Use of gabaa alpha 6 receptor knockout substances and their combinations for the manufacture of a medicament for the treatment of bladder cancer

By using substances that knock out the GABAAα6 receptor gene and macrophage inhibitory drugs, the activation and killing ability of CD8+ T cells are enhanced, solving the problems of high trauma, high recurrence rate and drug resistance in bladder cancer treatment, and achieving effective killing and inhibition of tumor cells.

CN121287749BActive Publication Date: 2026-05-08THE THIRD MEDICAL CENT OF THE CHINESE PEOPLES LIBERATION ARMY GENERAL HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE THIRD MEDICAL CENT OF THE CHINESE PEOPLES LIBERATION ARMY GENERAL HOSPITAL
Filing Date
2025-12-10
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Current treatments for bladder cancer have problems such as high trauma, high recurrence rate, and drug resistance. The killing function of CD8+ T cells is suppressed by the tumor microenvironment, which affects the treatment effect.

Method used

By using substances that knock out the GABAAα6 receptor gene and macrophage inhibitors to enhance the activation and killing ability of CD8+ T cells, and combining them with pharmaceutically acceptable carriers, products for the treatment of bladder cancer can be prepared.

Benefits of technology

It significantly enhances the killing ability of CD8+ T cells against tumor cells, strengthens tumor cell apoptosis and cell cycle arrest, and inhibits tumor progression. It is suitable for cases where traditional treatments are ineffective or resistant, thus expanding the applicable population for bladder cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses application of a GABAA alpha 6 receptor knockout substance and a combination drug thereof in preparation of a bladder cancer treatment product. The application provides application of a substance for knocking out a GABAA alpha 6 receptor gene and a macrophage inhibiting drug in preparation of a tumor treatment product. The application also provides application of the substance for knocking out the GABAA alpha 6 receptor gene and the macrophage inhibiting drug in preparation of a product for inhibiting tumor progression. The application explores the regulation of CD8+ T cell function by knocking out the GABAA alpha 6 receptor gene, verifies the application value of the GABAA alpha 6 receptor gene in bladder cancer treatment, and provides a new strategy for clinical treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of GABAAα6 receptor knockout substances and their combination drugs in the preparation of products for treating bladder cancer. Background Technology

[0002] Bladder cancer is a common malignant tumor of the genitourinary system worldwide, with consistently high incidence and mortality rates. Current clinical treatments primarily involve surgical resection, BCG instillation, and chemotherapy, but these methods suffer from significant risks, including high recurrence rates and drug resistance. Therefore, developing novel immunotherapies is an important direction for bladder cancer treatment.

[0003] CD8+ T cells are core killer cells in tumor immunity, inducing tumor cell apoptosis by secreting cytokines (such as TNF-α and IFN-γ) and cytotoxic molecules (such as granzyme B and perforin). However, the tumor microenvironment often inhibits CD8+ T cell function, leading to a weakened killing ability. Studies have found that γ-aminobutyric acid (GABA) and its receptors (such as GABAA receptors) can regulate immune cell function. Among them, the GABAAα6 receptor is specifically highly expressed in activated CD8+ T cells, but the effect of this receptor on CD8+ T cell killing function and bladder cancer progression remains unclear. Summary of the Invention

[0004] The technical problems solved by this invention are how to improve the killing power of CD8+ T cells and how to treat tumors such as bladder cancer.

[0005] To address the aforementioned technical problems, the first aspect of this invention provides the application of a substance for knocking out the GABAAα6 receptor gene and a macrophage inhibitory drug in the preparation of tumor treatment products.

[0006] Secondly, the present invention provides the use of substances for knocking out the GABAAα6 receptor gene and macrophage inhibitory drugs in the preparation of products that inhibit tumor progression.

[0007] Thirdly, the present invention provides a product for treating tumors, comprising a substance that knocks out the GABAAα6 receptor gene, a macrophage inhibitor, and a pharmaceutically acceptable carrier.

[0008] Fourthly, the present invention provides a product for inhibiting tumor progression, comprising a substance that knocks out the GABAAα6 receptor gene, a macrophage inhibitory drug, and a pharmaceutically acceptable carrier.

[0009] Fifthly, the present invention provides the use of a substance that knocks out the GABAAα6 receptor gene in the preparation of any of the following products:

[0010] A1) Enhance the ability of CD8+ T cells to kill tumor cells;

[0011] A2) Enhances the activation of CD8+ T cells;

[0012] A3) Leads to cell cycle arrest in tumor cells;

[0013] A4) Promotes tumor cell apoptosis;

[0014] A5) Promotes the secretion of TNF-α and / or GZMB cytokines by tumor cells;

[0015] A6) Inhibit the development of diseases caused by the decline in CD8+ T cell function.

[0016] Sixthly, the present invention provides the use of CD8+ T cells with the GABAAα6 receptor gene knocked out in the preparation of any of the following products:

[0017] B1) Enhances the ability to kill tumor cells;

[0018] B2) Enhances the activation of CD8+ T cells;

[0019] B3) leads to tumor cell cycle arrest;

[0020] B4) Promotes tumor cell apoptosis;

[0021] B5) Promotes the secretion of TNF-α and / or GZMB cytokines by tumor cells;

[0022] B6) Inhibits the progression of disease caused by the decline in CD8+ T cell function.

[0023] In a seventh aspect, the present invention provides a product comprising a substance that knocks out the GABAAα6 receptor gene or CD8+ T cells that knock out the GABAAα6 receptor gene, and a pharmaceutically acceptable vector.

[0024] The product described above has any of the following functions:

[0025] A1) Enhance the ability of CD8+ T cells to kill tumor cells;

[0026] A2) Enhances the activation of CD8+ T cells;

[0027] A3) Leads to cell cycle arrest in tumor cells;

[0028] A4) Promotes tumor cell apoptosis;

[0029] A5) Promotes the secretion of TNF-α and / or GZMB cytokines by tumor cells;

[0030] A6) Inhibit the development of diseases caused by the decline in CD8+ T cell function.

[0031] Eighthly, the present invention provides the application of substances that knock out the GABAAα6 receptor gene in the development and research of tumor drugs;

[0032] Alternatively, this invention provides the application of substances that knock out the GABAAα6 receptor gene in the preparation and development of tumor drug models;

[0033] Alternatively, the present invention provides the application of the GABAAα6 receptor or its gene, or an expression cassette or recombinant vector containing said gene, in the preparation of products that inhibit tumor progression.

[0034] The tumor mentioned above is bladder cancer.

[0035] In some embodiments, the substance that knocks out the GABAAα6 receptor gene may be a substance that knocks out the GABAAα6 receptor gene in cells.

[0036] In some embodiments, the substance that knocks out the GABAAα6 receptor gene in cells may be the substance that knocks out the GABAAα6 receptor gene in CD8+ cells.

