttca tatacttaca tcagttgttt gtgatttggt acttgatgcc 181 gcacatgaga aaagtacaga atccagttcg gggccgaaac gtgaagaaat aatggagagt 241 attttgttca aatgttcaga ctttgttgtg gtacagttta aagatatgga ctccagttat 301 gcaaaaagag atgcttttac tgactctgct atcagtgcta aagtgaatgg cgaacacaaa 361 gagaaggacc tggagccctg ggatgcaggt gaactcacag ccaatgagga acttgaggct 421 ttggaaaatg acgtatctaa tggatgggat cccaatgata tgtttcgata taatgaagaa 481 aattatggtg tagtgtctac gtatgatagc agtttatctt cgtatacagt gcccttagaa 541 agagataact cagaagaatt tttaaaacgg gaagcaaggg caaaccagtt agcagaagaa 601 attgagtcaa gtgcccagta caaagctcga gtggccctgg aaaatgatga taggagtgag 661 gaagaaaaat acacagcagt tcagagaaat tccagtgaac gtgaggggca cagcataaac 721 actagggaaa ataaatatat tcctcctgga caaagaaata gagaagtcat atcctgggga 781 agtgggagac agaattcacc gcgtatgggc cagcctggat cgggctccat gccatcaaga 841 tccacttctc acacttcaga tttcaacccg aattctggtt cagaccaaag agtagttaat 901 ggaggtgttc cctggccatc gccttgccca tctccttcct ctcgcccacc ttctcgctac 961 cagtcaggtc ccaactctct tccacctcgg gcagccaccc ctacacggcc gccctccagg 1021 cccccctcgc ggccatccag acccccgtct cacccctctg ctcatggttctccagctcct 1081 gtctctacta tgcctaaacg catgtcttca gaagggcctc caaggatgtccccaaaggcc 1141 cagcgacatc ctcgaaatca cagagtttct gctgggaggg gttccatatccagtggccta 1201 gaatttgtat cccacaaccc acccagtgaa gcagctactc ctccagtagcaaggaccagt 1261 ccctcggggg gaacgtggtc atcagtggtc agtggggttc caagattatcccctaaaact 1321 catagaccca ggtctcccag acagaacagt attggaaata cccccagtgggccagttctt 1381 gcttctcccc aagctggtat tattccaact gaagctgttg ccatgcctattccagctgca 1441 tctcctacgc ctgctagtcc tgcatcgaac agagctgtta ccccttctagtgaggctaaa 1501 gattccaggc ttcaagatca gaggcagaac tctcctgcag ggaataaagaaaatattaaa 1561 cccaatgaaa catcacctag cttctcaaaa gctgaaaaca aaggtatatcaccagttgtt 1621 tctgaacata gaaaacagat tgatgattta aagaaattta agaatgattttaggttacag 1681 ccaagttcta cttctgaatc tatggatcaa ctactaaaca aaaatagagagggagaaaaa 1741 tcaagagatt tgatcaaaga caaaattgaa ccaagtgcta aggattctttcattgaaaat 1801 agcagcagca actgtaccag tggcagcagc aagccgaata gccccagcatttccccttca 1861 atacttagta acacggagca caagagggga cctgaggtca cttcccaaggggttcagact 1921 tccagcccag catgtaaaca agagaaagac gataaggaag agaagaaagacgcagctgag 1981 caagttagga aatcaacatt gaatcccaat gcaaaggagt tcaacccacgttccttctct 2041 cagccaaagc cttctactac cccaacttca cctcggcctc aagcacaacctagcccatct 2101 atggtgggtc atcaacagcc aactccagtt tatactcagc ctgtttgttttgcaccaaat 2161 atgatgtatc cagtcccagt gagcccaggc gtgcaacctt tatacccaatacctatgacg 2221 cccatgccag tgaatcaagc caagacatat agagcagtac caaatatgccccaacagcgg 2281 caagaccagc atcatcagag tgccatgatg cacccagcgt cagcagcgggcccaccgatt 2341 gcagccaccc caccagctta ctccacgcaa tatgttgcct acagtcctcagcagttccca 2401 aatcagcccc ttgttcagca tgtgccacat tatcagtctc agcatcctcatgtctatagt 2461 cctgtaatac agggtaatgc tagaatgatg gcaccaccaa cacacgcccagcctggttta 2521 gtatcttctt cagcaactca gtacggggct catgagcaga cgcatgcgatgtatgtttcc 2581 acgggctccc ttgctcagca gtatgcgcac cctaacgcta ccctgcacccacatactcca 2641 caccctcagc cttcagctac ccccactgga cagcagcaaa gccaacatggtggaagtcat 2701 cctgcaccca gtcctgttca gcaccatcag caccaggccg cccaggctctccatctggcc 2761 agtccacagc agcagtcagc catttaccac gcggggcttg cgccaactccaccctccatg 2821 acacctgcct ccaacacgca gtcgccacag aatagtttcc cagcagcacaacagactgtc 2881 tttacgatcc atccttctca cgttcagccg gcgtatacca acccaccccacatggcccac 2941 gtacctcagg ctcatgtaca gtcaggaatg gttccttctc atccaactgcccatgcgcca 3001 atgatgctaa tgacgacaca gccacccggc ggtccccagg ccgccctcgctcaaagtgca 3061 ctacagccca ttccagtctc gacaacagcg catttcccct atatgacgcacccttcagta 3121 caagcccacc accaacagca gttgtaaggc tgccctggag gaaccgaaaggccaaattcc 3181 ctcctccctt ctactgcttc taccaactgg aagcacagaa aactagaatttcatttattt 3241 tgtttttaaa atatatatgt tgatttctlg taacatccaa taggaatgctaacagttcac 3301 ttgcagtgga agatacttgg accgagtaga ggcatttagg aacttgggggctattccata 3361 attccatatg ctgtttcaga gtcccgcagg taccccagct ctgcttgccgaaactggaag 3421 ttatttattt tttaataacc cttgaaagtc atgaacacat cagctagcaaaagaagtaac 3481 aagagtgatt cttgctgcta ttactgctaa aaaaaaaaaa aaaaaaaaatcaagacttgg 3541 aacgcccttt tactaaactt gacaaagttt cagtaaattc ttaccgtcaa actgacggat 3601 tattatttat aaatcaagtt tgatgaggtg atcactgtct acagtggttca acttttaag 3661 ttaagggaaa aacttttact ttgtagataa tataaaataa aaacttaaaaaaaatttaaa 3721 aaataaaaaa agttttaaaa actgaaaaaa aaaaa

[0076] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand, wherein position 19 of the antisense strand (5' 3') is capable of forming base pairs with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ATXN2 agent comprises an antisense strand, wherein position 1 of the antisense strand (5' 3') is capable of forming base pairs with position 19 of a 19-mer target sequence disclosed in Table 1.

[0077] In some embodiments, an ATXN2 agent comprises an antisense strand, wherein position 2 of the antisense strand (5' 3') is capable of forming base pairs with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ATXN2 agent comprises an antisense strand, wherein positions 2 to 18 of the antisense strand (5' 3') are each capable of forming base pairs with a respective complementary base located at positions 18 to 2, respectively, of a 19-mer target sequence disclosed in Table 1.

[0078] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' end 3' end) can be fully complementary to the ATXN2 gene, or can not be complementary to the ATXN2 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end 3' end) is a U, an A, or a dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end 3' end) forms an A:U or U:A base pair with the sense strand.

[0079] In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the sequence of nucleotides (5' end 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the ATXN2 RNAi sense strand comprises the sequence of nucleotides (5' end 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0080] In some embodiments, the ATXN2 RNAi agent comprises: (i) an antisense strand comprising the sequence of nucleotides (5’ end 3’ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (5’ end 3’ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0081] In some embodiments, the ATXN2 RNAi agent includes a core 19-mer nucleotide sequence as set forth in Table 2 below.

[0082] Table 2. Antisense strand and sense strand core segment base sequences for ATXN2 RNAi agents (N = any nucleobase; I = inosine (hypoxanthine nucleobase) .

[0083] The sense and antisense strands of the ATXN2 RNAi agents comprising or consisting of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the ATXN2 RNAi agents having sense and antisense strand sequences comprising or consisting of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0084] In some embodiments, the antisense strand of an ATXN2 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an ATXN2 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0085] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases, including those found on both modified and unmodified nucleotides. In some embodiments, an N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is complementary to an N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is not complementary to an N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is the same as an N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is different from an N nucleotide at the corresponding position on the other strand.

[0086] The sense and antisense strands of certain modified ATXN2 RNAi agents are provided in Table 3, Table 4, Table 5, Table 6, and Table 10. The antisense strands of certain modified ATXN2 RNAi agents are provided in Table 3, along with their potential unmodified nucleobase sequences. The sense strands of certain modified ATXN2 RNAi agents are provided in Tables 4, 5, and 6, along with their potential unmodified nucleobase sequences. Each nucleotide in each of the potential base sequences listed in Tables 3, 4, 5, and 6, and Table 2 above, can be a modified nucleotide when forming an ATXN2 RNAi agent.

[0087] The ATXN2 RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can hybridize to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0088] In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0089] In some embodiments, an ATXN2 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense and antisense strands of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, or Table 10.

[0090] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5, and 6.

[0091] As used in Tables 3, 4, 5, 6, and 10, the following symbols are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine 3'-phosphate I = inosine 3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate A UNA = 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA = 2',3'-seco-cytidine-3'-phosphate C UNA s = 2',3'-seco-cytidine-3'-phosphorothioate G UNA = 2',3'-seco-guanosine-3'-phosphate G UNA s = 2',3'-seco-guanosine-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N = see Table 11 a_2Ns = see Table 11 (invAb) = inverted abasic deoxyribonucleotide-5'-phosphate, see Table 11 (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate, see Table 11 s = phosphorothioate linkage p = terminal phosphate (when synthesized) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 11) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 11) (Alk-SS-C6) = see Table 11 (C6-SS-Alk) = see Table 11 (C6-SS-C6) = see Table 11 (6-SS-6) = see Table 11 (C6-SS-Alk-Me) = see Table 11 (NH2-C6) = see Table 11 -C6- = see Table 11 -C6s- = see Table 11 -L6-C6- = see Table 11 -L6-C6s- = see Table 11 LP183s = see Table 11 LP183rs = see Table 11 cC16 = see Table 11 aC16 = see Table 11 gC16 = see Table 11 uC16 = see Table 11 ALNA = see Table 11 c16s = see Table 11 C22s = see Table 11 HO-C16s = see Table 11 LP293 = see Table 11 LP310 = see Table 11.

[0092] As will be readily understood by one of ordinary skill in the art, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage “s”), when present in an oligonucleotide, nucleotide monomers are connected to one another by 5’-3’-phosphodiester linkages. As will be clearly understood by one of ordinary skill in the art, as shown in the modified nucleotide sequences disclosed herein, phosphorothioate linkages include a substitution of the phosphodiester linkages normally present in an oligonucleotide. Further, one of ordinary skill in the art will readily understand that the terminal nucleotide at the 3’ end of a given oligonucleotide sequence, will typically have a hydroxyl (-OH) group at the corresponding 3’ position of the given monomer rather than an exocyclic phosphate moiety. Additionally, for the embodiments disclosed herein, when viewing the corresponding strand 5’→3’, an inverted deoxyabasic residue is inserted such that the 3’ position of the deoxyribose is connected at the 3’ end of the preceding monomer on the corresponding strand (see, e.g., Table 11). Moreover, as will be readily understood and appreciated by one of ordinary skill in the art, although the phosphorothioate chemical structures depicted herein typically show an anion on the sulfur atom, the present application disclosed herein encompasses all phosphorothioate tautomers (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise explicitly indicated herein, such understanding by one of ordinary skill in the art is used when describing the ATXN2 RNAi agents and compositions of ATXN2 RNAi agents disclosed herein.

[0093] Certain examples of targeting groups and linking groups for use with the ATXN2 RNAi reagents disclosed herein include the chemical structures provided in Table 11 below. Each sense strand and / or antisense strand can have any of the targeting groups or linking groups listed herein conjugated to the 5’ and / or 3’ terminus of the sequence, as well as other targeting groups or linking groups.

[0094] Table 3. Antisense strand sequences of ATXN2 RNAi reagents .

[0095] Table 4. Sense strand sequences of ATXN2 reagents (linkers, conjugates, or capping moieties not shown) a_2N = 2-amino adenosine nucleotide.

[0096] Table 5. Sense strand sequences of ATXN2 reagents (shown without lipid conjugate but with terminal cap (see Table 11 for structure information)) a_2N = 2-amino adenosine nucleotide

[0097] Table 6. Sense strand sequences of ATXN2 agents (shown with lipid moieties or NAG37 ligands. Structures of lipid moieties are shown in Table 11.

