A strain of Klebsiella sp. TYF-NHY-Klk002 and its applications and microbial agents

By screening out the Klebsiella TYF-NHY-Klk002 strain, a microbial agent was prepared for the degradation of nitroglycerin and its metabolic intermediates, which solved the problems of low efficiency and pollution in the existing technology for nitroglycerin wastewater treatment, and achieved efficient and safe wastewater treatment.

CN121320163BActive Publication Date: 2026-06-19TAIYUAN UNIVERSITY OF TECHNOLOGY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TAIYUAN UNIVERSITY OF TECHNOLOGY
Filing Date
2025-10-27
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing technologies for treating nitroglycerin wastewater suffer from low efficiency, high cost, and potential secondary pollution, necessitating an efficient and safe microbial treatment method.

Method used

Klebsiella pneumoniae strain TYF-NHY-Klk002 was screened out and used to degrade nitroglycerin and its metabolic intermediates under highly toxic conditions, and was prepared into a microbial agent for wastewater treatment.

Benefits of technology

It achieves simultaneous and efficient removal of nitroglycerin and intermediate products, is applicable to various explosives and pharmaceutical wastewater, and the strain maintains good degradation activity in highly toxic environments. The culture medium has a simple composition, which is convenient for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320163B_ABST
    Figure CN121320163B_ABST
Patent Text Reader

Abstract

This invention relates to the field of microbial denitrification technology, and in particular to a strain of Klebsiella pneumoniae ( Klebsiella Klebsiella pneumoniae strain TYF-NHY-Klk002 and its applications and microbial agents. Klebsiella pneumoniae strain TYF-NHY-Klk002 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 6, 2024, with accession number CGMCC NO.32523. This strain can utilize nitroglycerin as its sole nitrogen source for growth, achieving simultaneous and highly efficient removal of nitroglycerin and its intermediates.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial denitrification technology, and in particular to a strain of Klebsiella pneumoniae (…). Klebsiella sp.)TYF-NHY-Klk002 and its applications and microbial agents. Background Technology

[0002] Nitroglycerin (NG) is an organic nitrate ester widely used in the military industry. Due to its non-natural occurrence and potential explosive hazards and high toxicity, it cannot be directly released into the environment.

[0003] The large quantities of nitrate-containing energetic waste generated during ammunition decommissioning or manufacturing processes are generally treated internationally using three methods: first, traditional methods such as incineration, blasting, and heat recovery; second, actively developing various recycling technologies; and third, considering the R3 (recycling / reuse) characteristics in the design of new solid propellants, making it a design goal that aligns better with green and environmentally friendly principles. Physical and chemical methods have significant limitations in treating nitroglycerin wastewater, such as low efficiency, high cost, and potential secondary pollution. Microbial treatment methods have attracted considerable attention due to their environmental friendliness and high degradation efficiency.

[0004] By conducting in-depth research on the biodegradation mechanism of nitroglycerin, we can develop more efficient and stable wastewater treatment technologies. There is an urgent need to find microbial populations or enzymes capable of completely degrading nitroglycerin to achieve both high efficiency and safety in wastewater treatment. Therefore, screening for a highly efficient nitroglycerin-degrading strain is of paramount importance. Summary of the Invention

[0005] To address the above problems, this invention provides a strain of Klebsiella pneumoniae ( Klebsiella The present invention relates to Klebsiella pneumoniae TYF-NHY-Klk002 and its applications and microbial agents. The present invention provides Klebsiella pneumoniae TYF-NHY-Klk002 that can remove nitroglycerin and its metabolic intermediates in a highly toxic environment.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a strain of Klebsiella pneumoniae ( Klebsiella Klebsiella pneumoniae sp.) TYF-NHY-Klk002, was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 6, 2024, with accession number CGMCC NO.32523.

[0008] The present invention also provides the application of Klebsiella TYF-NHY-Klk002 described in the above technical solution in the degradation of nitroglycerin.

[0009] The present invention also provides the application of Klebsiella TYF-NHY-Klk002 as described in the above technical solution in the degradation of intermediate products of nitroglycerin metabolism.

[0010] Preferably, the intermediate products of the nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0011] The present invention also provides a microbial agent for degrading nitroglycerin and / or nitroglycerin metabolic intermediates, wherein the microbial agent contains Klebsiella TYF-NHY-Klk002 as described in technical solution 1 above;

[0012] The nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin.

[0013] Preferably, the effective viable count of Klebsiella pneumoniae TYF-NHY-Klk002 in the microbial agent is 1×10⁻⁶. 5 CFU / mL.

[0014] The present invention also provides the application of the microbial agent described in the above technical solution in the degradation of wastewater containing nitroglycerin and / or nitroglycerin metabolic intermediates;

[0015] The nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin.