[0037] In some embodiments, the substance that knocks out the GABAAα6 receptor gene is a reagent for knocking out the GABAAα6 receptor gene.

[0038] In some embodiments, the reagent for knocking out the GABAAα6 receptor gene is a reagent for knocking out the gene via CRISPR / Cas9.

[0039] In some embodiments, the reagent for knocking out the GABAAα6 receptor gene includes a polynucleotide that targets the GABAAα6 receptor gene, such as siRNA, shRNA, sgRNA, gRNA, miRNA, or antisense RNA.

[0040] In one implementation, the reagent for knocking out the GABAAα6 receptor gene includes multiple gRNAs;

[0041] The specific gRNA is as follows:

[0042] gRNA-A1, whose nucleotide sequence is Sequence 1: AAAGGTCATCCACTAGAAGTGGG (SEQ ID NO:1).

[0043] gRNA-A2, whose nucleotide sequence is Sequence 2: TCCATCCCTTGAAAGTCCCCTGG (SEQ ID NO:2).

[0044] gRNA-B1, whose nucleotide sequence is Sequence 3:GTTCACAATGCTGTCGCACTTGG (SEQ ID NO:3).

[0045] gRNA-B2, whose nucleotide sequence is Sequence 4: GTAGAGAGCATTCACACCGGGGG (SEQ ID NO:4).

[0046] In the above text, the decline in CD8+ T cell function refers to a decrease in the killing ability of CD8+ T cells.

[0047] In some embodiments, the disease development due to CD8+ T cell dysfunction may be tumor development due to CD8+ T cell dysfunction.

[0048] The term "tumor" refers to cells characterized by unregulated growth, including but not limited to pretumoral hyperplasia, carcinoma in situ, tumors, metastatic tumors, and solid and non-solid tumors. Tumors caused by cancer include, but are not limited to, lymphoma, leukemia, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, adrenal cancer, anal cancer, bile duct cancer, bladder cancer, brain cancer, breast cancer, triple-negative breast cancer, central or peripheral nervous system cancers, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastrointestinal cancer, glioblastoma, head and neck cancer, kidney cancer, liver cancer, nasopharyngeal carcinoma, nasal cavity cancer, oropharyngeal cancer, oral cancer, osteosarcoma, ovarian cancer, pancreatic cancer, parathyroid cancer, pituitary cancer, prostate cancer, retinoblastoma, sarcoma, salivary gland cancer, skin cancer, small intestine cancer, stomach cancer, testicular cancer, thymic cancer, thyroid cancer, uterine cancer, vaginal cancer, and vulvar cancer.

[0049] In some implementations, the tumor is bladder cancer.

[0050] In some implementations, the tumor cells may be bladder cancer cells.

[0051] The pharmaceutically acceptable carriers mentioned above can be excipients, stabilizers, suspending agents, or diluents, as is well known to those skilled in the art.

[0052] Furthermore, the carrier materials include, but are not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric-coated carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). Using these materials, various dosage forms can be formulated, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, lyophilized powder injections, etc. These can be conventional formulations, sustained-release formulations, controlled-release formulations, and various microparticle delivery systems. To formulate unit-dose dosage forms into tablets, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, and aluminum silicate; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, and polyvinylpyrrolidone; and disintegrants. Examples of carriers include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium dodecyl sulfate, methylcellulose, and ethylcellulose; disintegration inhibitors include sucrose, tristearate, cocoa butter, and hydrogenated oil; absorption enhancers include quaternary ammonium salts and sodium dodecyl sulfate; and lubricants include talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into pills. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfonate, methylcellulose, and ethylcellulose. For preparing unit-dose dosage forms into suppositories, a wide variety of carriers known in the art can be used. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, and semi-synthetic glycerides. For preparing unit-dose dosage forms into injectable formulations such as solutions, emulsions, lyophilized powders for injection, and suspensions, all diluents commonly used in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, and polyoxyethylene sorbitan fatty acid esters. In addition, to prepare isotonic injection solutions, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injectable formulation. Furthermore, conventional solubilizers, buffers, pH adjusters, etc., can also be added.In addition, colorants, preservatives, flavorings, tasters, sweeteners or other materials may be added to pharmaceutical preparations if necessary.

[0053] The products mentioned above may be pharmaceuticals, compositions or other biological products.

[0054] The experiments of this invention demonstrate that by knocking out the GABAAα6 receptor gene, its regulatory effect on CD8+ T cell function is explored, and its application value in bladder cancer treatment is verified, providing a new strategy for clinical treatment. It has the following advantages:

[0055] 1) Highly targeted, precisely regulating core killer cells

[0056] a) High target specificity

[0057] The GABAAα6 receptor is highly expressed only in activated CD8+ T cells and is a specific target for regulating the function of this cell. By knocking out this receptor, it is possible to precisely target CD8+ T cells, avoiding non-specific effects on other immune cells or normal tissue cells, and specifically improving the core defects in the immune response in bladder cancer.

[0058] b) Directly acts on key aspects of tumor immunity

[0059] CD8+ T cells are the main killer cells in tumor immunity, and their suppressed function is an important cause of bladder cancer progression. This technology directly compensates for key deficiencies in the immune response of bladder cancer by enhancing the activation of CD8+ T cells (significantly increased expression of CD25 and CD69) and the secretion of killing-related factors, and its targeting is superior to non-specific immunomodulatory methods.

[0060] 2) Significant killing effect and clear tumor suppression effect.

[0061] When CD8+ T cells with GABAAα6 receptor knockout are co-cultured with bladder cancer cells, they can significantly induce early apoptosis in cancer cells (the increase in apoptosis rate is statistically significant) and inhibit cancer cell proliferation (the proportion of cells in the G0+G1 phase increases). At the same time, the levels of cytotoxic factors such as TNF-α and GZMB secreted by these cells are significantly increased, directly demonstrating enhanced killing function against bladder cancer cells.

[0062] Reliable tumor suppression in vivo: In animal models, the intervention significantly reduced the wet weight of bladder cancer tumors, lessened tumor infiltration, and preserved bladder structure more completely. Clear tumor growth inhibition was observed in both in situ and subcutaneous tumor models, validating the effectiveness of this technology in vivo.

[0063] 3) It can avoid interference from the tumor microenvironment and improve treatment stability.

[0064] a) Addressing the immunosuppressive microenvironment

[0065] Studies have found that GABAAα6 receptor knockout may be accompanied by increased M2 macrophage infiltration, but this inhibition can be relieved by combining it with macrophage inhibitors. Under this combined strategy, tumor volume is significantly reduced, CD8+ T cell infiltration in the tumor increases, effectively avoiding interference from the tumor microenvironment on killer cells and ensuring their effective function.