[0098] The ATXN2 RNAi agents disclosed herein are formed by annealing an antisense strand to a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can hybridize to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over an adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0099] As shown in Table 5 above, the nucleotide sequences of certain example ATXN2 RNAi agents are shown to further include a reactive linking group at one or both of the 5’ terminal end and the 3’ terminal end of the sense strand. For example, the sense strand sequences of many of the ATXN2 RNAi agents shown in Table 5 above have a (NH2-C6) linking group at the 5’ end of the nucleotide sequence. In certain embodiments, other linking groups can also or alternatively be present, such as a (6-SS-6) linking group or a (C6-SS-C6) linking group. Such reactive linking groups are placed to facilitate the attachment of targeting ligands, targeting groups, and / or PK / PD modulators to the ATXN2 RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and provide for the formation of a covalent linkage between two molecules or reactants. Suitable conjugation reactions within the scope of the present invention for use herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, inverse-demand Diels-Alder cycloaddition reactions, oxime ligation, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0100] In some embodiments, the targeting ligand can be synthesized as an activated ester, such as a tetrafluorophenyl (TFP) ester, which can be displaced by a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to the ATXN2 RNAi agents disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group, for example, via copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0101] Additionally, certain nucleotide sequences can be synthesized with a dT nucleotide at the 3’ terminal end of the sense strand, followed by a (3’ → 5’) linker (e.g., C6-SS-C6). In some embodiments, the linker can facilitate bonding to additional components, such as a lipid or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced, removing the dT from the molecule, which can then facilitate conjugation of the desired component. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.

[0102] In some embodiments, the antisense strand of the ATXN2 RNAi agents disclosed herein differs from any of the antisense strand sequences in Table 3 or Table 10 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the ATXN2 RNAi agents disclosed herein differs from any of the sense strand sequences in Table 4, Table 5, Table 6, or Table 10 by 0, 1, 2, or 3 nucleotides.

[0103] In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the nucleotides (5’ end 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2, Table 3, or Table 10. In certain embodiments, the antisense strand of an ATXN2 RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0104] In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the nucleotides (5’ end 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2, Table 3, or Table 10. In certain embodiments, the antisense strand of an ATXN2 RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0105] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5’ end 3’ end) can be fully complementary to the ATXN2 gene, or can not be complementary to the ATXN2 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5’ end 3’ end) is U, A, or dT (or a modified form of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5’ end 3’ end) forms an A:U or U:A base pair with the sense strand.

[0106] In some embodiments, the antisense strand of an ATXN2 RNAi agent comprises the nucleotides (5’ end 3’ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10. In some embodiments, the sense strand of an ATXN2 RNAi comprises the nucleotides (5’ end 3’ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0107] In some embodiments, an ATXN2 RNAi agent comprises (i) an antisense strand comprising the sequence of nucleotides (5' end 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10), and (ii) a sense strand comprising the sequence of nucleotides (5' end 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10).

[0108] A sense strand comprising a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand comprising a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, an ATXN2 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10. Certain representative sequence pairings are exemplified by duplex ID No. shown in Tables 7, 8, and 9A.

[0109] In some embodiments, an ATXN2 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID Nos. presented herein. In some embodiments, an ATXN2 RNAi agent consists of any duplex ID No. presented herein. In some embodiments, an ATXN2 RNAi agent comprises the sense and antisense strand nucleotide sequences of any duplex ID No. presented herein. In some embodiments, an ATXN2 RNAi agent comprises the sense and antisense strand nucleotide sequences of any duplex ID No. presented herein, and a targeting group, a linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently attached (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an ATXN2 RNAi agent comprises the modified nucleotide sequences of the sense and antisense strands of any duplex ID No. presented herein. In some embodiments, an ATXN2 RNAi agent comprises the modified nucleotide sequences of the sense and antisense strands of any duplex ID No. presented herein, and a targeting group, a linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently attached to the sense strand or the antisense strand.

[0110] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises a targeting group. In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises one or more lipid moieties.

[0111] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises a lipid moiety. In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises one or more lipid moieties.

[0112] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense / sense strand duplexes of Tables 7, 8, 9A, and 10.

[0113] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense / sense strand duplexes of Tables 7, 8, 9A, and 10, and comprises a lipid moiety.

[0114] In some embodiments, an ATXN2 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 7, 8, 9A, and 10.

[0115] Table 7. Duplexes of ATXN2 RNAi agents with corresponding sense strand and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0116] Table 8. Duplexes of ATXN2 RNAi agents with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Conjugates with targeting ligand conjugates are shown) .

[0117] Table 9A. Duplex ID numbers for conjugates referencing the targeted position on the ATXN2 (ATXN2) gene .

[0118] Table 10. Conjugate ID numbers for antisense strands and sense strands (including linkers and conjugates) with chemical modifications .

[0119] In some embodiments, the ATXN2 RNAi agents are prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the ATXN2 RNAi agents are prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the ATXN2 RNAi agents are prepared or provided as a pharmaceutically acceptable sodium salt or potassium salt. Upon delivery to cells expressing the ATXN2 gene, the RNAi agents described herein inhibit or knockdown the expression of one or more ATXN2 genes in vivo and / or in vitro.

[0120] Targeting groups, linking groups, lipid moieties, and delivery vehicles In some embodiments, the ATXN2 RNAi agents contain or are conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linking groups, pharmacokinetic / pharmacodynamic (PK / PD) modulators, delivery polymers, or delivery vehicles. The non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agents. The non-nucleotide groups can be covalently linked to the 3’ and / or 5’ end of the sense and / or antisense strand. In some embodiments, the ATXN2 RNAi agents contain non-nucleotide groups linked to the 3’ and / or 5’ end of the sense strand. In some embodiments, the non-nucleotide groups are linked to the 5’ end of the sense strand of the ATXN2 RNAi agents. The non-nucleotide groups can be directly or indirectly linked to the RNAi agents via a linker / linking group. In some embodiments, the non-nucleotide groups are linked to the RNAi agents via a labile, cleavable, or reversible bond or linker.

[0121] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to improve the cell or tissue specific distribution and cell specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0122] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which they are attached to improve the cell specific (in some cases, including organ specific) distribution and cell specific (or organ specific) uptake of the conjugate or RNAi agent. The targeting groups can be monovalent, bivalent, trivalent, tetravalent, or of higher valency for the target to which it is directed. Representative targeting groups include, but are not limited to, compounds having affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics (having affinity for cell surface molecules). In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker, or one, two, or three abasic and / or ribose alcohol (abasic ribose) residues, which in some cases can act as a linker.

[0123] The targeting groups, with or without linkers, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10. The linkers, with or without targeting groups, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10.

[0124] The ATXN2 RNAi agents described herein can be synthesized with a reactive group, such as an amino group (also referred to herein as an amine), at the 5' end and / or 3' end. The reactive group can then be used to attach a targeting moiety using methods generally in the art.

[0125] For example, in some embodiments, the ATXN2 RNAi agents disclosed herein are synthesized with an NH2-C6 group at the 5' end of the sense strand of the RNAi agent. The terminal amino group can then be reacted with a group, such as a lipid moiety, to form a conjugate with the group. In some embodiments, the ATXN2 RNAi agents disclosed herein are synthesized with one or more alkynyl groups at the 5' end of the sense strand of the RNAi agent.

[0126] In some embodiments, the targeting group is linked to the ATXN2 RNAi agent without the use of an additional linker. In some embodiments, the targeting group is designed to have an easily available linker to facilitate bonding to the ATXN2 RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the same linker can be used to link the two or more RNAi agents to their respective targeting groups. In some embodiments, when two or more RNAi agents are included in the composition, different linkers are used to link the two or more RNAi agents to their respective targeting groups.

[0127] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, a pharmacokinetic modulator, a delivery polymer, or a delivery vehicle. The linking group can be attached to the 3’ and / or 5’ end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5’ or 3’ end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5’ end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, trialkyne functional groups, ribitol, and / or PEG groups. Examples of certain linking groups are provided in Table 11.

[0128] A linker or linking group is a connection between two atoms that links one chemical group (e.g., an RNAi agent) or segment of interest to another chemical group (e.g., a targeting group, a pharmacokinetic modulator, or a delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. The linkage can optionally include a spacer that increases the distance between the two connected atoms. The spacer can further increase the flexibility and / or length of the linkage. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the previous list is not meant to limit the scope of the present specification. In some embodiments, the ATXN2 RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.

[0129] In some embodiments, the ATXN2 RNAi agent is linked to one or more lipid moieties. The lipid moieties can enhance the pharmacodynamic or pharmacokinetic properties of the RNAi agent. In some embodiments, the lipid moieties can be conjugated to a linker at the 3’ or 5’ end of the sense or antisense strand of the RNAi agents described herein. In some embodiments, the lipid moieties can be linked at the 3’ or 5’ end of the sense or antisense strand of the RNAi agents described herein.

[0130] In some embodiments, the lipid moieties can be conjugated to the ATXN2 RNAi agents by reacting the ATXN2 RNAi agents comprising an amine-containing linker, such as (NH2-C6), to the ATXN2 RNAi agents (see Table 11). In some embodiments, the amine-containing linker can be positioned on the 5’ end of the sense or antisense strand of the ATXN2 RNAi agents. In some embodiments, the amine-containing linker can be positioned on the 3’ end of the sense or antisense strand of the RNAi agents.

[0131] In some embodiments, the RNAi agents comprising an amine-containing linker, such as (NH2-C6) or (NH2-C6)s, can be reacted with a lipid comprising an active ester moiety. Exemplary lipids with active ester moieties include LP183-p, LP293-p, and LP310-p as shown in Table 11 below.

[0132] In some embodiments, the ATXN2 RNAi agents can be conjugated to the lipid moieties using phosphoramidite synthesis. The synthesis of oligonucleotides using phosphoramidite is well known in the art. In some embodiments, the lipid moieties can be conjugated to the 5’ end of the sense or antisense strand of the ATXN2 RNAi agents using phosphoramidite. In some embodiments, the lipid moieties can be conjugated to the 3’ end of the sense or antisense strand of the ATXN2 RNAi agents using phosphoramidite. In some embodiments, a phosphoramidite selected from HO-C16-p, C16-p, or C22-p (all shown below in Table 11) can be used to conjugate the lipid moieties to the ATXN2 RNAi agents.

[0133] In some embodiments, the ATXN2 RNAi agents can comprise a lipid moiety on an internal nucleotide (i.e., not on a 3’ or 5’ terminal nucleotide). In some embodiments, the internal nucleotide can be linked to the 2’ position of a ribose. In some embodiments, the ATXN2 RNAi agents can comprise aC16, uC16, cC16, or gC16 as shown in Table 11 below.

[0134] The nucleotide sequences of any of the ATXN2 RNAi agents listed in Tables 2, 3, 4, 5, 6, and 10, whether modified or unmodified, can contain a 3’ and / or 5’ targeting group, a linking group, and / or a lipid moiety. Any of the ATXN2 RNAi agent sequences listed in Tables 3, 4, 5, 6, and 10, or described elsewhere herein, that contain a 3’ or 5’ targeting group, a linking group, and / or a lipid moiety, can alternatively not contain a 3’ or 5’ targeting group, a linking group, or a lipid moiety, or can contain a different 3’ or 5’ targeting group, linking group, or pharmacokinetic modulator, including but not limited to those depicted in Table 11. Any of the duplexes of the ATXN2 RNAi agents listed in Tables 7, 8, 9A, and 10, whether modified or unmodified, can further comprise a targeting group or linking group, including but not limited to those depicted in Table 11, and the targeting group or linking group can be attached to the 3’ or 5’ end of the sense or antisense strand of the duplex of the ATXN2 RNAi agent.

[0135] Examples of certain modified nucleotides, capping moieties, lipid moieties, and linking groups are provided in Table 11.

[0136] Table 11. Structures representative of various modified nucleotides, capping moieties, lipid moieties, and linking groups (where Indicating the point of attachment .

[0137] Alternatively, other linking groups known in the art can be used. In many cases, the linking groups can be obtained commercially, or alternatively, incorporated within commercially available nucleotide phosphoramidites. (See, e.g., International Patent Application Publication No. WO 2019 / 161213, which is incorporated by reference herein in its entirety).

[0138] In some embodiments, the ATXN2 RNAi agents are delivered without conjugation to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as “naked” or “naked RNAi agents”).

[0139] In some embodiments, the ATXN2 RNAi agents are conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the ATXN2 RNAi agents to selected cells or tissues, such as CNS cells in vivo. In some embodiments, the ATXN2 RNAi agents are conjugated to a lipid moiety.

[0140] In some embodiments, a delivery vehicle can be used to deliver the RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves the delivery of the RNAi agent to a cell or tissue. The delivery vehicle can include or consist of, but is not limited to, a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0141] In some embodiments, the RNAi agent can be combined with a lipid, a nanoparticle, a polymer, a liposome, a micelle, a DPC, or other delivery system available in the art for nucleic acid delivery. The RNAi agent can also be chemically conjugated to a targeting group, a lipid (including but not limited to a cholesterol group and cholesterol group derivatives), encapsulated in a nanoparticle, a liposome, a micelle, conjugated to a polymer or a DPC (see, e.g., WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art, such as a hydrogel, a cyclodextrin, a biodegradable nanocapsule, a bioadhesive microsphere, or a protein carrier. In some embodiments, the RNAi agent can be conjugated to an antibody that has affinity for CNS cells. In some embodiments, the RNAi agent can be linked to a targeting ligand that has affinity for CNS cells or a receptor present on CNS cells.