[0016] Preferably, the application includes the following steps: adding the microbial agent to wastewater for degradation.

[0017] Preferably, the volume ratio of the microbial agent to the wastewater is 0.8~20:100.

[0018] Preferably, the degradation conditions include a temperature of 30°C and a rotation speed of 140 rpm.

[0019] The beneficial effects of this invention are:

[0020] (1) The Klebsiella TYF-NHY-Klk002 strain described in this invention can use nitroglycerin as the sole nitrogen source for growth, and can achieve simultaneous removal of nitroglycerin and its intermediate products with high removal efficiency.

[0021] (2) The strain of the present invention still maintains good degradation activity under highly toxic environments and can be used in various explosives and pharmaceutical wastewater;

[0022] (3) The culture medium required for the activation and expansion of the strain of the present invention has simple components and the bacterial solution preparation process is relatively easy, which is conducive to industrial production and subsequent application.

[0023] Biological Preservation Instructions

[0024] Klebsiella pneumoniae TYF-NHY-Klk002, Latin name is ( Klebsiella The gene (sp.) was deposited on November 6, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.32523. The depository address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, 100101, China. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0026] Figure 1 Phylogenetic tree of Klebsiella TYF-NHY-Klk002;

[0027] Figure 2 Morphological characterization of Klebsiella TYF-NHY-Klk002;

[0028] Figure 3 A schematic diagram of the degradation of nitroglycerin by Klebsiella TYF-NHY-Klk002 when nitroglycerin is the sole nitrogen source;

[0029] Figure 4 This is a schematic diagram illustrating the degradation of dinitroglycerin and mononitroglycerin, intermediate products of nitroglycerin, by Klebsiella pneumoniae TYF-NHY-Klk002.

[0030] Figure 5 This is a schematic diagram of the co-occurrence network of Klebsiella pneumoniae TYF-NHY-Klk002. Detailed Implementation

[0031] This invention provides a strain of Klebsiella pneumoniae ( Klebsiella Klebsiella pneumoniae sp.) TYF-NHY-Klk002, was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 6, 2024, with accession number CGMCC NO.32523.

[0032] The present invention also provides the application of Klebsiella TYF-NHY-Klk002 described in the above technical solution in the degradation of nitroglycerin.

[0033] This invention also provides the application of Klebsiella TYF-NHY-Klk002 as described in the above-mentioned technical solution in the degradation of intermediate products of nitroglycerin metabolism. In this invention, the intermediate products of nitroglycerin metabolism preferably include dinitroglycerin and / or mononitroglycerin.

[0034] This invention also provides a microbial agent for degrading nitroglycerin and / or nitroglycerin metabolic intermediates, wherein the microbial agent contains Klebsiella TYF-NHY-Klk002 as described in the above-mentioned technical solution; the nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin. In this invention, the effective viable count of Klebsiella TYF-NHY-Klk002 in the microbial agent is 1×10⁻⁶. 5 CFU / mL. This invention does not specifically limit the preparation method of the microbial agent; any method for preparing Klebsiella pneumoniae agents can be used, such as: inoculating Klebsiella pneumoniae TYF-NHY-Klk002 into an inorganic salt medium containing nitroglycerin, then activating it in a shaker at 30°C and 140 rpm. After it grows to the logarithmic phase, inoculate 5% by volume of the activated bacterial solution into 100 ml of liquid inorganic salt medium containing nitroglycerin and culture for 60 h at 30°C and 140 rpm. In this invention, the components of the liquid inorganic salt medium containing nitroglycerin are: 1.4 g L / L. -1 K2HPO4, 0.8g L -1 KH2PO4, 0.5g L -1 NaCl, 0.12 g L -1 1 ml / L trace element solution (0.1 g L) -1 H3BO3, 0.24g L -1 0.31g L -1 , 0.0228g L -1 0.06g L -1 0.04gL -1 pH 7.0±0.2.

[0035] This invention also provides the application of the microbial agent described in the above-mentioned technical solution in the degradation of wastewater containing nitroglycerin and / or nitroglycerin metabolic intermediates; the nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin. In this invention, the application preferably includes the following steps: adding the microbial agent to the wastewater for degradation. In this invention, the volume ratio of the microbial agent to the wastewater is preferably 0.8~20:100. In this invention, the degradation conditions preferably include: a temperature of 30°C and a rotation speed of 140 rpm.

[0036] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0037] (1) Source of strain:

[0038] The strains screened in the experiment were obtained from the aerobic tank packing material and wastewater samples of the Shanxi Beifang Xing'an Wastewater Treatment Plant in Taiyuan City, Shanxi Province.