[0066] b) Wide range of applications

[0067] This technology operates independently of traditional BCG instillation and chemotherapy, and can be used in cases where traditional treatments are ineffective or resistant, thus expanding the applicable population for bladder cancer treatment and compensating for the limitations of existing treatment methods.

[0068] 4) High safety and conversion potential

[0069] a) The preparation process is mature and controllable (with the potential to treat various cancers / tumors by modifying CD8+ T cells and reinfusing them through chimeric antigen receptor T cell (CAR T) and T cell receptor engineered T cell (TCR T) therapies).

[0070] CD8+ T cells were prepared using a standardized magnetic sorting (purity ≥95%) and activation process, which is reproducible and easy to standardize. The animal and cell models used in the experiment were all conventional systems, providing a reliable foundation for subsequent clinical translation.

[0071] b) Initial security is guaranteed

[0072] No significant damage to normal tissues was observed during the experiment, and CD8+ T cells mainly target tumor cells, making it safer than systemic toxic treatments, thus meeting the basic safety requirements for clinical application. Attached Figure Description

[0073] Figure 1 For CD8+ T cell phenotype detection; a: Percentage of CD3, CD62L, CD44, CD69, CD197 and CD25 expression in CD8+ T cells of group W (n=3), CD62L ( P =3.5e-05): W>α6; b: The percentage of CD8+ T cell expression of CD3, CD62L, CD44, CD69, CD197, and CD25 in the α6 group (n=3), CD25 ( P <0.000001), CD44 ( P <0.05), CD69 ( P =0.047): α6>W.

[0074] Figure 2 The effect of CD8+ T cells on the proliferation of MB49 cells in a co-culture system of CD8+ T cells and MB49 cells is shown; the top three rows of figures are phenotypic figures, and the last row of figures is the analysis results.

[0075] Figure 3 The effect of CD8+ T cells on apoptosis of MB49 cells in a co-culture system of CD8+ T cells and MB49 cells is shown. The top three rows of figures are phenotypic figures, and the last row of figures is the analysis results. UL represents the top left (broken and damaged cells), UR represents the top right (late apoptotic and dead cells), LL represents the bottom left (normal cells as negative control), and LR represents the bottom right (early apoptotic cells).

[0076] Figure 4 To detect cytokines secreted by CD8+ T cells in the co-culture system with MB49 cells using ELISA; a: Detection results of TNF-α and IFN-γ secreted by CD8+ T cells in the α6 group; b: Detection results of GZMB secreted by CD8+ T cells in the α6 group; c: There was no significant difference in PFP secreted by CD8+ T cells between the two groups.

[0077] Figure 5 This is an orthotopic bladder tumor model. The left figure shows the phenotype, and the right figure shows the tumor wet weight statistics.

[0078] Figure 6 This is a subcutaneous bladder tumor model. The top image shows the phenotype, and the bottom image is a statistical chart of tumor wet weight.

[0079] Figure 7 The images are representative of HE staining, magnified at 100 / 200x, with a scale bar of 100μm.

[0080] Figure 8 These are representative images of immunohistochemical staining, magnified 200 times. The top two rows show the staining results, and the last row shows the analysis results.

[0081] Figure 9 For flow cytometry analysis of bladder tumor tissue: a) CD45, CD3, and CD8a labeling was used to detect the content of CD8+ T cells in the tissue; b) CD45, F4 / 80, and CD206 labeling was used to detect the content of M2 macrophages; c) Analysis graphs of a and b.

[0082] Figure 10For transcriptomic quality control and differential analysis of GABAAα6 receptor in bladder tumor tissue: a: FPKM density analysis: The horizontal line in the middle of the box is the median; the upper and lower edges of the box are the 75th and 25th percentiles, respectively; the upper and lower limits of the box are the 90th and 10th percentiles, respectively. The outer shape is an estimate of nuclear density;

[0083] b: Sample clustering and correlation analysis: The upper left corner shows the sample clusters, and the lower right corner shows the sample names. Different colored squares represent the correlation level between two samples. c: Differential analysis: The horizontal axis is log2 FoldChange, and the vertical axis is the significance level value of the negative logarithm divided by 10. The two vertical dashed lines in the figure represent the threshold values ​​for fold changes. The horizontal dashed line is the threshold for significance level. Color indicates whether the gene is upregulated, downregulated, or differentially expressed is not significant.

[0084] Figure 11 To measure CD5L gene expression in RAW 264.7 cells (α6 group) and RAW 264.7 cells (W group) with GABAAα6 knockout after adding 2 ng / ml IL-4, q-PCR was used. Nonparametric tests (Man Whitney test) were performed on the W and α6 groups. Data are presented as medians, and statistical significance is indicated as follows: ***P<0.001, **P<0.01; *P<0.05. Detailed Implementation

[0085] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0086] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0087] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0088] The mouse culture method in the following examples is as follows: Wild Type mice (C57BL / 6, also known as W mice) at 6-8 weeks old and GABAAα6- / - mice (also known as α6 mice, with a genetic background of C57BL / 6) were purchased from Zhejiang Xishu Biotechnology Co., Ltd. (License number: SYXK (Zhe) 2020-0006), and were raised in a clean environment at a room temperature of 20-22°C, with regular light for a 12-hour cycle, and free access to food and water. In this experiment, 30 male Wild Type mice and 30 male GABAAα6- / - mice were used. All experiments were approved by the Experimental Animal Management and Ethics Committee of the Third Medical Center of the Chinese People's Liberation Army General Hospital.

[0089] The GABAAα6- / - mice in the following examples were prepared according to the following method:

[0090] 1. gRNA design

[0091] Select the exons 3-8 of the GABAAα6 gene (NM_001099641.2) (positions 158-1086 of the NM_001099641.2 transcript) as the knockout region, and design the gRNA as follows:

[0092] The gRNA sequences are as follows:

[0093] gRNA-A1 (matching the forward strand of the gene): AAAGGTCATCCACTAGAAGTGGG (SEQ ID NO:1);

[0094] gRNA-A2 (matching the forward strand of the gene): TCCATCCCTTGAAAGTCCCCTGG (SEQ ID NO:2);

[0095] gRNA-B1 (matching the reverse strand of the gene): GTTCACAATGCTGTCGCACTTGG (SEQ ID NO:3);

[0096] gRNA-B2 (matching the reverse strand of the gene): GTAGAGAGCATTCACACCGGGGG (SEQ ID NO:4).

[0097] 2. Cas9 protein (purchased from NEB, catalog number M0646) and four gRNAs (gRNA-A1: AAAGGTCATCCACTAGAAGTGGG, gRNA-A2: TCCATCCCTTGAAAGTCCCCTGG, gRNA-B1: GTTCACAATGCTGTCGCACTTGG, gRNA-B2: GTAGAGAGCATTCACACCGGGGG) were co-injected into C57BL / 6 mouse zygotes. The embryos were then transferred into recipient female C57BL / 6 mice to obtain F0 generation mice. PCR and sequencing were performed using a pair of primers (F1: 5'-TCATGTGTGTATTGCCATCTCTTC-3' (SEQ ID NO:5), R1: 5'-TGGACTTACTTCCTTCTTTGGCAT-3' (SEQ ID NO:6)). The primer annealing temperature was 60℃, yielding 676bp positive F0 generation mice.