[0142] Pharmaceutical compositions and formulations The ATXN2 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, the pharmaceutical compositions include at least one ATXN2 RNAi agent. These pharmaceutical compositions can be particularly useful for inhibiting the expression of ATXN2 mRNA in a target cell, cell population, tissue, or organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method includes administering an ATXN2 RNAi agent as described herein linked to a targeting ligand or lipid moiety to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition including the ATXN2 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0143] The pharmaceutical compositions and methods disclosed herein that include ATXN2 RNAi agents reduce target mRNA levels in a cell, cell population, cell population, tissue, organ, or subject, including by inhibiting the expression of ATXN2 mRNA in a subject by administering to the subject a therapeutically effective amount of an ATXN2 RNAi agent described herein. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that can be mediated at least in part by a reduction in ATXN2 expression. In some embodiments, the subject has been previously diagnosed as having one or more neurodegenerative diseases, such as SCA2 and ALS. In some embodiments, the neurodegenerative disease is SCA2.

[0144] In some embodiments, the subject has been previously diagnosed as having a neurodegenerative disease.

[0145] Embodiments of the present disclosure include pharmaceutical compositions for delivering ATXN2 RNAi agents to in vivo CNS cells. Such pharmaceutical compositions can include, for example, ATXN2 RNAi agents conjugated to lipid moieties.

[0146] In some embodiments, the pharmaceutical composition including the ATXN2 RNAi reagent is used to treat or manage clinical manifestations in subjects who would benefit from inhibition of ATXN2 expression. In some embodiments, a therapeutically or preventively effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some embodiments, administration of any disclosed ATXN2 RNAi reagent may be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0147] In some embodiments, the ATXN2 RNAi reagent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent may be another ATXN2 RNAi reagent (e.g., an ATXN2 RNAi reagent targeting a different sequence within the ATXN2 gene). In some embodiments, the second therapeutic agent may be an RNAi reagent targeting the ATXN2 gene. Additional therapeutic agents may also be small molecule drugs, antibodies, antibody fragments, and / or aptamers. The ATXN2 RNAi reagent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.

[0148] The pharmaceutical composition comprising an ATXN2 RNAi reagent can be used to treat at least one symptom in a subject suffering from a disease or condition that would benefit from a reduction or inhibition of ATXN2 mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an ATXN2 RNAi reagent is administered to the subject to treat the symptom. In other embodiments, a preventatively effective amount of one or more ATXN2 RNAi reagents is administered to the subject to prevent or inhibit at least one symptom.

[0149] In some embodiments, one or more of the ATXN2 RNAi reagents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0150] The route of administration is the path by which the ATXN2 RNAi reagent comes into contact with the body. Generally, methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The ATXN2 RNAi reagent disclosed herein can be administered via any suitable route in formulations appropriately tailored to a particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration. In some embodiments, the pharmaceutical compositions can be administered, for example, by intravenous, intramuscular, intradermal, subcutaneous, intraventricular, intra-articular, or intraperitoneal or local injection.

[0151] The pharmaceutical compositions including the ATXN2 RNAi agents described herein can be delivered to a cell, a population of cells, a tissue, or a subject using oligonucleotide delivery techniques known in the art. In general, any suitable method known in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intraventricular, intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal suction administration, or intratracheal administration. For example, in some embodiments, it is desirable that the ATXN2 RNAi agents described herein inhibit ATXN2 gene expression in the CNS.

[0152] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0153] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one therapeutic compound described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance other than an active pharmaceutical ingredient (API, therapeutic product, e.g., an ATXN2 RNAi agent) that is intentionally included in a drug delivery system. An excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. Excipients can act to: a) aid in the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptance of the API, c) aid in product identification, and / or d) enhance the overall safety, effectiveness of API delivery during storage or use of any other attribute. A pharmaceutically acceptable excipient can or can not be an inert substance.

[0154] Excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextrans, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorants, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents.

[0155] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0156] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0157] Formulations suitable for intra-articular administration can be in the form of sterile aqueous preparations of the drug which can be in the form of a microcrystalline, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymeric systems can also be used to present the drug for intra-articular and intraocular administration.

[0158] The active compounds can be prepared with carriers that protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0159] The ATXN2 RNAi agents can be formulated in dosage unit form in composition for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such active compound for the treatment of individuals.

[0160] The pharmaceutical composition can contain other additional components typically found in pharmaceutical compositions. Such additional components include, but are not limited to: antipruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also contemplated that a cell, tissue, or isolated organ expressing or comprising an RNAi agent as defined herein can be used as a “pharmaceutical composition.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to the amount of an RNAi agent that produces a pharmacological, therapeutic, or prophylactic result.

[0161] In some embodiments, in addition to administering an RNAi agent disclosed herein, the methods disclosed herein further comprise the step of administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another ATXN2 RNAi agent (e.g., an ATXN2 RNAi agent that targets a different sequence within the ATXN2 target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0162] In some embodiments, described herein are compositions comprising a combination or cocktail of at least two ATXN2 RNAi agents having different sequences. In some embodiments, the two or more ATXN2 RNAi agents are each separately and independently linked to a lipid.

[0163] Described herein are compositions for delivering an ATXN2 RNAi agent to cells of the central nervous system. Further, described herein generally are compositions for delivering an ATXN2 RNAi agent to cells in vivo, including neurons, astrocytes, microglia, and endothelial cells.

[0164] Generally, an effective amount of the ATXN2 RNAi agents disclosed herein is in the range of about 0.0001 to about 20 mg / kg body weight, for example, about 0.001 to about 5 mg / kg body weight. In some embodiments, an effective amount of the ATXN2 RNAi agent is in the range of about 0.01 mg / kg to about 3.0 mg / kg body weight per dose. In some embodiments, an effective amount of the ATXN2 RNAi agent is in the range of about 0.03 mg / kg to about 2.0 mg / kg body weight per dose. In some embodiments, an effective amount of the ATXN2 RNAi agent is in the range of about 0.01 to about 1.0 mg / kg dose / body weight. In some embodiments, an effective amount of the ATXN2 RNAi agent is in the range of about 0.50 to about 1.0 mg / kg dose / body weight. The amount administered will also likely depend on such variables as the overall health of the patient, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Additionally, it is appreciated that the initial dose administered can be increased beyond the upper level indicated above to rapidly reach the desired blood level or tissue level, or the initial dose can be less than the optimal dose. In some embodiments, a dose is administered every day. In some embodiments, a dose is administered every week. In further embodiments, a dose is administered every two weeks, every three weeks, once a month, or once a quarter (i.e., once every three months).

[0165] For the treatment of a disease or for the formation of a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein, including the ATXN2 RNAi agents, can be combined with an excipient or a second therapeutic agent or therapy, including but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0166] When incorporated into a pharmaceutically acceptable excipient or adjuvant, the ATXN2 RNAi agents can be packaged into a kit, container, package, or dispenser.

[0167] Methods of treatment and inhibition of ATXN2 expression The ATXN2 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from the administration of an RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and / or inhibition of ATXN2 mRNA expression and / or a reduction in ATXN2 protein levels.

[0168] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or condition for which the subject would benefit from a reduction in mutant ATXN2 protein, including but not limited to, Spinocerebellar ataxia type 2 and ALS. Treatment of a subject can include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more of the ATXN2 RNAi agents described herein is administered to the subject. The subject can be a human, patient, or human patient. The subject can be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein can be for a human or an animal.

[0169] Mutant ATXN2 activity is known to contribute to neurodegenerative disorders. In some embodiments, the ATXN2 RNAi agents described are used to treat a subject for at least one symptom mediated at least in part by a reduction in mutant ATXN2 levels. A therapeutically effective amount of any one or more of the ATXN2 RNAi agents described is administered to the subject. In some embodiments, a prophylactically effective amount of any one or more of the RNAi agents described is administered to the subject to treat the subject by preventing or inhibiting at least one symptom.

[0170] In certain embodiments, the disclosure provides a method for treating a disease, disorder, condition, or pathological state in a patient in need thereof that is mediated at least in part by ATXN2 gene expression, wherein the method comprises administering to the patient any of the ATXN2 RNAi agents described herein.

[0171] In some embodiments, the ATXN2 RNAi agents are used to treat or manage a clinical manifestation or pathological state in a subject, wherein the clinical manifestation or pathological state is mediated at least in part by a reduction in ATXN2 expression. A therapeutically effective amount of one or more of the ATXN2 RNAi agents described herein, or a composition comprising an ATXN2 RNAi agent, is administered to the subject. In some embodiments, the method comprises administering to the subject to be treated a composition comprising an ATXN2 RNAi agent described herein.

[0172] In a further aspect, the disclosure features a method of treating (including prophylactic or preventative treatment) a disease or symptom that can be addressed by a reduction in mutant ATXN2 levels, the method comprising administering to a subject in need thereof an ATXN2 RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2, Table 3, or Table 10. Compositions for use in such methods are also described herein.

[0173] The ATXN2 RNAi agents and / or compositions including ATXN2 RNAi agents can be used in methods of therapeutic treatment of a disease or condition caused by enhanced or elevated levels of mutant ATXN2. Such methods include administering an ATXN2 RNAi agent as described herein to a subject, e.g., a human or animal subject.

[0174] In another aspect, the present disclosure provides methods for treating (including prophylactic treatment) of a pathological state (e.g., a condition or disease) mediated at least in part by ATXN2 expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2, Table 3, or Table 10.

[0175] In some embodiments, disclosed herein are methods for inhibiting ATXN2 gene expression, wherein the method comprises administering to a cell an RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2, Table 3, or Table 10.

[0176] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) of a pathological state mediated at least in part by ATXN2 expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0177] In some embodiments, disclosed herein are methods for inhibiting ATXN2 gene expression, wherein the method comprises administering to a cell an RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0178] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) of a pathological state mediated at least in part by ATXN2 expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising a sequence of any sequence in Table 3 or Table 10.

[0179] In some embodiments, disclosed herein are methods for inhibiting ATXN2 gene expression, wherein the method comprises administering to a cell an RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising a sequence of any sequence in Table 3 or Table 10.

[0180] In some embodiments, disclosed herein are methods of inhibiting expression of an ATXN2 gene, wherein the method comprises administering to the subject an ATXN2 RNAi agent comprising a sense strand consisting of the nucleobase sequence of any sequence in Table 4, 5, 6, or 10, and an antisense strand consisting of the nucleobase sequence of any sequence in Table 3 or 10. In other embodiments, disclosed herein are methods of inhibiting expression of an ATXN2 gene, wherein the method comprises administering to the subject an ATXN2 RNAi agent comprising a sense strand consisting of the modified sequence of any modified sequence in Table 4, 5, 6, or 10, and an antisense strand consisting of the modified sequence of any modified sequence in Table 3 or 10.

[0181] In some embodiments, disclosed herein are methods for inhibiting expression of an ATXN2 gene in a cell, wherein the method comprises administering one or more ATXN2 RNAi agents comprising the duplex structure of one of the duplexes set forth in Tables 7, 8, 9A, and 10.

[0182] In some embodiments, the level of gene expression and / or mRNA level of the ATXN2 gene in certain CNS cells of a subject to which the ATXN2 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to administration of the ATXN2 RNAi agent or a subject that has not received the ATXN2 RNAi agent. In some embodiments, the level of ATXN2 mRNA or ATXN2 protein in certain CNS cells of a subject to which the ATXN2 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to administration of the ATXN2 RNAi agent or a subject that has not received the ATXN2 RNAi agent. The level of gene expression, protein level, and / or mRNA level in a subject can be reduced in cells, cell populations, and / or tissues of the subject. In some embodiments, the level of ATXN2 mRNA in certain CNS cells in a subject to which the ATXN2 RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to administration of the ATXN2 RNAi agent or a subject that has not received the ATXN2 RNAi agent.

[0183] Reduction in gene expression, mRNA, and protein levels can be assessed by any method known in the art. Reduction or decrease in ATXN2 mRNA and / or ATXN2 protein levels are collectively referred to herein as a decrease, reduction, or inhibition of ATXN2 expression. The examples set forth herein illustrate known methods for assessing ATXN2 expression and inhibition of ATXN2 gene expression.

[0184] Cells, tissues, organs, and non-human organisms Cells, tissues, organs, and non-human organisms comprising at least one ATXN2 RNAi agent described herein are contemplated. The cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi agent to the cells, tissues, organs, or non-human organisms.

[0185] Additional illustrative embodiments Certain additional illustrative embodiments of the disclosed technology are provided herein. These embodiments are illustrative only and do not limit the scope of the disclosure or the appended claims.