[0039] (2) Culture medium:

[0040] Beef extract peptone medium: 5 g / L beef extract, 10 g / L peptone, 5 g / L NaCl, pH 7.0±0.2.

[0041] Inorganic salt medium (MSM): 1.4 g / L -1 K2HPO4, 0.8g L -1 KH2PO4, 0.5g L -1 NaCl, 0.12 g L -1 1 ml / L trace element solution (0.1 g L) -1 H3BO3, 0.24g L -1 0.31g L -1 , 0.0228g L -1 0.06g L -1 0.04g L -1 pH 7.0±0.2.

[0042] Phosphate buffer: 8 g / L -1 NaCl, 0.2 g L -1 KCl, 0.24g L -1 KH2PO4, 1.44g L -1 Na2HPO4, pH 7.0 ± 0.2.

[0043] Solid culture media are prepared by adding 2%-2.5% agar to the above-mentioned culture media. All culture media must be autoclaved at 121 °C for 30 min before use and cooled to room temperature before subsequent experiments.

[0044] (3) Main experimental instruments:

[0045] Constant temperature biochemical incubator, high-speed refrigerated centrifuge, constant temperature shaker, ultra-clean workbench, vertical pressure steam sterilizer, full-wavelength enzyme reader, PCR instrument, etc.

[0046] Example 1

[0047] Screening of Klebsiella pneumoniae TYF-NHY-Klk002.

[0048] (1) Enrichment of microbial strains

[0049] 10 mL of the retrieved packing material and 10 mL of wastewater sample were inoculated into an Erlenmeyer flask containing 90 mL of sterilized beef extract peptone medium and cultured at 120 r / min and 30 ℃ for 5 days.

[0050] (2) Isolation and preservation of bacterial strains

[0051] In a clean bench, the enriched culture solution was serially diluted with sterile water and spread onto an inorganic salt solid medium containing nitroglycerin. After standing for 30 min, the plates were inverted and incubated at 30 ℃ for at least 48 h. Single colonies with different morphological characteristics were picked and inoculated into an inorganic salt liquid medium containing nitroglycerin. After incubation at 140 r / min and 30 ℃ for 48 h, the culture was further purified by streaking on plates. This process was repeated three times. The resulting single colonies were then inoculated into an inorganic salt liquid medium and incubated under the same conditions for 48 h. Finally, the culture was inoculated into paraffin slant agar and stored at 4 ℃. Simultaneously, 500 μL of the bacterial culture was mixed with 50% glycerol at a 1:1 ratio and frozen at -80 ℃. The nitroglycerin content in the culture solution was measured to further screen for strains that can efficiently degrade nitroglycerin for the next stage of experiments.

[0052] (3) Rescreening of strains at higher nitroglycerin concentrations

[0053] The strains to be screened were inoculated into liquid medium containing 200 mg / L nitroglycerin and cultured under suitable conditions (30 ℃, 140 rpm). The OD of each well was measured using a microplate reader at regular intervals (12 hours). 600The growth of the strains was recorded, and the growth curves of the strains at this concentration were compared to screen for strains that could grow well at higher nitroglycerin concentrations. Finally, the strain TYF-NHY-Klk002, which showed the best nitroglycerin degradation effect, was identified as the target strain. Its colony morphology on solid culture medium is shown in the figure below. Figure 2 As shown.

[0054] Example 2

[0055] Molecular biological identification of strains

[0056] The purified strain was inoculated into basal medium and cultured at 140 r / min and 30 ℃ for more than 48 h. Using the bacterial culture as a template, the universal primer pair 27F / 1492R was selected. The PCR amplification reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min, denaturation at 94 ℃ for 30 s, annealing at 57 ℃ for 30 s, extension at 72 ℃ for 90 s, and repeated 30 times from the second step. Then, the extension was carried out at 72 ℃ for 5-10 min, and finally stored at 4 ℃ for 15 min.

[0057] The upstream primer was 27F (SEQ ID No. 1): 5' AGAGTTTGATCCTGGCTCAG 3';

[0058] The downstream primer is 1492R (SEQ ID No. 2): 5' TACGGCTACCTTGTACGACTT 3';

[0059] The 16S rRNA product obtained by PCR amplification was sent to Beijing Novogene Technology Co., Ltd. for first-generation sequencing. The obtained sequence was submitted to the NCBI website and compared with existing strain data in the GenBank database. BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ) was then used to search for strains with high similarity, which showed 99% homology with Klebsiella. A phylogenetic tree was then constructed using MEGA 11.0 software with the Neighbor Joining method. Figure 1 As shown, the genus and species of the strain were further analyzed.