[0098] Positive F0 generation mice were crossed with wild-type mice C57BL / 6J to obtain heterozygous F1 generation mice.

[0099] Genotyping was performed on heterozygous F1 generation mice as test mice:

[0100] The tails of heterozygous F1 mice were clipped, and genomic DNA was extracted and amplified by PCR using primers 1 and 2, respectively.

[0101] Primer 1: (annealing temperature 60.0℃), product size 676bp.

[0102] F1:5'-TCATGTGTGTATTGCCATCTCTTC-3'

[0103] R1: 5'-TGGACTTACTTCCTCTTTGGCAT-3'

[0104] Primer 2: (annealing temperature 60.0℃), product size 593bp.

[0105] F1: 5'-TCATGTGTGTATTGCCATCTCTTC-3'

[0106] R2: 5'-TGTACTCACCATCTCCCACATCTGA-3' (SEQ ID NO:7)

[0107] If the amplification product of primer 1 is 676 bp in size and primer 2 has no amplification product, then the genotype of the mouse to be tested is α6- / -, that is, exons 3 to 8 of the Gabra6 gene are knocked out in both homologous chromosomes of the mouse genome, and it is recorded as a homozygous mouse α6 (hereinafter referred to as α6 mouse).

[0108] If the amplification product of primer 1 is 676 bp and the amplification product of primer 2 is 593 bp, then the genotype of the mouse to be tested is α6+ / -, that is, the Gabra6 gene exons 3-8 are knocked out in one homologous chromosome of the mouse genome, and the Gabra6 gene in the other homologous chromosome is the same as that in wild-type mouse C57BL / 6N, which is recorded as a heterozygous mouse α6+ / -.

[0109] If primer 1 produces no amplification product and primer 2 produces an amplification product of 593 bp, then the genotype of the mouse being tested is α6+ / +, meaning that the Gabra6 gene is not knocked out in either of the two homologous chromosomes in the genome of the mouse being tested, which is the same as the wild-type mouse C57BL / 6N, and is denoted as wild-type mouse α6+ / +.

[0110] α6 mice are mice in which exons 3-8 of the Gabra6 gene are knocked out on two homologous chromosomes in the genome of all cells of mouse C57BL / 6N, including CD8+ cells.

[0111] In the examples below, MB49 (mouse bladder cancer cells), Suzhou, Cyagen; and RAW 264.7 (mouse mononuclear macrophage leukemia cells), Suzhou, Cyagen.

[0112] The reagents used in the following examples are shown in Table 1.

[0113]

[0114]

[0115] The Clodronate Liposomes used in the following examples function to inhibit macrophages (including M0 / M1 / M2). In tumor tissue, GABAAα6 receptor knockout promotes the growth of M2 macrophages; therefore, the majority of macrophages in the tissue are M2 (over 90%). Thus, the use of Clodronate Liposomes can eliminate (or weaken) the inhibitory effect of M2 macrophages on CD8+ T cells, thereby achieving tumor suppression.

[0116] Example 1: GABAAα6 knockout promotes the killing effect of CD8+ T cells on bladder cancer cells

[0117] I. Sorting of CD8+ T cells

[0118] Spleens were harvested from W mice (C57BL / 6N) and α6 mice, respectively, and then ground and centrifuged to obtain peripheral blood mononuclear cells (PBMCs). CD8+ T cells were then added to CD3 / CD28 activation beads using magnetic cell sorting technology. After 5 days of activation, the cells were analyzed. Details are as follows:

[0119] Cell experiments were divided into two groups: (1) wild-type control (W) group (C57BL / 6, n=3); (2) GABAAα6 receptor knockout (α6) group (GABAAα6- / - mice, n=3).

[0120] 1. Extraction of mouse PBMCs

[0121] Mice in the W and α6 groups underwent spleen removal. After rapid cervical dislocation and sterilization, the mice were immersed in 75% alcohol for approximately 1 minute. They were then placed in a laminar flow hood and fixed on a sterilized foam board. The spleen was separated using sterilized scissors and forceps. The spleen was placed on a 35mm culture dish containing 5ml of lymphocyte separation medium, separated from the liquid surface by a 200-mesh nylon membrane. The membrane and tissue fragments were then thoroughly ground using a syringe plunger, and the resulting lymphocyte separation medium containing spleen cells was discarded (all procedures were performed under aseptic conditions). The lymphocyte separation medium containing spleen cells was mixed thoroughly and immediately transferred to a 15ml centrifuge tube, covered with 1ml of 1640 culture medium to maintain a clear liquid boundary. The centrifuge parameters were set as follows: room temperature, horizontal rotor, 800g, both acceleration and deceleration rates set to "0", and time set to 30min for gradient centrifugation. After centrifugation, clearly defined layers were obtained from top to bottom: a 1640 cover layer, a lymphocyte layer, a separation medium layer, and red blood cells and tissue fragments. The lymphocyte layer was aspirated using a pipette and added to a 15ml centrifuge tube containing 10ml of 1640 medium. After thorough refluxing and washing, the tube was centrifuged at 250g for 10min. The supernatant was discarded, yielding PBMC cell pellet. The cells were resuspended in 1ml of 1640 medium to prepare a cell suspension with a concentration of 1*10⁻⁶. 7 cells·ml -1 Store in a refrigerator at 4°C for later use.

[0122] 2. CD8+ T cell sorting

[0123] Prepare a component selection buffer by mixing 2 mM EDTA in BSA stock solution and Rinsing Solution at a 1:20 ratio. Add 1*10 cells prepared in step 1.7 cells·ml -1 After centrifugation, cell pellets were obtained from the PBMC cell suspensions of each group. Cells were resuspended in 90 μl of buffer, and 10 μl of CD8 (Ly-2) MicroBeads were added. After mixing by pipetting, the pellets were incubated at -4°C for 10 min. MS sorting columns were fixed into a MACS separator. The column was rinsed with 500 μl of buffer. Before the buffer dried out, the incubated cell suspension was added to the column. After the liquid in the column had dried out, another 500 μl of buffer was added for rinsing. This process was repeated twice. The sorting column was removed from the MACS separator and placed on a 15 ml centrifuge tube. 1 ml of buffer was added to the column and quickly pushed in through the plunger, immediately rinsing out 1 ml of magnetically labeled CD8+ T cell suspension. CD8+ T cells from the α6 group and the W group were obtained.