[0186] Embodiment 1. An RNAi agent for inhibiting expression of ataxin-2 (ATXN2) gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

[0187] Embodiment 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.

[0188] Embodiment 3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity to the antisense strand over 17 contiguous nucleotides.

[0189] Embodiment 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the ATXN2 RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

[0190] Embodiment 5. The RNAi agent of any one of embodiments 1-4, wherein all or substantially all nucleotides are modified nucleotides.

[0191] Embodiment 6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from the group consisting of: 2’-O-methyl nucleotides, 2’-fluoro nucleotides, 2’-deoxy nucleotides, 2’,3’-seco nucleotide mimics, locked nucleotides, 2’-F- arabino nucleotides, 2’-methoxyethyl nucleotides, abasic nucleotides, ribo thols, inverted nucleotides, inverted 2’-O-methyl nucleotides, inverted 2’-deoxy nucleotides, 2’-amino modified nucleotides, 2’-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate containing nucleotides, cyclopropyl phosphonate containing nucleotides, and 3’ O-methyl nucleotides.

[0192] Embodiment 7. The RNAi agent of embodiment 5, wherein all or substantially all nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0193] Embodiment 8. The RNAi agent of any of embodiments 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.

[0194] Embodiment 9. The RNAi agent of any of embodiments 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

[0195] Embodiment 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

[0196] Embodiment 11. The RNAi agent of any of embodiments 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0197] Embodiment 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.

[0198] Embodiment 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

[0199] Embodiment 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0200] Embodiment 15. The RNAi agent of embodiment 14, wherein the RNAi agent has two blunt ends.

[0201] Embodiment 16. The RNAi agent of any of embodiments 1-15, wherein the sense strand comprises one or two terminal caps.

[0202] Embodiment 17. The RNAi agent of any of embodiments 1-16, wherein the sense strand comprises one or two inverted deoxyabasic residues.

[0203] Embodiment 18. The RNAi agent of embodiment 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7, Table 8, Table 9A, or Table 10.

[0204] Embodiment 19. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides.

[0205] Embodiment 20. The RNAi agent of embodiment 19, wherein all or substantially all of the nucleotides are modified nucleotides.

[0206] Embodiment 21. The RNAi agent of any one of embodiments 19-20, wherein the sense strand further comprises an inverted abasic residue at the 3' terminal end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

[0207] Embodiment 22. The RNAi agent of any one of embodiments 1-21, wherein the RNAi agent is linked to a lipid moiety.

[0208] Embodiment 23. The RNAi agent of embodiment 22, wherein the lipid moiety is selected from: wherein indicates the point of linkage to the RNAi agent.

[0209] Embodiment 24. The RNAi agent of embodiment 22 or embodiment 23, wherein the lipid moiety is conjugated to the sense strand.

[0210] Embodiment 25. The RNAi agent of embodiment 24, wherein the lipid moiety is conjugated to the 5' terminal end of the sense strand.

[0211] Embodiment 26. A composition comprising the RNAi agent of any one of embodiments 1-25, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0212] Embodiment 27. The composition of embodiment 26, further comprising a second RNAi agent capable of inhibiting expression of the ataxin-2 gene.

[0213] Embodiment 28. The composition of any one of embodiments 26-27, further comprising one or more additional therapeutic agents.

[0214] Embodiment 29. The composition of any one of embodiments 26-28, wherein the RNAi agent is a sodium salt.

[0215] Embodiment 30. The composition of any one of embodiments 26-29, wherein the pharmaceutically acceptable excipient is water for injection.

[0216] Embodiment 31. The composition of any one of embodiments 26-29, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

[0217] Embodiment 32. A method for inhibiting expression of an ATXN2 gene in a cell, the method comprising introducing into the cell an effective amount of the RNAi agent of any one of embodiments 1-25 or the composition of any one of embodiments 26-31.

[0218] Embodiment 33. The method of embodiment 32, wherein the cell is in a subject.

[0219] Embodiment 34. The method of embodiment 33, wherein the subject is a human subject.

[0220] Embodiment 35. The method of any one of embodiments 32-34, wherein the ataxin-2 (ATXN2) gene expression is inhibited by at least about 30% following administration of the RNAi agent.

[0221] Embodiment 36. A method of treating one or more symptoms or diseases associated with enhanced or elevated levels of membrane ATXN2 activity, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of embodiments 26-31.

[0222] Embodiment 37. The method of embodiment 36, wherein the disease is a neurodegenerative disease.

[0223] Embodiment 38. The method of embodiment 37, wherein the neurodegenerative disease is Spinocerebellar ataxia type 2 (SCA2).

[0224] Embodiment 39. The method of embodiment 37, wherein the disease is ALS.

[0225] Embodiment 40. The method of any one of embodiments 32-39, wherein the RNAi agent is administered at a dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject’s body weight.

[0226] Embodiment 41. The method of any one of embodiments 32-40, wherein the RNAi agent is administered at a dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject’s body weight.

[0227] Embodiment 42. The method of any one of embodiments 32-41, wherein the RNAi agent is administered in two or more doses.

[0228] Embodiment 43. Use of the RNAi agent of any one of embodiments 1-25 for treating a disease, disorder, or symptom mediated at least in part by mutant ATXN2 activity and / or ATXN2 gene expression.

[0229] Embodiment 44. Use of a composition according to any one of embodiments 26-31 for the treatment of a disease, disorder, or condition mediated at least in part by ataxin-2 (ATXN2) activity and / or ataxin-2 (ATXN2) gene expression.

[0230] Embodiment 45. Use of a composition according to any one of embodiments 26-31 for the manufacture of a medicament for the treatment of a disease, disorder, or condition mediated at least in part by ataxin-2 (ATXN2) and / or ataxin-2 (ATXN2) gene expression.

[0231] Embodiment 46. Use according to any one of embodiments 43-45, wherein the disease is a neurodegenerative disease.

[0232] Embodiment 47. A method of making an RNAi agent according to any one of embodiments 1-25, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

[0233] Embodiment 48. The method of embodiment 47, wherein the sense strand comprises a lipid moiety.

[0234] Embodiment 49. The method of embodiment 48, comprising conjugating a lipid moiety to the sense strand. Example

[0235] Example 1. Synthesis of ATXN2 RNAi reagents.

[0236] The duplexes of the ATXN2 RNAi agents disclosed herein were synthesized according to the following: A. Synthesis. The sense and antisense strands of the ATXN2 RNAi agents were synthesized according to the phosphoramidite technique on solid phase used in oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) were used. The synthesis was performed on solid supports made of controlled pore glass (CPG, 500 Å or 600 Å, from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6-(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxytrityl-N 4-(acetyl)-2'-O-methylcytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl- amino)phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methylguanosine- 3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, and 5'-O- dimethoxytrityl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro phosphoramidites carry the same protecting groups as the 2'-O-methyl RNA amidites. The 5'-dimethoxytrityl-2'-O-methyl- inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia). The inverted deoxy base (3'-O- dimethoxytrityl-2'-deoxyribo-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)- 2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite, 5'(4,4' dimethoxytrityl)-N-acetyl-2',3'-seco-cytidine, 2'-benzoyl- 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'- dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite and 5'-(4,4'-dimethoxytrityl)-2',3'-seco- uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. The TFA amino linked phosphoramidites were also purchased commercially (Thermo Fisher). The linker L6 was purchased from BroadPharm (Cat# BP-20907) as propargyl-PEG5-NHS and coupled with the NH2-C6 group from the amino linked phosphoramidite using standard coupling conditions to form -L6-C6-. The linker Alk-cyHex was similarly purchased commercially from Lumiprobe (alkyne phosphoramidite, 5'-terminal) as a propargyl containing compound phosphoramidite to form the linker -Alk-cyHex-. In each case, the thio-phosphate linkages were introduced using the conditions set out herein as specified.Cyclopropyl phosphonate phosphoramidites were synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).

[0237] Phosphoramidites containing trialkyne were dissolved in dry dichloromethane or dry acetonitrile (50 mM), while all other amidites were dissolved in dry acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM solution in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM solution in acetonitrile) were used as activator solution. Coupling times were 10 min (RNA), 90 s (2' O-Me) and 60 s (2' F). For the introduction of phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in dry acetonitrile was used.

[0238] Alternatively, the trialkyne moiety was introduced post-synthetically (see section E below). For this approach, the sense strand was functionalized with primary amine containing 5' and / or 3' terminal nucleotides. TFA amino linked phosphoramidites were dissolved in dry acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM solution in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM solution in acetonitrile) were used as activator solution. Coupling times were 10 min (RNA), 90 s (2' O-Me) and 60 s (2' F). For the introduction of phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in dry acetonitrile was used.

[0239] B. Cleavage and deprotection of support-bound oligomers After completion of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% aqueous methylamine and 28% to 31% aqueous ammonium hydroxide solution (Aldrich) at 30 °C for 1.5 h. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0240] C. Purification. Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5 PW 13 pm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, with 20% acetonitrile, and Buffer B was identical to Buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were pooled and then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G25 Fine with a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system via tangential flow filtration.

[0241] D. Annealing The complementary strands were mixed by combining equimolar solutions of RNA (sense and antisense) in 1 x PBS (phosphate buffered saline, 1 x, Corning, Cellgro) to form the RNAi agent. Some of the RNAi agents were lyophilized and stored at -15 to -25 °C. The duplex concentration was determined by measuring the absorbance of the solution at UV-Vis spectrometer in 1 x PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL cm)) and a dilution factor to determine the duplex concentration.

[0242] E. Synthesis of lipids If the lipids described herein are not included in Example 1E, it is assumed that the compound is commercially available.

[0243] Synthesis of LP183 phosphoramidite To a solution of compound 2 (2.00 g) in DCM was added TEA (2.27 mL) followed by dropwise addition of compound 1 (4.931 g) at room temperature. The mixture was then stirred at room temperature for 2 hours. The mixture was then filtered. The white solid was allowed to dry overnight. The product was a white solid, 4.267 g, 74%. LC-MS: calculated [M+H] 356.35, found 356.63.

[0244] To a mixture of compound 1 (2.54 g) in 120 mL DCM was added compound 3 (0.61 g) followed by dropwise addition of compound 2 (5.37 g) at room temperature. The mixture was then stirred at room temperature overnight. 5 mL TEA was added followed by celite. After removal of the solvent in vacuo, the residue was dry loaded onto a 40 g column. Hexanes (2% TEA) to 50% EtOAc (2% TEA) in hexanes (2% TEA) was used as a gradient to purify the product. The product was a white waxy solid, 3.462 g, 87%. LC-MS: calculated [M+H] 556.46, found 556.64.

[0245] Synthesis of LP293-p To a solution of compound 1 (73 mg), NEt3(0.112 mL) and COMU (126 mg) in DMF was added compound 2 (48.9 mg) at ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. No clear conversion was observed by LC-MS, instead the reaction was allowed to stir for 30 minutes until the bright yellow color (prior to addition of compound 2) turned to honey orange and most of the material was observed to dissolve. The reaction mixture was then washed with water, extracted with DCM, dried over Na2S04, filtered and concentrated in vacuo. The residue was purified by CombiFlash® via loading onto a 12-g column with DCM liquid with a gradient of hexanes to 100% EtOAc, where the product eluted at 30% B. The product was concentrated in vacuo to provide a white solid residue and confirmed by1H NMR in CDC13.

[0246] Synthesis of LP-310p To a solution of 1 in DCM was added DIPEA (0.057 mL), COMU (0.077 g) and 2 (0.0300 g) at room temperature. After stirring at room temperature for 2 hours, the reaction was quenched with 0.1 N HC1. The organic layer was washed with concentrated brine. After removal of the solvent, the residue was loaded onto a 4 g column. Hexanes to 50% hexanes in EtOAc was used as a gradient for purification. The product was a white solid, 46 mg, 44%. LC-MS: calculated [M+H] 422.36, found 422.61.

[0247] 1 (0.046 g) in 4N HCI / dioxane (2 mL) was stirred at room temperature overnight. After removal of the solvent in vacuo, the residue was placed under high vacuum for 3 hours. The residue was then dissolved in DCM at room temperature, followed by the addition of COMU (0.0700 g), DIPEA (0.038 mL), and 2 (0.036 g) at room temperature. After stirring at room temperature for 2 hours, the solvent was removed in vacuo. The residue was loaded onto a 4 g column. Hexanes to 50% hexanes in EtOAc was used as a gradient for purification. The product was a white solid, 21 mg, 38%. LC-MS: calculated [M+H] 514.29, found 514.61.

[0248] Synthesis of HO-C16 phosphoramidite Dissolve 1,16-hexadecanediol, N,N-diisopropylethylamine (0.100 g) in 2 mL THF. Slowly add 4,4'-dimethoxytrityl chloride (2.2 g, 6.6 mmol) as a solid. After 2 hours, concentrate the reaction by rotary evaporation and purify the product by column chromatography (25% ethyl acetate / 75% hexanes).