[0124] 3. Purity detection and sorting by flow cytometry

[0125] 50 μl of CD8+ T cell suspensions from each group before and after sorting were taken, and 2.5 μl of CD3 and CD8 flow cytometry antibodies were added respectively. After incubation in the dark for 30 min, the purity of sorted CD8+ T cells was immediately detected using a CytoFLEX flow cytometer. The results showed that the purity of CD8+ T cells in the α6 group and the W group both reached over 90%.

[0126] 4. CD8+ T cell phenotype detection

[0127] The flow cytometry assay was divided into three groups: (1) wild-type control (W) group (n=3) CD8+ T cells; (2) GABAAα6 receptor knockout (α6) group (n=3) CD8+ T cells; (3) blank control group (CD8+ T cells in the wild-type group were not added with antibodies).

[0128] 1) Activation

[0129] T cells were activated using the CD3 / CD28 Streptamer® Kit.

[0130] The concentration after sorting is 1*10 6 cells·ml -11 ml of each group of CD8+ T cells was added to a 24-well plate, followed by 30 μl of CD3 / CD28 Streptamer premix (CD3 Fab-Strep, CD28 Fab-Strep, and Strep-Tactin® Multimer were mixed in a 1:1:1 ratio and incubated at 4°C for 20 minutes with continuous stirring. After incubation, the CD3 / CD28 Streptamer premix was obtained to stimulate and activate the CD8+ T cells. The total volume of the cell suspension was supplemented with 1640 complete medium (1640 medium + 5% fetal bovine serum + 0.5% penicillin-streptomycin) to 2 ml. The cells were then placed in a cell culture incubator and cultured for 5 days at 37°C, 5% CO2, and 95% humidity to obtain activated α6 group CD8+ T cell suspensions and W group CD8+ T cell suspensions.

[0131] 2) Detection

[0132] All activated α6 group CD8+ T cell suspensions and W group CD8+ T cell suspensions obtained in step 1) of the 24-well plate culture plate were transferred to flow cytometry tubes and centrifuged at 300g for 5 min to obtain cell pellets. The pellets were resuspended in 50 μl of PBS, and 2.5 μl of flow cytometry antibodies (CD3, CD8, CD25, CD44, CD69, CD62L, CD197) were added to each well. After vortexing and mixing, the cells were incubated in the dark for 30 min. After centrifugation at 300g for 5 min, the supernatant was discarded, and the cells were resuspended in 200 μl of PBS and immediately analyzed using a CytoFLEX flow cytometer.

[0133] The results of CD8+ T cell activation were analyzed 5 days later. Figure 1 As shown, CD25 in CD8+ T cells of group α6 was 15.16% ± 0.73%. P <0.000001 (late activated state), CD69 (76.75%±0.12%) P =0.047 (early activated state) expression was significantly higher in group W than in group W, while CD62L (1.05%±0.21%) (naive T cells / central memory T cells) expression in CD8+ T cells in group W was significantly higher than in group α6 ( P =3.5e-05). CD25 in CD8+ T cells after GABAAα6 knockout ( P <0.000001), CD69 ( P=0.047) significantly increased, showing enhanced cell maturation and activation, suggesting that the activation level of CD8+ T cells after GABAAα6 knockout is stronger than that of wild-type. The high expression of CD62L in wild-type may indicate that CD8+ T cells are more in the initial CD8+ T cell state. Preliminary inference is that GABAAα6 knockout will enhance the killing ability of CD8+ T cells.

[0134] II. GABAAα6 knockout promotes the inflammatory response of CD8+ T cells to MB49 cells.

[0135] 1. Culture of MB49 cells

[0136] MB49 cells were resuspended in DMEM complete medium and cultured in 6-well plates to achieve a concentration of 1*10⁻⁶ MB49 cells per well. 5 / ml, total volume 2ml, and cultured overnight in an incubator at 37℃, 5% CO2, and 95% humidity until cells adhere to the culture vessel for later use.

[0137] 2. MB49 proliferation detection

[0138] Experimental Groups:

[0139] (1) Wild-type control (W) group (n=3): The concentration of cultured in 6-well plates was 1*10 5 MB49 cells that have adhered to the culture vessel were removed from the incubator at a concentration of 1*10⁶ ml. After discarding the supernatant, a solution of 1*10⁶ cells / ml was added to the solution. 6 The activated CD8+ T cell suspension obtained in step 4 of section 1 above was co-cultured with MB49 cells for 24 hours. All supernatant and suspended CD8+ T cells were collected from the wells of the plate for later use. The 6-well plate containing MB49 cells was washed twice with PBS, and then the MB49 cells were digested with trypsin and collected into 15 ml centrifuge tubes. The cell pellet was collected by centrifugation at 300g for 5 minutes, yielding the co-cultured MB49 cells in group W.

[0140] (2) GABAAα6 receptor knockout (α6) group (n=3): The activated W group CD8+ T cell suspension in the wild control (W) group was replaced with the activated α6 group CD8+ T cell suspension obtained in step 4 above. All other aspects were the same, and MB49 cells were co-cultured in the α6 group.

[0141] (3) CD8+ T cell negative control (MB49) group (n=3); the activated W group CD8+ T cell suspension in the wild control (W) group was replaced with DMEM complete medium, and the process was repeated n=3. All other conditions were the same to obtain the negative control group co-cultured MB49 cells.

[0142] Cell proliferation was detected using the BrdU kit labeled with MB49, as detailed below:

[0143] After co-culturing the MB49 cells obtained from the above groups, add 1 ml of PBS, mix well by pipetting, transfer to a flow cytometry tube, centrifuge at 300g for 5 min, discard the supernatant, add 100 μl of Cytofix / Cytoperm to the pellet, and vortex thoroughly (vortexing should be performed for each subsequent step to ensure thorough mixing). Fix at room temperature for 30 min, then add 1 ml of Perm / wash buffer and wash, centrifuge at 300g for 5 min. Discard the supernatant, add 100 μl of Cytoperm / Permedization buffer plus, incubate at 4℃ for 10 min, add 1 ml of perm / wash buffer and wash, centrifuge at 300g for 5 min. Discard the supernatant, add 100 μl of Cytofix / Cytoperm and fix at room temperature for another 5 min, add 1 ml of perm / wash buffer and wash, centrifuge at 300g for 5 min, and discard the supernatant. Add 100 μl of the prepared DNAase solution to a centrifuge tube and incubate at 37°C for 1 hour. Wash with 1 ml of perm / wash buffer at 300g for 5 minutes, then discard the supernatant. Add 50 μl of the prepared BrdU antibody solution (the BrdU-control group does not require BrdU antibody solution; all other steps are the same). Incubate at room temperature in the dark for 20 minutes, then wash with 1 ml of perm / wash buffer at 300g for 5 minutes, then discard the supernatant. Resuspend the cells in 200 μl of PBS, add 20 μl of 7-AAD flow cytometry antibody, incubate for 20 minutes, and then perform flow cytometry analysis. Prepare the relevant solutions for the BrdU kit:

[0144] ①1*Perm / wash buffer: 10*Perm / wash buffer and PBS, 1:9;

[0145] ② DNAase solution: 30 μl DNAase stock solution + 70 μl Perm / wash buffer;

[0146] ③ BrdU antibody solution: 1.3 μl BrdU antibody + 48.7 μl Perm / wash buffer.

[0147] The results are as follows Figure 2 As shown, the G0+G1 (77.66%±2.94%) phase of MB49 co-cultured with group α6 CD8+T was significantly higher than that of MB49 co-cultured with group W. P=0.00630); the G2+M phase (14.01%±1.85%) of MB49 co-cultured with CD8+T from group α6 was significantly lower than that of MB49 co-cultured with CD8+T from group W. P =1.37e-03) and both were lower than those of MB49 cultured alone. This indicates that the G0+G1 phase and the G2+M phase of MB49 co-cultured with CD8+T cells in the α6 group were high, suggesting that the synthesis of DNA and protein in MB49 cells was impaired.

[0148] This result is consistent with the trend of the activated CD8+ T cell phenotype, so we can further conclude that GABAAα6 receptor knockout enhances the killing effect of CD8+ T cells on bladder tumors. This killing effect on bladder tumor cells is manifested in the inhibition of MB49 mitosis, leading to cell cycle arrest.

[0149] 3. Apoptosis detection of MB49

[0150] After co-culturing for 24 hours, the MB49 cells obtained from each group were labeled with the Annexin V-FITC apoptosis detection kit (BD, USA) and then analyzed by flow cytometry.

[0151] The results are as follows Figure 3 As shown, it can be seen that LL in group W > group α6 ( P <0.01), LR ( P =0.0038) and death ( P <0.05) was greater in the α6 group than in the W group. There was no significant difference between UR and UL; premature apoptosis of MB49 cells co-cultured with CD8+T cells in the α6 group (35.76%±0.86%) was higher than that in the W group and the MB49 cells cultured alone. P =0.0038). This further corroborates that GABAAα6 receptor knockout enhances the killing effect of CD8+ T cells on bladder tumors, mainly by promoting early apoptosis of bladder tumors.

[0152] 4. Release of CD8+ T inflammatory factors (TNF-α, INF-γ, PFP, GZMB)

[0153] After co-culturing for 24 hours, the supernatants from each group were collected. The supernatants were then extracted and the expression levels of inflammatory factors—interferon-γ (INF-γ), tumor necrosis factor-α (TNF-α), granzyme B (GZMB), and perforin (PFP)—in the cell supernatants were detected using enzyme-linked immunosorbent assay (ELISA). The specific methods are as follows:

[0154] Add standards and universal standard diluent to the selected blank wells in the plate strips. Add samples or standards of different concentrations (100 μg / well) to the corresponding wells in the remaining wells. Seal the reaction wells with sealing tape and incubate at 37°C in the dark for 90 min. Wash the plate 5 times. Add biotinylated antibody diluent to the blank wells and biotinylated antibody working solution (100 μl / well) to the remaining wells. Seal the reaction wells and incubate at 37°C in the dark for 60 min. Store at room temperature (22~25) in the dark. Wash the plate 5 times. Add enzyme conjugate diluent to the blank wells and enzyme conjugate working solution (100 μl / well) to the remaining wells. Seal the reaction wells and incubate at 37°C in the dark for 30 min. Turn on the microplate reader and preheat the instrument. Wash the plate 5 times. Add chromogenic substrate (TMB) (100 μl / well) and incubate at 37°C in the dark for 15 min. Add the reaction stop solution (100 μl / well), mix well, and immediately measure the OD450 value (within 3 min). Save the data results.

[0155] ELISA results are as follows Figure 4 As shown, the TNF-α secreted by MB49 cells co-cultured with CD8+ T cells in group α6 was 13.03 ng / ml ± 2.41 ng / ml. P =0.0096), GZMB (190.06ng / ml±8.70ng / ml, P =0.0012) level was significantly higher than that of MB49 cells co-cultured with CD8+ T cells in group W, while INF-γ ( P =0.276), PFP ( P =0.470) showed no significant difference. This result further suggests that CD8+ T cell killing function is enhanced to some extent after GABAAα6 knockout, mainly involving two cytokines, TNF-α and GZMB.

[0156] TNF-α:genbank: CAA68530.1; accession: CAA68530; date: 2006.11.14

[0157] GZMB: genbank: CAJ18480.1; accession: CAJ18480; date 2008.9.24

[0158] The above results indicate that knocking out the GABAAα6 receptor enhances the killing function of CD8+ T cells.

[0159] Example 2: Combined action of GABAAα6 knockout and macrophage inhibitors to inhibit the progression of bladder tumors.

[0160] I. Construction of an animal bladder tumor model

[0161] 1. Construction of a bladder tumor model

[0162] Experimental groups: (1) Wild control mice (W) group (n=5); (2) GABAAα6 receptor knockout mice (α6) group (n=5). The mice in each group were used to construct the orthotopic bladder tumor model and the ectopic bladder tumor model, respectively, to obtain the orthotopic bladder tumor model and the ectopic bladder tumor model of different groups of mice.

[0163] 1) Orthotopic bladder tumor model

[0164] Compared to subcutaneous (ectopic) bladder tumor models, orthotopic bladder tumor models are closer to the biological behavior of bladder cancer in humans and have a higher induction success rate. Therefore, orthotopic bladder tumor models are the preferred choice for construction.

[0165] Dissolve 2.5g of 2,2,2-tribromoethanol in 5ml of 2-methyl-2-butanol, mix thoroughly, and then bring the volume to 200ml with double-distilled water. Filter the solution through a 200-mesh sieve to prepare avocadin for mouse anesthesia. Weigh each mouse to determine its weight as 25-30g. Administer the prepared avocadin intraperitoneally at a rate of 20μl / g, approximately 500-600μl per mouse. After approximately 3-5 minutes of complete anesthesia, remove hair from the abdomen / skin preparation. Fix the limbs to a sterilized foam board. Using autoclaved scissors and forceps, open the lower abdomen to expose the bladder. Resuspend MB49 cells in serum-free DMEM medium, adjusting the concentration to 5*10⁻⁶. 5 After loading the solution into a 1ml syringe, replace the syringe with a 34g needle. Insert the needle into the bladder and inject 5*10 ml of solution. 550 μl of MB49 cell suspension was added to the bladder wall. The bladder wall was then scraped 10 times with a needle to induce sufficient trauma, which would facilitate the implantation of MB49 cells. After the needle was removed, the bladder was returned to the abdominal cavity, and the abdominal incision was sutured with 10-0 absorbable sutures. Iodine was applied immediately after suturing to prevent infection. The anesthetized mice were then placed on a heating pad and left to stand for 5-10 minutes to prevent hypothermia and death after laparotomy. After the mice were fully awakened, they were returned to their cages for continued feeding. Different groups of mice were used to obtain orthotopic bladder tumor models. The tumor was harvested after 14 days via laparotomy.