[0249] Dissolve DMT-O-C 16 -OH (0.200 g), bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.227 mL), and bisdiisopropylammonium tetrazolide (0.0611 g) in anhydrous DCM. Cap the reaction and stir overnight. Determine conversion via LC-MS (0.25 M NH4HCO3:H2O buffer system). Add Celite® to the reaction mixture and concentrate it in vacuo until a white powder remains. Dry load the mixture onto a silica column (12 grams) using an EtOAc / hexanes (1% triethylamine) solvent system to prevent silica gel hydrolysis. [1] Characterize the product by 31 PNMR, 1 HNMR and LC-MS.

[0250] Synthesis of C16 phosphoramidite Cetiol® (1.10 g), bis(diisopropylamino)(2-cyanoethoxy) phosphine (2.88 mL), and bisdiisopropylammonium tetrazolide (0.778 g) were dissolved in DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined via LC-MS (0.25M NH4HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated in vacuo until a white powder remained. The mixture was dry loaded onto a silica column (12 grams) using an EtOAc / hexanes (1% triethylamine) solvent system to prevent silica hydrolysis. The desired product did not remain on the column and came off shortly after loading. The product was then characterized by LC-MS, 1 HNMR and 31 PNMR of the isolated product. Final yield: 856.5 mg (93.8%).

[0251] Synthesis of a C22 phosphoramidite Cetiol® (1.10 g), bis(diisopropylamino)(2-cyanoethoxy) phosphine (2.88 mL), and bisdiisopropylammonium tetrazolide (0.778 g) were dissolved in DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined via LC-MS (0.25M NH4HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated in vacuo until a white powder remained. The mixture was dry loaded onto a silica column (12 grams) using an EtOAc / hexanes (1% triethylamine) solvent system to prevent silica hydrolysis. The desired product did not remain on the column and came off shortly after loading. The product was then characterized by LC-MS, 1 HNMR and 31 PNMR of the isolated product. Final yield: 856.5 mg (93.8%).

[0252] Synthesis of a C22 phosphoramidite Compound 2:Sodium hydride (60% dispersion in mineral oil, 4.17 g, 104 mmol) was added in 2 portions (15 minutes apart) to a cold solution of adenosine 1 (12.5 g, 46.77 mmol) in anhydrous DMF (250 mL). The cooling bath was removed and the reaction mixture was stirred at RT for 1.5 hours and 1-bromohexadecane (18 g, 59 mmol) was added. After 16 hours stirring at RT, ethanol (5 mL) was added, stirred for 15 minutes, DMF was removed on a rotary evaporator and toluene was evaporated twice to remove residual DMF. The product was isolated on a CombiFlash using a 220 g SiO2column after loading with 40 g of silica gel solids. Eluent: DCM (A) - 20% MeOH in DCM (B), B = 0 - 20% in 15 minutes then 20% for 5 minutes. The product was dried in vacuo. Yield 2.726 g. Calculated: MW 491.68. Found: MS (ES, positive ion): 492.46 [M+H]+.

[0253] Compound 3: A solution of compound solution 2 (2.7 g, 5.49 mmol) in anhydrous pyridine (40 mL) was cooled on an ice bath and TMS-Cl (2.25 mL, 17.73 mmol) was added. The reaction mixture was stirred on an ice bath for 30 minutes, benzoyl chloride (1.5 mL, 12.9 mmol) was added, the cooling bath was removed over 30 minutes and stirring was continued overnight. The reaction mixture was cooled on an ice bath over 16 hours, water (7.5 mL) was added and stirred for another 30 minutes. Concentrated NH4OH (7.5 mL) was added and all volatiles were removed on a rotary evaporator. To remove the by-product bis-acylated adduct, the crude material was dissolved in MeOH (125 mL) and treated with NH4OH (13 mL) for 25 minutes. The solvent was removed on a rotary evaporator and toluene was evaporated once. Purification was performed on a CombiFlash® using loading with silica gel (18 g) on a 80 g column using eluent: DCM - 20% MeOH in DCM, 0 - 20% in 50 minutes. Yield 2.66 g. Calculated: MW 595.79. Found: MS (ES, positive ion): 596.53 [M+H]+.

[0254] Compound 4:Compound 3 (1.55 g, 2.60 mmol) was dried using a dry rotary evaporator by successive evaporation of toluene and anhydrous pyridine. It was dissolved in anhydrous pyridine (10 mL) and DMAP (12 mg, 0.1 mmol) was added followed by dimethoxytrityl chloride (965 mg, 2.9 mmol). The reaction was stirred at RT for 16 hours. All volatiles were removed on a rotary evaporator and residual pyridine was removed by evaporation of toluene. The residue was partitioned between DCM and aqueous NaHC03solution. The organic phase was separated, the aqueous phase was extracted with DCM and the combined organic phases were dried (Na2S04) and concentrated. The product was isolated on a CombiFlash® using a 40 g column, eluent: hexanes (A) - ethyl acetate (B) + 1% Et3N, B = 20-60%, 40 minutes. Yield 1.845 g. Calculated: MW 898.16. Found: MS (ES, positive ion): 899.65 [M+H]+.

[0255] Compound 5: Compound 4 (1.845 g, 2.052 mmol) was dried by 2 evaporations of toluene. It was dissolved in anhydrous DCM (30 mL), diisopropylammonium salt tetrazole (176 mg, 1.03 mmol) and dry molecular sieves (100 mg) were added and stirred for 30 minutes. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (804 mg, 2.67 mmol) was added and stirring was continued for 16 hours. The reaction mixture was diluted 3-fold with anhydrous DCM, filtered and stirred with 150 mL of cold NaHC03solution for 5 minutes. The organic phase was separated, the aqueous phase was extracted with DCM and the combined organic phases were washed with NaHC03and dried (Na2S04). The product was isolated on a CombiFlash® using a 40 g column, eluent: hexanes (A) - ethyl acetate (B) + 1% Et3N, B = 15-60%, 30 minutes. Yield 1.386 g. Calculated: MW 1098.38. Found: MS (ES, positive ion): 1099.17 [M+H]+.

[0256] Synthesis of phosphoramidites for gC16 internal nucleotides Compound 2:A solution of N2-isobutyrylguanosine 1 (5 g, 14.15 mmol) in dry DMF (120 mL) was added to a cold flask with sodium hydride (60% dispersion in mineral oil, 1.3 g, 32.55 mmol). The cooling bath was removed and the reaction mixture was stirred at RT for 3 h and 1-bromohexadecane (5.61 g, 18.4 mmol) was added. The reaction mixture was stirred at 50 °C for 72 h and EtOH (2 mL) was added. The DMF was removed on a rotary evaporator and toluene was evaporated twice to remove residual DMF. The product was isolated on a CombiFlash® using a 120 g column after loading with 30 g of silica gel. System used for isolation: A = DCM : EtOAc (1 : 1); B = DCM : EtOAc : MeOH (9 : 9 : 2). B = 0 - 100%, 50 min. Retain fraction B = 32-70%. Yield 2.45 g. Calculated: MW 577.77. Found: MS (ES, positive ion): 579.39 [M+H]+.

[0257] Compound 3: Compound 2 (2.129 g, 3.69 mmol) was dried by 2 evaporations of toluene followed by one evaporation of dry pyridine. It was dissolved in dry pyridine (40 mL), dimethoxytrityl chloride (1.375 g, 4.06 mmol) and DMAP (18 mg, 0.148 mmol) were added and stirred overnight. All volatiles were removed on a rotary evaporator followed by 2 evaporations of toluene. The residue was dissolved in DCM (150 mL) and stirred with NaHC03(50 mL) for 3 min. The organic phase was separated, the aqueous phase was extracted with DCM and the combined organic phases were washed with NaHC03and dried (Na2S04). The product was isolated on a CombiFlash® using a 40 g column, eluent: hexane (A) - ethyl acetate (B) + 1% Et3N, B = 20-90%, 40 min. Retain fraction B = 58-70%. Yield 1.606 g. Calculated: MW 880.14. Found: MS (ES, positive ion): 881.34 [M+H]+.

[0258] Compound 4:Compound 3 (1.4 g, 1.59 mmol) was dried by 2 evaporations of toluene. It was dissolved in dry DCM (30 mL), diisopropylammonium salt tetrazole (136 mg, 0.8 mmol) and dry molecular sieves (100 mg) were added and stirred for 30 minutes. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (767 mg, 2.54 mmol) was added and stirring was continued for 16 hours. Et3N (0.3 mL) was added followed by silica gel (6 g). The mixture was concentrated in vacuo and the solid was loaded onto CombiFlash®. The product was separated using a 40 g column, eluent: hexane (A) - ethyl acetate (B) + 1% Et3N, B = 20-90%, 35 minutes. Yield 836 mg. Calculated: MW 1080.36. Found: MS (ES, positive ion): 1081.38 [M+H]+.

[0259] Synthesis of phosphoramidites for uC16 internal nucleotides Compound 2: Dry 2,2'-cyclouridine 1 (18 g, 79.6 mmol) and DMAP (486 mg, 3.98 mmol) were suspended in dry pyridine (120 mL) and treated with tert-butyl(chloro)diphenylsilane (25.6 g, 93.14 mmol). The reaction mixture was stirred at RT for 48 hours. The pyridine was removed on a rotary evaporator and the residual pyridine was co-evaporated with toluene. The residue was dissolved in ethyl acetate (200 mL) and washed with 10% H3PO4(75 mL), 5% NaCl and brine, then dried over Na2SO4. Compound 2 was isolated after purification on CombiFlash® using two 120 g SiO2columns, eluent: DCM (A) - 20% MeOH (B) in DCM, B = 0-60%. Yield 14 g. Calculated: MW 464.59. Found: MS (ES, positive ion): 465.71 [M+H]+.

[0260] Compound 3:Hexadecanol (49.6 g, 204.4 mmol) was dried in vacuo overnight. It was dissolved in dry diglyme (38 mL) with heating and cooled to RT. AlMe3(2M in heptane, 31.25 mL, 62.5 mmol) was added slowly under a stream of N2and the reaction mixture was heated at 110 °C until methane evolution ceased (30 min). It was cooled to RT and the dry uridine derivative 2 (13.2 g, 28.39 mmol) was added as a solid, dry diglyme (30 mL) was added. The reaction was heated at 140 °C for 18 h. It was partitioned between 10% H3PO4(300 mL) and EtOAc (200 mL). The aqueous layer was extracted with EtOAc; the combined organic phases were washed twice with 5% NaCl, concentrated brine and dried over Na2SO4. After filtration and concentration, the crude solid was dried by evaporation of toluene and kept in vacuo overnight. The crude product 3 (115.8 g) was used directly in the next step.

[0261] Compound 4: The crude compound 3 was dissolved in THF (130 mL), triethylamine trifluorohydrogenate (18 mL, 114 mmol) was added and the reaction mixture was stirred for 3 days. The product was partitioned between EtOAc (300 mL) and 5% aqueous NaCl (250 mL). The organic phase was separated, the aqueous phase was extracted with EtOAc, the combined organic phases were washed with concentrated brine, dried (Na2SO4) and concentrated to dryness. The product 4 was isolated after purification on 2 CombiFlash® columns with 60 g silica gel, solid loading. Eluent: DCM (A), 10% MeOH in DCM (B), B = 0-60% in 60 min. The product was dried by 2 evaporations of toluene. Yield 5.63 g. Calculated: MW 468.64. Found: MS (ES, positive ion): 469.52 [M+H]+; 491.52 [M+Na]+.

[0262] Compound 5:Compound 4 (5.63 g, 12 mmol), 4,4'-dimethoxytrityl chloride (5.2 g, 15.36 mmol) and DMAP (293 mg, 2.4 mmol) were dissolved in dry pyridine (40 mL), Et3N (2.17 mL, 15.36 mmol) was added and stirred for 16 hours. The reaction was quenched with MeOH (0.6 mL), stirred for 15 minutes, the pyridine was removed in vacuo, the residue was partitioned between EtOAc (230 mL) and 5% aqueous NaCl (230 mL). The organic phase was separated, the aqueous phase was extracted with EtOAc, the combined organic phases were washed with concentrated brine and dried over Na2S04. CombiFlash® purification using a 120 g Si02column, eluent: hexanes (A) - EtOAc (B), B = 10-50% over 60 minutes. Yield 8.271 g. Calculated: MW 771.01. Found: MS (ES, positive ion): 772.35 [M+H]+.

[0263] Compound 6: Compound 5 (2.33 g, 3.024 mmol) was dried by 2 evaporations of dry ACN and left under high vacuum for 2 hours. The dried compound 5 was dissolved in dry DCM (40 mL) and stirred with diisopropylammonium salt tetrazole (704 mg, 4.11 mmol) and molecular sieves for 20 minutes. 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (1.404 g, 4.66 mmol) was added, the reaction mixture was stirred at RT for 16 hours, diluted with dry DCM to 100 mL, the solids were filtered and shaken with cold NaHC03(100 mL) for 5 minutes. The organic layer was separated, washed with NaHC03, dried (Na2S04) and the product was purified on CombiFlash® using a 40 g Si02column. Eluent: hexanes (A) - EtOAc with 1% Et3N (B), B = 15-50%. Yield 2 g. Calculated: MW 971.23. Found: MS (ES, positive ion): 972.17 [M+H]+.