[0166] 2) Ectopic bladder tumor model

[0167] Compared to the orthotopic bladder cancer model, the subcutaneous (ectopic) bladder cancer model is simpler to operate and has a tumor formation rate of almost 100%, and the differences between groups can be minimized. Therefore, in order to verify the accuracy of the orthotopic bladder cancer model, a subcutaneous bladder cancer model was constructed for further verification.

[0168] The experimental groupings for the subcutaneous bladder cancer model were the same as those for the orthotopic bladder cancer model. To reduce cell exudation from the injection site during subcutaneous tumor formation, the injected cells were resuspended in serum-free DMEM medium mixed with an equal volume of matrix gel, totaling 100 μl, to achieve a concentration of 5*102. 5 / ml. The prepared cell solution was slowly injected into the armpit of mice using a 32g insulin needle. After a few seconds of stillness, the needle was rotated and withdrawn to obtain ectopic bladder tumor models (also known as subcutaneous bladder cancer models) in different groups of mice. The mice were sacrificed 14 days later for tissue collection.

[0169] 2. Tumor tissue growth

[0170] After sacrifice, the orthotopic bladder tumor model and the ectopic bladder tumor model of different groups of mice were dissected, and the orthotopic bladder tumor / subcutaneous bladder tumor tissue was measured, weighed and photographed.

[0171] The wet weight results of the in situ bladder tumor are as follows Figure 5 As shown, the wet weight results of subcutaneous bladder tumors are as follows: Figure 6 As shown, there are significant differences between the GABAA α6 group and the wild-type group in both the orthotopic bladder tumor and subcutaneous bladder tumor models. In the orthotopic model: compared with the wild-type orthotopic bladder tumor model (W), the α6 group (α6) (0.508g±0.23g) showed a significantly higher tumor weight. P =0.047 (see) Figure 5 Subcutaneous model: Compared with the wild-type subcutaneous bladder cancer model (W), the α6 subcutaneous bladder cancer model (α6) (0.83g±0.09g) had a significantly increased tumor weight. P =0.0016 (see) Figure 6).

[0172] Whether it is an in-situ model ( P =0.047) or subcutaneous model ( P The volume and wet weight of bladder tumors in the α6 group (α = 0.016) were significantly greater than those in the W group, indicating that knocking out α6 promotes bladder cancer progression.

[0173] 3. HE staining of bladder tumor in situ

[0174] Since orthotopic bladder tumors more closely resemble the actual occurrence of tumors, HE staining was performed only on the bladders of the wild-type orthotopic bladder tumor model (W) and the α6 orthotopic bladder tumor model (α6).

[0175] The results are as follows Figure 7 As shown, the bladder structure of the wild-type orthotopic bladder tumor model is still clearly visible, but the bladder disease course of the GABAAα6 group orthotopic bladder tumor model is more severe, with the bladder tumor clearly infiltrating into the muscle layer and even causing it to lose its basic functional structure.

[0176] II. GABAAα6 knockout promotes the infiltration of M2 macrophages in bladder tumors and participates in the inhibition of CD8+ T cell expression.

[0177] 1) M2 macrophages are highly expressed in bladder tumors, while CD8+ T cells are lowly expressed in bladder tumors.

[0178] Immunohistochemical detection: Orthotopic bladder tumor tissues from the α6 group and W group orthotopic bladder tumor models were fixed and dehydrated, embedded in paraffin blocks, sectioned, and hydrated (procedure consistent with histopathological staining). Microwave repair was then performed: sections were placed in 0.01M citrate buffer (pH=6.0) and microwaved on medium heat for 6 min x 4 times. After natural cooling for 30 min, they were rinsed with tap water and cooled to room temperature. They were then rinsed with PBS for 5 min x 3 times. Incubation with 3% H2O2 at room temperature for 10 min was performed to block endogenous peroxidase. After rinsing with PBS for 5 min x 3 times, sections were blocked with 5% sheep serum at room temperature for 30 min. After absorbing the blocking solution with filter paper, primary antibodies were added: CD8a (1:800), F4 / 80 (1:400), CD163 (1:800), and FOXP3 (1:1000), and incubated overnight at 4℃. On the second day, rinse with PBS (5 min x 3 times), incubate with low-valent enhancer at room temperature for 30 min, rinse with PBS (5 min x 3 times), add universal IgG antibody and incubate at room temperature for 30 min. Rinse with PBS (5 min x 3 times). Add freshly prepared DAB chromogenic solution, develop color under a microscope for 3-10 min, then place in distilled water to stop the reaction. Stain with hematoxylin for 10 min, rinse with tap water for 10 min for blue inversion, differentiate with hydrochloric acid for 3 s, rinse with tap water for 10 min for blue inversion. Rinse with PBS (5 min x 3 times) for dehydration and mounting.

[0179] Immunohistochemical results of bladder tumor tissue sections as follows Figure 8 As shown, CD8+ T cell expression was very low in all groups, lower than that of immunosuppressive M2 macrophages, and the expression was even lower in the α6 group (0.33%±0.58%) than in the W group (…). P =0.009), M2 macrophages (6.00%±1.00%) were significantly more numerous than those in the wild group ( P =0.006), indicating that α6 knockout reduced the infiltration of CD8+ T cells.

[0180] To further verify this result and rule out the limitations of immunohistochemical staining, single-cell suspensions of tumor tissues from the α6 group and W group orthotopic bladder tumor models were extracted and analyzed by flow cytometry. After collection, the tissues were ground to prepare single-cell suspensions. CD8+ T cells were labeled with CD45, CD3, and CD8 antibodies, and M2 macrophages were labeled with CD45, F4 / 80, and CD206 antibodies. After fixation and incubation, the suspensions were analyzed by flow cytometry.

[0181] The results are as follows Figure 9 As shown, the CD8+ T cells in the α6 group (38.96% ± 0.88%) were significantly lower than those in the W group ( P =2e-06), the percentage of M2 macrophages with α6 (97.82%±0.29%) was significantly higher than that in the W group ( P =1.64e-04), α6 knockout reduced CD8+ T cell infiltration.

[0182] The above results indicate that CD8+ T cell expression in the GABAAα6 group was lower than that in the wild group, suggesting that α6 knockout reduced CD8+ T cell infiltration, while M2 macrophage expression was higher than that in the wild group.