[0264] Synthesis of phosphoramidites for cC16 internal nucleotides Compound 2:The 5'-O-DMT protected uracil derivative 1 described in the preparation of cC16 (11.687 g, 15.15 mmol) was dissolved in dry pyridine (100 mL) and cooled on an ice bath. TMS-Cl (7.8 mL, 61 mmol) was added and the cooling bath was removed, the reaction was stirred at RT for 30 min and cooled again on an ice bath.

[0265] In a separate flask, 1,2,4-triazole (35 g, 50.7 mmol) was suspended in dry CAN (200 mL), cooled on an ice bath, POCl3(11.2 mL, 120 mmol) was added slowly over 10 min and stirred at 0 °C for 5 min. Et3N (84 mL, 595 mmol) was added slowly over 30 min and stirred at 0 °C for 30 min.

[0266] The cooled contents from the first flask containing the silylated uracil derivative was added in one portion to the mixture containing the 1,2,4-triazole, stirred for 10 min and the cooling bath was removed. Stirring was continued at RT for 5 h. The reaction mixture was concentrated on a rotary evaporator to 1 / 3 of its volume, diluted with EtOAc (600 mL) and washed with 5% NaCl (2 x 400 mL). The aqueous phase was back extracted with EtOAc (200 mL). The combined EtOAc layers were washed with brine and dried (Na2SO4). The EtOAc solution was filtered and concentrated and dried in vacuo to obtain the crude derivative 2 (17.46 g).

[0267] Compound 3: The crude compound 4 was dissolved in dry dioxane (220 mL) in a 1 L thick walled RB flask, concentrated ammonium hydroxide solution (50 mL) was added, the flask was sealed with a rubber septum and the reaction mixture was stirred at RT for 40 h. All volatiles were removed on a rotary evaporator. Toluene was evaporated twice to dry the residue. The product was separated on a CombiFlash using a 220 g SiO2column after loading with 35 g of silica gel. Eluent: DCM (A) - 10% MeOH in DCM (B), B = 0 - 45%, 60 min. Yield 7.81. Calculated: MW 770.02. Found: MS (ES, positive ion): 770.31 [M+H]+, 1541.24 [2M+H]+.

[0268] Compound 4:Compound 3 (6.94 g, 9 mmol) was dried by evaporation of anhydrous DMF and dissolved in anhydrous DMF (60 mL). Acetic anhydride (1.75 mL, 18 mmol) was added and stirred at RT for 16 hours. NaHC03solution (250 mL) was added and the product was extracted with DCM (2 x 200 mL). This was washed with concentrated brine (50 mL), dried (Na2S04), concentrated and dried by 2 successive evaporations of toluene. Purification was performed using a 120 g Si02column, eluents: DCM (A), 5% MeOH in DCM (B), B = 0-40% over 60 minutes. Yield 6.55 g. Calculated: MW 812.06. Found: MS (ES, positive ion): 813.36 [M+H]+.

[0269] Compound 5: Compound 4 (6.55 g, 8.07 mmol) was dried by 2 evaporations of toluene. This was dissolved in anhydrous DCM (166 mL) and stirred with diisopropylammonium salt tetrazole (2.188 g, 12.78 mmol) and molecular sieves (500 mg) for 20 minutes. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (4.376 g, 14.52 mmol) was added and the reaction mixture was stirred at RT for 16 hours, diluted with anhydrous DCM to 300 mL, the solids were filtered and shaken with cold NaHC03(150 mL) for 5 minutes. The organic layer was separated, washed with NaHC03, dried (Na2S04) and the product purified on a CombiFlash® using a 120 g Si02column. Eluents: Hexane (A) - EtOAc (B), B = 10-50%, 60 minutes. Yield 6.29 g. Calculated: MW 1012.28. Found: MS (ES, positive ion): 1013.89 [M+H]+.

[0270] Example 2. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected subcutaneously with saline or 3 mg / kg (mpk) of compound formulated in saline according to the following Table 12, using an injection volume of 200 μL per 20 g animal weight: Table 12: Dosing groups of mice for Example 2. Group ID Animals dosed Group 1 (saline) n=4 Group 2 (3 mpk AD10230) n=4 Group 3 (3 mpk AD10231) n=4 Group 4 (3 mpk AD10234) n=4 Group 5 (3 mpk AD10237) n=4 Group 6 (3 mpk AD10242) n=4 Group 7 (3 mpk AD10244) n=4 Group 8 (3 mpk AD10247) n=4 Group 9 (3 mpk AD10252) n=4 Group 10 (3 mpk AD10253) n=4 Group 11 (3 mpk AD10268) n=4 Group 12 (3 mpk AD10271) n=4 Group 13 (3 mpk AD10272) n=4

[0271] Four (n=4) mice per group were dosed. On Day 1, mice were injected subcutaneously. On Day 8, mice were euthanized and 50 mg of liver from each animal was collected. Samples were analyzed for ATXN2 knockdown by qPCR. Average results for each group are shown in Table 13 below: Table 13. Relative expression of ATXN2 mRNA in liver analyzed by qPCR for each dosing group of Example 2.

[0272] As shown in Table 13, each dosing group showed an improvement in knockdown over the saline administration group. AD10271 showed the greatest knockdown in liver (~76% reduction in ATXN2).

[0273] Example 3. In vivo knockdown of ATXN2 in mice On study Day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebrospinal fluid), 50 μg of compound formulated in aCSF, or 200 μg of compound formulated in aCSF, using an injection volume of 10 μL, according to Table 14 below: Table 14: Dosing groups of mice for Example 3. Group ID Animals dosed AC duplex number Group 1 (aCSF) n=3 N / A Group 2 (50 μg LP183-AD10517) n=4 AC002088 Group 3 (200 μg LP183-AD10517) n=4 AC002088 Group 4 (50 μg LP183-AD10518) n=4 AC002089 Group 5 (200 μg LP183-AD10518) n=4 AC002089 Group 6 (50 μg LP183-AD10519) n=4 AC002090 Group 7 (200 μg LP183-AD10519) n=4 AC002090 Group 8 (50 μg LP183-AD10520) n=4 AC002091 Group 9 (200 μg LP183-AD10520) n=4 AC002091 Group 10 (50 μg LP183-AD10521) n=4 AC002092 Group 11 (200 μg LP183-AD10521) n=4 AC002092 Group 12 (50 μg LP183-AD10522) n=4 AC002093 Group 13 (200 μg LP183-AD10522) n=4 AC002093

[0274] Four (n=4) mice per group were dosed except for Group 1, in which three (n=3) mice were dosed. On Day 1, mice were injected intracerebroventricularly. On Day 12, mice were euthanized and left hemibrains and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from thoracic spinal cord and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. Average results for each group are shown in Table 15 below: Table 15. Relative expression of ATXN2 mRNA in thoracic spinal cord and cerebellum analyzed by qPCR for each dosing group of Example 3.

[0275] As shown in Table 15, most dosing groups showed a dose-dependent improvement in knockdown over the aCSF administration group in both tissues. AC002089 showed the greatest knockdown in thoracic spinal cord at both the 50 μg (~35% reduction in ATXN2) and 200 μg (~66% reduction in ATXN2) dose levels. AC002089 also showed the greatest reduction in ATXN2 in the cerebellum at both dose levels.

[0276] Example 4. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebral spinal fluid), 100 pg of compound formulated in aCSF, using a 10 pL injection volume, according to the following Table 16: Table 16: Dosing groups for mice for Example 4. Group ID Animals dosed AC duplex number Group 1 (aCSF) n=4 N / A Group 2 (100 μg LP183-AD10518) n=4 AC002089 Group 3 (100 μg LP183-AD10520) n=4 AC002091 Group 4 (100 μg LP183-AD11306) n=4 AC002460 Group 5 (100 μg LP183-AD11307) n=4 AC002461 Group 6 (100 μg LP183-AD11308) n=4 AC002462 Group 7 (100 μg LP183-AD11309) n=4 AC002463 Group 8 (100 μg LP183-AD11310) n=4 AC002464 Group 9 (100 μg LP183-AD11311) n=4 AC002465 Group 10 (100 μg LP183-AD11312) n=4 AC002466 Group 11 (100 μg LP183-AD11313) n=4 AC002467 Group 12 (100 μg LP183-AD11314) n=4 AC002468 Group 13 (100 μg LP183-AD11315) n=4 AC002469 Group 14 (100 μg LP183-AD11316) n=4 AC002470 Group 15 (100 μg LP183-AD11317) n=4 AC002471

[0277] Four (n=4) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left half brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. The average results for each group are shown in Table 17 below: Table 17. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each dosing group for Example 4.

[0278] As shown in Table 17, all dosing groups showed improved knockdown in all tissues over the aCSF administered group. With the exception of AC02091, all RNAi agents dosed in the groups target position 499 of ATXN2. All groups showed significant knockdown, with AC002463 demonstrating the greatest reduction in ATXN2 in the thoracic spinal cord and cerebellum.

[0279] Example 5. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebral spinal fluid), 100 pg of compound formulated in aCSF, using a 10 pL injection volume, according to the following Table 18: Table 18: Dosing groups for mice for Example 5. Group ID Animals dosed AC duplex number Group 1 (aCSF) n=4 N / A Group 2 (100 μg LP183-AD10518) n=4 AC002089 Group 3 (100 μg LP183-AD11307) n=4 AC002461 Group 4 (100 μg LP183-AD11472) n=4 N / A Group 5 (100 μg LP183-AD11473) n=4 N / A Group 6 (100 μg LP183-AD11474) n=4 N / A Group 7 (100 μg LP183-AD11475) n=4 N / A Group 8 (100 μg LP183-AD11476) n=4 N / A Group 9 (100 μg LP183-AD11477) n=4 N / A Group 10 (100 μg LP183-AD11478) n=4 N / A Group 11 (100 μg LP183-AD11479) n=4 N / A Group 12 (100 μg LP183-AD11480) n=4 N / A Group 13 (100 μg LP183-AD11481) n=4 N / A Group 14 (100 μg LP183-AD11482) n=4 N / A

[0280] Four (n=4) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left half brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. The average results for each group are shown in Table 17 below: Table 19. Relative expression of ATXN2 mRNA in cerebellum analyzed by qPCR for each dosing group for Example 5.

[0281] As shown in Table 19, all dosing groups showed improvement in knockdown over the aCSF administered group in the cerebellum. Each RNAi reagent dosed to Groups 2-14 targets position 499 of hATXN2.

[0282] Example 6. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebrospinal fluid), or 100 μg of compound formulated in aCSF using a 10 μL injection volume according to Table 20 below: Table 20: Dosing groups for mice for Example 6. Group ID Animals dosed Group 1 (aCSF) n=4 Group 2 (100 μg LP183-AD11443) n=4 Group 3 (100 μg LP183-AD11534) n=4 Group 4 (100 pg LP183-AD11629) n=4 Group 5 (100 pg LP183-AD11527) n=4 Group 6 (100 pg LP183-AD11528) n=4 Group 7 (100 pg LP183-AD11529) n=4 Group 8 (100 pg LP183-AD11530) n=4 Group 9 (100 pg LP183-AD11531) n=4 Group 10 (100 pg LP183-AD11532) n=4

[0283] Four (n=4) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left half brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. Average results for each group are shown in Table 21 below: Table 21. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each dosing group for Example 6.

[0284] As shown in Table 21, all dosing groups showed improvement in knockdown over the aCSF administered group in at least one selected tissue. AD11534 (targeting position 499 of hATXN2) showed the greatest reduction in ATXN2 in the thoracic spinal cord and cortex.

[0285] Example 7. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebrospinal fluid), or 100 μg of compound formulated in aCSF using a 10 μL injection volume according to Table 22 below: Table 22: Dosing groups for mice for Example 7. Group ID Animals dosed Group 1 (aCSF) n=3 Group 2 (100 pg LP183-AD11644) n=3 Group 3 (100 pg LP183-AD11629) n=3 Group 4 (100 pg LP183-AD11645) n=3 Group 5 (100 pg LP183-AD11646) n=3 Group 6 (100 pg LP183-AD11647) n=3 Group 7 (100 pg LP183-AD11648) n=3 Group 8 (100 pg LP183-AD11649) n=3 Group 9 (100 pg LP183-AD11650) n=3 Group 10 (100 pg LP183-AD11651) n=3 Group 11 (100 pg LP183-AD11652) n=3 Group 12 (100 pg LP183-AD11653) n=3 Group 13 (100 pg LP183-AD11654) n=3 Group 14 (100 pg LP183-AD11655) n=3 Group 15 (100 pg LP183-AD11656) n=3 Group 16 (100 pg LP183-AD11657) n=3 Group 17 (100 pg LP183-AD11658) n=3 Group 18 (100 pg LP183-AD11659) n=3 Group 19 (100 pg LP183-AD11660) n=3

[0286] Three (n=3) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left half brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. Average results for each group are shown in Table 23 below: Table 23. Relative expression of ATXN2 mRNA in thoracic spinal cord and cerebellum by qPCR analysis for each dosing group of Example 7.