[0183] 2) CD5L-mediated increase in M2 macrophages

[0184] Transcriptome sequencing was performed on bladder tissue from the α6 group orthotopic bladder tumor model and the W group orthotopic bladder tumor model. Based on the transcriptome sequencing results (see...),... Figure 10 The data from this sample is reliable. The graph shows 10 genes with significant increases and decreases in regulation. The differentially regulated genes with significant decreases in the GABAAα6 group are: CNN1, Actg2, Des, Myh11, Lox, Acta1, ... P dlim3, Eln, Lmod1, Synm; significantly upregulated differentially expressed genes include: CD5L, Lcn2, Car6, Tdrd9, Hmga2, Cdsn, Ddit3, Cox6a2, and Gm42031.

[0185] Literature review revealed that CD5L, the gene most significantly upregulated after GABAAα6 knockout, is associated with the upregulation of M2 macrophages. CD5L is a key gene promoting M2 macrophages, and it can induce macrophages to transform from M1 to M2.

[0186] The GABAAα6 gene (GABAAα6 is the α6 subtype of the γ-aminobutyric acid type A receptor, a ligand-gated ion channel protein belonging to the GABA receptor group. It is regulated by the GABAAα6 gene and is also known as the GABARA6 gene) of mouse mononuclear macrophage leukemia cells RAW 264.7 was knocked down via lentiviral transfection to obtain RAW264.7 cells with GABAAα6 knockout (α6 group). RAW 264.7 cells without knockout were used as the control group (W group).

[0187] After resuscitating RAW264.7 cells, passage them to passages 2-3 to ensure good cell viability. Digest the cells and seed them into 6-well plates (density 1.0 x 10⁻⁶). 5 Each well was prepared. When the cell confluence was approximately 40%-50%, each lentivirus and enhancer (HitransGA) were removed and thawed on ice. The appropriate virus titer was determined according to the corresponding MOI value for infection (15 for RAW264.7). After observing the cell status, the cells were infected at 37℃ and 5% CO2 for 16 hours, and then the medium was changed (without virus and enhancer). After culturing for 24 hours, the medium was changed again and puromycin (1 μg / ml) was added. The cells were cultured for 2-3 days until the blank control group cells were killed. The fluorescence status was observed to confirm successful transfection. The cells were then cultured in DMEM complete medium for passage and prepared for use. RAW 264.7 cells with GABAAα6 knockout (α6 group) and RAW 264.7 (W group) were obtained.

[0188] RAW 264.7 cells (α6 group) and RAW 264.7 (W group) cells with GABAAα6 knockout were cultured and stimulated with IL-4 at a concentration of 2 ng / ml for 48 h to differentiate into M2 macrophages, resulting in differentiated W group RAW.264.7 and differentiated α6 group RAW.264.7.

[0189] Total RNA was extracted from RAW.264.7 in group W (denoted as W in the figure) and RAW.264.7 in group α6 (denoted as α6 in the figure) after differentiation and subjected to real-time quantitative PCR (q-PCR) experiments.

[0190] The primers for the above real-time quantitative PCR are as follows:

[0191] CD5L (forward, 5'-GATCGTGTTTTTCAGAGTCTCCA-3' (SEQ ID NO:8); reverse, 5'-TGCAGTCAACCCCTTGAATAAG-3' (SEQ ID NO:9));

[0192] The results are as follows Figure 11 As shown, the expression of CD5L in M2 macrophages of group α6 was significantly higher than that in group W. P =0.01).

[0193] M2 macrophages are a key component in suppressing CD8+ T cells in bladder tumors, and as mentioned above, the mechanism by which GABAAα6 gene knockout affects the increase of M2 macrophages may be due to CD5L upregulation.

[0194] III. Progress in inhibiting bladder cancer tumors by combining GABAAα6 knockout with macrophage inhibitors

[0195] To verify that GABAAα6 knockout in mice promotes the killing function of CD8+ T cells and also promotes the activity of M2 macrophages, and that even after M2 macrophages are suppressed, GABAAα6 knockout CD8+ T cells still exhibit a stronger inhibitory effect on bladder tumors. Details are as follows:

[0196] On days 0 and 7 of the aforementioned subcutaneous bladder tumor models in the α6 group and W group mice, mice were intraperitoneally injected with the macrophage inhibitor clodronate liposomes at a dose of 5 mg / ml and a volume of 200 μl, respectively, to obtain subcutaneous bladder tumor models in different groups of mice (α6 group (denoted as α6(M2-) in the figure) and W group (denoted as W(M2-) in the figure). Tumor tissue was collected on day 14, weighed, photographed, and the changes in CD8+ T cell content in the tumor were further detected by immunohistochemistry.

[0197] After the mice in different groups of drug-treated subcutaneous bladder tumor models were sacrificed, the subcutaneous bladder tumor tissue was dissected, measured, weighed, and photographed.

[0198] See results Figure 6 As shown, it can be seen that the α6 treatment group (denoted as α6(M2-) in the figure, 0.24g±0.07g) < the W treatment group (denoted as W(M2-) in the figure, 0.46g±0.03g) < the W group (0.62g±0.05g) < the α6 group (0.83g±0.09g), and all differences are statistically significant. P<0.01). The growth trend of bladder tumors in both the W group and α6 group was significantly reduced after macrophage inhibition, and the tumors in the W group were significantly larger than those in the α6 group ( P =0.0016).

[0199] The above results indicate that M2 macrophages inhibit the infiltration of CD8+ T cells in bladder tumors. When M2 macrophages are antagonized, CD8+ T cells in the GABAAα6 group have stronger killing function, resulting in smaller bladder tumors and inhibiting bladder tumor progression. This is consistent with the results of cell experiments.

[0200] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of substances that knock out the GABAAα6 receptor gene and macrophage inhibitors in the preparation of products for treating bladder cancer; The substances that knock out the GABAAα6 receptor gene are cas protein and gRNA; The macrophage-inhibiting drug is chlorphospholiposome.

2. Application of substances that knock out the GABAAα6 receptor gene and macrophage inhibitors in the preparation of products that inhibit the progression of bladder cancer; The substances that knock out the GABAAα6 receptor gene are cas protein and gRNA; The macrophage-inhibiting drug is chlorphospholiposome.

3. A product for treating bladder cancer, comprising a substance that knocks out the GABAAα6 receptor gene, a macrophage inhibitor, and a pharmaceutically acceptable carrier; The substances that knock out the GABAAα6 receptor gene are cas protein and gRNA; The macrophage-inhibiting drug is chlorphospholiposome.

4. A product for inhibiting the progression of bladder cancer, comprising a substance that knocks out the GABAAα6 receptor gene, a macrophage inhibitor, and a pharmaceutically acceptable carrier; The substances that knock out the GABAAα6 receptor gene are cas protein and gRNA; The macrophage-inhibiting drug is chlorphospholiposome.

Citation Information

Patent Citations

  • Application of reagent for inhibiting MYH11 expression in preparation of medicine for treating bladder cancer

    CN117137935A

  • Methods for intratumoral delivery of CRISPR / CAS system

    CN118574841A