[0287] As shown in Table 23, all dosing groups showed improvement in knockdown over the aCSF administered group in both tissues. AD11650 showed the greatest reduction in ATXN2 in the thoracic spinal cord and AD11629 showed the greatest reduction in ATXN2 in the cerebellum.

[0288] Example 8. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebral spinal fluid), 100 pg of compound formulated in aCSF, using a 10 pL injection volume, according to the following Table 24: Table 24: Dosing groups of mice for Example 8. Group ID Animals dosed Group 1 (aCSF) n=4 Group 2 (100 pg LP183-AD11914) n=4 Group 3 (100 pg LP183-AD11915) n=4 Group 4 (100 pg LP183-AD11916) n=4 Group 5 (100 pg LP183-AD11917) n=4 Group 6 (100 pg LP183-AD11918) n=4 Group 7 (100 pg LP183-AD11919) n=4 Group 8 (100 pg LP183-AD11920) n=4 Group 9 (100 pg LP183-AD11921) n=4 Group 10 (100 pg LP183-AD11922) n=4 Group 11 (100 pg LP183-AD11923) n=4 Group 12 (100 pg LP183-AD11924) n=4 Group 13 (100 pg LP183-AD11925) n=4 Group 14 (100 pg LP183-AD11926) n=4 Group 15 (100 pg LP183-AD11927) n=4

[0289] Four (n=4) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemisphere and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. The average results for each group are shown in Table 25 below: Table 25. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex by qPCR analysis for each dosing group of Example 8.

[0290] As shown in Table 25, all dosing groups showed improvement in knockdown over the aCSF administered group in all selected tissues, with AD11916 showing the greatest knockdown in both the cortex and cerebellum.

[0291] Example 9. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebral spinal fluid), 100 pg of compound formulated in aCSF, using a 10 pL injection volume, according to the following Table 26: Table 26: Dosing groups of mice for Example 9. Group ID Animals dosed Group 1 (aCSF) n=3 Group 2 (100 pg LP183-AD11913) n=3 Group 3 (100 pg LP183-AD12007) n=3 Group 4 (100 pg LP183-AD12008) n=3 Group 5 (100 pg LP183-AD12009) n=3 Group 6 (100 pg LP183-AD12010) n=3 Group 7 (100 pg LP183-AD12011) n=3 Group 8 (100 pg LP183-AD12012) n=3 Group 9 (100 pg LP183-AD12013) n=3 Group 10 (100 pg LP183-AD12014) n=3 Group 11 (100 pg LP183-AD12015) n=3 Group 12 (100 pg LP183-AD12016) n=3 Group 13 (100 pg LP183-AD12017) n=3 Group 14 (100 pg LP183-AD12018) n=3 Group 15 (100 pg LP183-AD12019) n=3 Group 16 (100 pg LP183-AD12020) n=3

[0292] Three (n=3) mice per group were dosed. On Day 1, mice were injected intracerebroventricularly. On Day 8, mice were euthanized and left hemi-brains and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from thoracic spinal cord, cortex, and cerebellum. Samples were analyzed for ATXN2 knockdown by qPCR. Average results for each group are shown in Table 27 below: Table 27. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each dosing group of Example 9.

[0293] As shown in Table 27, all dosing groups showed improved knockdown over the aCSF administration group in at least two selected tissues. AD12008 showed significant knockdown in the cortex.

[0294] Example 10. In vivo knockdown of ATXN2 in cynomolgus monkeys On study Day 1, cynomolgus monkeys were injected with either artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or a compound formulation containing 60 mg of AD13051 in aCSF according to Table 28 below: Table 28: Dosing groups for non-human primates for Example 10. Group ID Animals dosed Group 1 (aCSF) - Day 29 n=3 Group 2 (60 mg AD13051) - Day 29 n=6 Group 3 (60 mg AD13051) - Day 85 n=6 Group 4 (60 mg AD13051) - Day 169 n=6 Group 5 (60 mg AD13051) - Day 253 n=5

[0295] Three (n=3) monkeys in Group 1 (control), six monkeys in Groups 2, 3, and 4 (triggered treatment), and five (n=5) monkeys in Group 5 (triggered treatment) were dosed. On Day 1, monkeys were injected intrathecally. On study Day 29, animals from Groups 1 and 2 were euthanized and brain and spinal cord tissue was collected from each animal. On study Day 85, animals from Group 3 were euthanized and brain and spinal cord tissue was collected from each animal. On study Day 168, animals from Group 4 were euthanized and brain and spinal cord tissue was collected from each animal. On study Day 253, animals from Group 5 were euthanized and brain and spinal cord tissue was collected from each animal.

[0296] Intrathecal injection in NHPs is a challenging procedure and due to limited space and accessibility, misplacement of the injection needle and leakage of test article are frequently observed with incorrect dosing. To adjust for incorrect dosing in the analysis of protein and expression levels, criteria for incorrect dosing were defined in order to exclude animals with incorrect dosing.

[0297] The misdose criteria were based solely on tissue distribution of the siRNA compound. A cynomolgus monkey was determined to be misdosed and excluded from analysis if approximately 50% or more of the brain tissue region analyzed had a compound concentration that was less than 25% of the group mean. Of the total twenty-six (26) NHPs that received the test article, ten (10) animals were identified as misdosed and the protein expression level data was excluded from analysis. Due to misdosing, three animals were excluded from Group 2, two animals were excluded from Group 3, three animals were excluded from Group 4, and two animals were excluded from Group 5.

[0298] Tissues were lysed in RIPA buffer (ThermoFisher, #89901) with protease / phosphatase inhibitors (Halt, #87786) added. Total protein concentration was calculated for each sample using BCA (Pierce Protein Assay Kit #23225) and all samples were diluted to 5 mg / ml or appropriate dilution using RIPA lysis buffer. 3 uL of each diluted tissue sample was combined with 1.5 uL of 5x sample mix (from JESS EZ Standard Pack 3, #PS-ST03EZ-8) and 3 uL of 0.1x sample buffer (2 mg / mL final sample concentration). The samples were then spun down, boiled at 70°C for 10 minutes, spun down again, and cooled on ice. The samples were mixed gently by pipetting up and down before loading onto the JESS plate (JESS 66-440 kDa Separation Module, #SM-W008). The JESS plate was loaded according to the Simple Western instructions. Briefly, 3 uL of sample (2 mg / mL) was loaded into each well of the plate. The ATXN2 primary antibody (BD Biosciences, #611378) was diluted 1:400 and the a-actinin (Cell Signaling, #6487) was diluted 1:100 and loaded onto the plate. Secondary antibodies were also loaded, including anti-mouse secondary antibody (for ATXN2 from JESS Anti-Mouse Detection Module, #DM-002) and anti-rabbit secondary antibody (for a-actinin from JESS Anti-Rabbit Detection Module, #DM-001). After all reagents were added according to the Simple Western instructions, the plate was loaded onto the instrument and run using the JESS default RePlex protocol (instrument built-in protocol, JESS Replex Module, RP-001). TM EZ Standard Pack 3, #PS-ST03EZ-8) and 3 uL of 0.1x sample buffer (2 mg / mL final sample concentration). The samples were then spun down, boiled at 70°C for 10 minutes, spun down again, and cooled on ice. The samples were mixed gently by pipetting up and down before loading onto the JESS plate (JESS 66-440 kDa Separation Module, #SM-W008). The JESS plate was loaded according to the Simple Western instructions. Briefly, 3 uL of sample (2 mg / mL) was loaded into each well of the plate. The ATXN2 primary antibody (BD Biosciences, #611378) was diluted 1:400 and the a-actinin (Cell Signaling, #6487) was diluted 1:100 and loaded onto the plate. Secondary antibodies were also loaded, including anti-mouse secondary antibody (for ATXN2 from JESS Anti-Mouse Detection Module, #DM-002) and anti-rabbit secondary antibody (for a-actinin from JESS Anti-Rabbit Detection Module, #DM-001). After all reagents were added according to the Simple Western instructions, the plate was loaded onto the instrument and run using the JESS default RePlex protocol (instrument built-in protocol, JESS Replex Module, RP-001).

[0299] Table 29 below shows the average results for each group relative to Group 1: Table 29. For each dosing group of Example 10, the protein expression levels were determined by JESSTM Relative amounts of ATXN2 protein in various tissues analyzed. After animal data was removed from the dataset for meeting error dosing criteria.

[0300] The reduction in ATXN2 protein in CNS tissue samples reached a maximum at study day 29 with an average reduction of approximately 80-90% in all major brain regions evaluated. This overall reduction in ATXN2 protein of 80-90% observed at day 29 began to recover over time to approximately 50-70% at day 85, approximately 50% at day 169, and less than 50% at day 253, with exact values varying across specific tissues. Focusing on the cerebellum, the major brain region affected in SCA2 patients, ATXN2 protein showed a reduction of approximately 83% at day 29, 50% at day 85, 64% at day 169, and approximately 8% at day 253. The lumbar spinal cord, closest to the injection site, showed the most robust and consistent reduction in ATXN2 protein over time with reductions of approximately 95% at day 29, 88% at day 85, 81% at day 169, and 75% at day 253.

[0301] Example 11. In vivo knockdown of ATXN2 in cynomolgus monkeys On study day 1, cynomolgus monkeys were injected with either artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier), or a compound formulation containing 5 mg, 15 mg, or 30 mg of AD13051 in aCSF, according to Table 28 below: Table 30: Dosing groups for non-human primates for Example 11. Group ID Animals dosed Group 1 (aCSF) n=4 Group 2 (5 mg AD13051) n=6 Group 3 (15 mg AD13051) n=6 Group 4 (30 mg AD13051) n=6

[0302] Four (n=4) monkeys in Group 1 (control) were dosed, and six monkeys in Groups 2, 3, and 4 (triggered agent treated) were dosed. On day 1, monkeys were injected intrathecally. Animals were euthanized on study day 29, and brain and spinal cord tissues were collected from each animal.

[0303] Intrathecal injection in NHPs is a challenging procedure, and due to limited space and accessibility, misplacement of the injection needle and leakage of test article are frequently observed errors in dosing. To adjust for errors in dosing in the analysis of protein and expression levels, error dosing criteria were defined such that animals with improper dosing were excluded.

[0304] The erroneous dosing criteria were based solely on the tissue distribution of the siRNA compound. Cynomolgus monkeys were identified as erroneously dosed and excluded from the analysis if approximately 50% or more of the analyzed brain tissue regions had compound concentrations below 25% of the group mean. Of the total twenty-six (26) NHPs that received the test item, ten (10) were identified as erroneously dosed, and protein expression level data were excluded from the analysis. Three animals were excluded from group 2, one from group 3, and three from group 4 due to erroneous dosing.

[0305] Tissues were lysed in RIPA buffer (ThermoFisher, #89901) with added protease / phosphatase inhibitor (Halt, #87786). Total protein concentrations were calculated for each sample using BCA (Pierce Protein Assay Kit #23225), and all samples were diluted to 5 mg / ml or as appropriate using RIPA lysis buffer. 3 μL of each diluted tissue sample was mixed with 1.5 μL of a 5x sample mixture (from JESS). TM Combine EZ Standard Pack 3 (#PS-ST03EZ-8) and 3 μL of 0.1x sample buffer (final sample concentration of 2 mg / mL). Then, rotate the sample downwards, boil at 70°C for 10 minutes, rotate downwards again, and cool on ice. Before loading onto the JESS plate (JESS 66-440 kDa separation module, #SM-W008), gently mix the sample by up-and-down aspiration. Load the JESS plate according to the Simple Western instructions. Briefly, load 3 μL of sample (2 mg / mL) into each well of the plate. ATXN2 primary antibody (BDBiosciences, #611378) was diluted 1:400, and α-actin (CellSignaling, #6487) was diluted 1:100 and loaded onto the plate. Secondary antibodies were also loaded, including an anti-mouse secondary antibody (targeting ATXN2, from the JESS anti-mouse detection module, #DM-002) and an anti-rabbit secondary antibody (targeting α-actin, from the JESS anti-rabbit detection module, #DM-001). After adding all reagents according to the Simple Western instructions, the plate was loaded onto the instrument and run using the default JESS Replex protocol (instrument-built-in protocol, JESS Replex Module, RP-001).

[0306] Table 31 below shows the average results for each group relative to group 1: Table 31. For each dosing group in Example 11, via JESS TMRelative amounts of ATXN2 protein in various tissues analyzed. After removal of animal data from the dataset for meeting error dosing criteria.

[0307] The largest ATXN2 protein reduction was observed in the spinal cord proximal to the intrathecal injection site, with 75% reduction at 5 mg and ~90% reduction at 15 mg and 30 mg doses in the lumbar region, and 35-40% reduction at 5 mg and 60-70% reduction at 15 mg and 30 mg in the cervical and thoracic regions. In the cerebellum and major cortical regions analyzed in this study, the largest ATXN2 protein reduction was achieved at the lowest dose of 5 mg, with approximately 58% reduction in the cerebellum and approximately 67%, 75%, and 54% reduction in the frontal, temporal, and motor cortices, respectively.

[0308] Example 12. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebrospinal fluid), or 18.75 μg, 37.5 μg, 75 μg, 150 μg, or 300 μg of compound formulated in aCSF using a 10 μL injection volume, according to Table 26 below: Table 32: Dosing groups for mice of Example 12. Group ID Animals dosed Group 1 (aCSF) n=4 Group 2 (18.75 pg AD11916) n=4 Group 3 (37.5 pg AD11916) n=4 Group 4 (75 pg AD11916) n=4 Group 5 (150 pg AD11916) n=4 Group 6 (300 pg AD11916) n=4 Group 7 (18.75 pg AD13051) n=4 Group 8 (37.5 pg AD13051) n=4 Group 9 (75 pg AD13051) n=4 Group 10 (150 pg AD13051) n=4 Group 11 (300 pg AD13051) n=4

[0309] Four (n=4) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 33 below: Table 33. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each dosing group of Example 12.

[0310] As shown in Table 33, AD11916 and AD13051 each showed dose-dependent increases in knockdown across all tissues assayed, with particularly high knockdown in the thoracic spinal cord. AD13051 linked to LP-293 PK / PD modulator generally showed increased ATXN2 knockdown over AD11916 linked to LP-183.

[0311] Example 13. In vivo knockdown of ATXN2 in mice On study day 1, C57bl / 6 mice were injected intracerebroventricularly with aCSF (artificial cerebrospinal fluid), or 18.75 pg, 37.5 pg, 75 pg, 150 pg, or 300 pg of compound formulated in aCSF using a 10 pL injection volume according to Table 26 below: Table 32: Dosing groups for mice for Example 12. Group ID Animals dosed Group 1 (aCSF) n=4 Group 2 (18.75 μg AD12008) n=4 Group 3 (37.5 μg AD12008) n=4 Group 4 (75 μg AD12008) n=4 Group 5 (150 μg AD12008) n=4 Group 6 (300 μg AD12008) n=4 Group 7 (18.75 μg AD13052) n=4 Group 8 (37.5 μg AD13052) n=4 Group 9 (75 μg AD13052) n=4 Group 10 (150 μg AD13052) n=4 Group 11 (300 μg AD13052) n=4

[0312] Four (n=4) mice per group were dosed. On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for ATXN2 knockdown by qPCR. The average results for each group are shown in Table 33 below: Table 33. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, cortex, and brainstem analyzed by qPCR for each dosing group for Example 12.

[0313] As shown in Table 33, AD12008 and AD13052 each showed a dose-dependent increase in knockdown across all tissues assayed, with particularly high knockdown in the thoracic spinal cord. AD13052 linked to the LP-293 PK / PD modulator generally showed increased ATXN2 knockdown over AD12008 linked to LP-183.

[0314] Example 13. In vivo knockdown of ATXN2 in mice For this experiment, the transgenic mouse model BAC-Q22, which expresses a normal number of hATXN2 genes with 22 CAG repeats, was used. On study day 1, mice were administered ICV injections of aCSF or AD13051 at different concentrations (Table 34). Clinical observations were completed 3 hours and 24 hours post-dose, and daily health checks were performed during the study period. On study day 15, animals were weighed, then humanely euthanized by administration of isoflurane followed by transcardial perfusion. Thoracic spinal cord and cerebellum were collected for downstream analysis.

[0315] Table 34. Dosing groups for mice for Example 34.

[0316] RNA was extracted from frozen tissue and purified using Qiagen RNeasy Mini Kit (Cat. No. 74106) according to standard protocol. Reverse transcription was performed using ThermoFisher High-Capacity cDNA Reverse Transcription Kit (Cat. No. 4368814) according to manufacturer’s instructions. qPCR was performed on a Quantstudio 12K Flex Real-Time PCR System (Applied Biosystems) using human ATXN2 Taqman assay ID Hs00268077_m1 and mouse beta actin (mACTB) Taqman assay ID Mm02619580_g1 (ThermoFisher) For RNA from spinal cord tissue, qPCR was performed in quadruplicate using hATXN2 and mACTB Taqman multiplex assays. Quantification of each transcript was determined using standard curves. After normalizing hATXN2 to mACTB in each reaction, the mean value of the four replicate wells was determined for each RNA sample.

[0317] For RNA from cerebellum tissue, hATXN2 and mACTB reactions were performed in triplicate and quadruplicate, respectively, for each animal sample. The ACt method was used to determine the level of hATXN2 expression normalized to mACTB after averaging the Ct replicates for each sample.

[0318] Protein extracts were prepared by homogenization of mouse cerebellum in extraction buffer (25 mM Tris-HCl pH 7.6, 300 mM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgCl2, 0.5 M urea and protease inhibitors; Sigma; Cat# P-8340) followed by centrifugation at 16,100 x g for 20 min at 4°C. Only the supernatant was used for Western blot to determine the steady-state levels of proteins. Protein extracts were resolved by SDS-PAGE and transferred to Hybond P membrane (Amersham Bioscience Inc., USA). After blocking with 5% nonfat milk in 0.1% Tween 20 / PBS, the membranes were incubated with primary antibodies in 5% nonfat milk in 0.1% Tween 20 / PBS for 2 h at room temperature or overnight at 4°C. After washing in 0.1% Tween 20 / PBS, the membranes were incubated with the corresponding secondary antibodies conjugated to HRP in 5% nonfat milk in 0.1% Tween 20 / PBS for 2 h at room temperature and washed again. Signals were detected by using Immobilon Western Chemiluminescent HRP Substrate (Millipore Inc., USA; Cat# WBKLSO100) according to the manufacturer’s protocol. The intensity of the proteins was determined using ImageJ software analysis system and quantified as a ratio to β-actin. ATXN2 monoclonal antibody (BD Biosciences Inc., Cat# 611378) was used at 1:4000. Secondary antibody was goat anti-mouse IgG-HRP (1:5000) (Sigma Inc., Cat# A2304). ACTB monoclonal antibody was HRP-conjugated and used at 1:10,000 (Sigma-Aldrich, Cat# A3854).

[0319] Reduction of hATNX2 mRNA and protein is shown in Tables 35 and 36, respectively.

[0320] Table 35. Relative expression of hATXN2 mRNA in spinal cord and cerebellum by qPCR analysis for each dosing group of Example 13.

[0321] Table 36. Relative hATXN2 protein in cerebellum by qPCR analysis for each dosing group of Example 13. *Data not available.

[0322] AD13051 showed a generally dose-dependent response in mice expressing hATXN2. AD13051 demonstrated deep ATXN2 protein knockdown at doses as low as 30 pg.

[0323] Other Embodiments It is to be understood that while the application has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the application, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the claims.

Claims

1. An RNAi reagent for inhibiting the expression of ataxia protein-2 (ATXN2) gene, comprising: The antisense strand comprises at least 17 adjacent nucleotides that differ from any of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi reagent according to claim 1, wherein the antisense strand comprises nucleotides 2-18 of any of the sequences provided in Table 2 or Table 3.

3. The RNAi reagent according to claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 adjacent nucleotides differing from any of the sequences provided in Table 2 or Table 4 by 0 or 1 nucleotide, and wherein the sense strand has a region on the 17 adjacent nucleotides that is at least 85% complementary to the antisense strand.

4. The RNAi reagent according to any one of claims 1-3, wherein at least one nucleotide of the RNAi reagent is a modified nucleotide or includes a modified internucleotide bond.

5. The RNAi reagent according to any one of claims 1-4, wherein all or substantially all nucleotides are modified nucleotides.

6. The RNAi reagent according to any one of claims 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-open-ring nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methyl nucleotide.

7. The RNAi reagent according to claim 5, wherein all or substantially all nucleotides are modified with 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

8. The RNAi reagent according to any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3.

9. The RNAi reagent according to any one of claims 1-8, wherein the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 4.

10. The RNAi reagent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3, and the sense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 4.

11. The RNAi reagent according to any one of claims 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

12. The RNAi reagent according to claim 11, wherein the sense strand and antisense strand are each 18 to 27 nucleotides in length.

13. The RNAi reagent according to claim 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

14. The RNAi reagent according to claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi reagent according to claim 14, wherein the RNAi reagent has two blunt ends.

16. The RNAi reagent according to any one of claims 1-15, wherein the sense strand comprises one or two terminal caps.

17. The RNAi reagent according to any one of claims 1-16, wherein the sense strand comprises one or two reverse debasement residues.

18. The RNAi reagent according to claim 1, wherein the RNAi reagent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a duplex having a structure having any one of the duplexes in Tables 7, 8, 9A or 10.

19. The RNAi reagent of claim 18, wherein all or substantially all nucleotides are modified nucleotides.

20. The RNAi reagent of claim 19, wherein all or substantially all nucleotides are modified nucleotides.

21. The RNAi reagent according to any one of claims 19-20, wherein the sense strand further comprises a reverse debasement residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

22. The RNAi reagent according to any one of claims 1-21, wherein the RNAi reagent is linked to a lipid moiety.

23. The RNAi reagent according to claim 22, wherein the lipid fraction is selected from: in Indicates the connection point with the RNAi reagent.

24. The RNAi reagent according to claim 22 or claim 23, wherein the lipid moiety is conjugated to the sense strand.

25. The RNAi reagent of claim 24, wherein the lipid portion is conjugated to the 5' end of the sense strand.

26. A composition comprising the RNAi reagent according to any one of claims 1-25, wherein the composition further comprises a pharmaceutically acceptable excipient.

27. The composition of claim 26, further comprising a second RNAi agent capable of inhibiting the expression of the ataxia protein-2 gene.

28. The composition according to any one of claims 26-27, further comprising one or more additional therapeutic agents.

29. The composition according to any one of claims 26-28, wherein the RNAi reagent is a sodium salt.

30. The composition according to any one of claims 26-29, wherein the pharmaceutically acceptable excipient is water for injection.

31. The composition according to any one of claims 26-29, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

32. A method for inhibiting ATXN2 gene expression in cells, the method comprising introducing an effective amount of an RNAi reagent according to any one of claims 1-25 or a composition according to any one of claims 26-31 into the cells.

33. The method of claim 32, wherein the cells are within the subject.

34. The method of claim 33, wherein the subject is a human subject.

35. The method according to any one of claims 32-34, wherein after the administration of the RNAi reagent, the expression of the ataxia protein-2 (ATXN2) gene is suppressed by at least about 30%.

36. A method for treating one or more symptoms or diseases associated with increased or elevated membrane ATXN2 activity levels, the method comprising administering to a human subject in need a therapeutically effective amount of the composition according to any one of claims 26-31.

37. The method of claim 36, wherein the disease is a neurodegenerative disease.

38. The method of claim 37, wherein the neurodegenerative disease is spinocerebellar ataxia type 2 (SCA2).

39. The method of claim 37, wherein the disease is ALS.

40. The method according to any one of claims 32-39, wherein the RNAi reagent is administered at a dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

41. The method according to any one of claims 32-40, wherein the RNAi reagent is administered at a dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

42. The method according to any one of claims 32-41, wherein the RNAi reagent is administered in two or more doses.

43. The use of the RNAi reagent according to any one of claims 1-25 for the treatment of diseases, conditions or symptoms mediated at least in part by mutant ATXN2 activity and / or ATXN2 gene expression.

44. The use of the composition according to any one of claims 26-31 for the treatment of diseases, conditions or symptoms mediated at least in part by ataxia protein-2 (ATXN2) activity and / or ataxia protein-2 (ATXN2) gene expression.

45. Use of the composition according to any one of claims 26-31 for manufacturing a pharmaceutical agent for treating at least a portion of a disease, condition, or symptom mediated by ataxia protein-2 (ATXN2) and / or ataxia protein-2 (ATXN2) gene expression.

46. ​​The use according to any one of claims 43-45, wherein the disease is a neurodegenerative disease.

47. A method for preparing an RNAi reagent according to any one of claims 1-25, comprising annealing the sense strand and the antisense strand to form a double-stranded ribonucleic acid molecule.

48. The method of claim 47, wherein the sense chain comprises a lipid moiety.

49. The method of claim 48, further comprising conjugating the lipid moiety with a sense chain.

Citation Information

Patent Citations

  • Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides

    US4522811A

  • Enzymatic nucleic acids containing 5'-and / or 3'-cap structures

    US5998203A

  • Delivery of substances to cells

    WO2000053722A2

  • Polyconjugates for in vivo delivery of polynucleotides

    WO2008022309A2

  • Compositions for targeted delivery of sirna

    WO2011104169A1