[0060]

[0061] Example 3

[0062] Klebsiella pneumoniae TYF-NHY-Klk002 removal performance test when nitroglycerin is the sole nitrogen source:

[0063] The TYF-NHY-Klk002 strain from Example 1, stored at -80°C, was inoculated into an inorganic salt medium containing 100 mg / L nitroglycerin and then activated in a shaker at 30°C. After reaching the logarithmic growth phase, 5% by volume of the activated bacterial solution was inoculated into 100 mL of simulated wastewater containing nitroglycerin as the sole nitrogen source (concentration 200 mg / L) and cultured for 72 h at 30°C and 140 r / min. Samples were taken at 0, 12, 24, 36, 48, 60, and 72 h, and the strain's nitroglycerin degradation performance was tested after centrifugation and filtration. The simulated wastewater formulation was consistent with the previously described inorganic salt medium containing nitroglycerin. Liquid chromatography was used to test the nitroglycerin content. The high-performance liquid chromatography (HPLC) conditions for nitroglycerin analysis were as follows: a 4.6 × 250 mm Unitary C18 column was used; the mobile phase was water:acetonitrile in a 50:50 ratio; the total flow rate was 0.8 mL / min; the UV wavelength was 214 nm; and the elution time of nitroglycerin was 2.5 min.

[0064] like Figure 3 As shown, the strain achieved a maximum removal efficiency of 83.6% for nitroglycerin at 36 h.

[0065] The removal efficiency formula is as follows:

[0066] (C1-C2) / C1

[0067] C1 represents the initial concentration of nitroglycerin.

[0068] C2 represents the nitroglycerin concentration over 36 hours.

[0069] Example 4

[0070] Degradation performance of Klebsiella pneumoniae TYF-NHY-Klk002 on dinitroglycerin and mononitroglycerin, intermediate products of nitroglycerin.

[0071] The TYF-NHY-Klk002 strain from Example 1, stored at -80°C, was inoculated into an inorganic salt medium containing 100 mg / L nitroglycerin and then activated in a shaker at 30°C. After reaching the logarithmic growth phase, 5% by volume of the activated bacterial solution was inoculated into 100 mL of simulated wastewater containing nitroglycerin as the sole nitrogen source (concentration 200 mg / L) and cultured for 72 h at 30°C and 140 r / min. Samples were taken at 0, 12, 24, 36, 48, 60, and 72 h, and after centrifugation and filtration, the contents of dinitroglycerin and mononitroglycerin, products that may appear during the degradation process, were determined. The simulated wastewater formulation was consistent with the previously described inorganic salt medium containing nitroglycerin. The method used to test the contents of dinitroglycerin and mononitroglycerin was liquid chromatography. The high-performance liquid chromatography (HPLC) conditions for dinitroglycerin were as follows: a 4.6 × 250 mm Unitary C18 column was used, with a mobile phase of water:acetonitrile (85:15) and a flow rate of 0.8 mL / min. The UV wavelength was 219 nm, and the peak times for 1,2-dinitroglycerin (1,2-DNG) and 1,3-dinitroglycerin (1,3-DNG) were 3 min and 5 min, respectively. The HPLC conditions for mononitroglycerin were as follows: a 4.6 × 250 mm Unitary C18 column was used, with a mobile phase of water:acetonitrile (85:15) and a flow rate of 0.8 mL / min. The UV wavelength was 220 nm, and the peak times for 1-mononitroglycerin (1-MNG) and 2-mononitroglycerin (2-MNG) were 3.5 min and 8 min, respectively.

[0072] like Figure 4 As shown, the degradation of nitroglycerin (NG) entered a logarithmic phase between 12 and 24 hours, reaching a peak degradation rate of 80% at 36 hours. During this period, the intermediate metabolites 1,2-DNG and 1,3-DNG showed an increasing trend, peaking at 36 hours. After 36 hours, these metabolites began to degrade, and after 12 hours, the concentration of MNG isomers began to rise. At the end of the 72-hour experiment, the elimination of NG occurred simultaneously with the accumulation of DNG and MNG isomers.

[0073] When nitroglycerin is used as the sole nitrogen source in the culture medium, the strain can effectively reduce the concentration of nitroglycerin while also degrading the intermediate products dinitroglycerin and mononitroglycerin.

[0074] Example 5

[0075] Schematic diagram of the co-occurrence network of Klebsiella TYF-NHY-Klk002

[0076] A microbial co-occurrence network model was constructed to determine the functional and metabolic profile of the TYF-NHY-Klk002 nitroglycerin-degrading bacteria. Figure 5 The image shows the co-occurrence network of Klebsiella pneumoniae TYF-NHY-Klk002, where each node represents a different type of carbon source, and the node size is proportional to the number of connections. The Klebsiella pneumoniae TYF-NHY-Klk002 network has a relatively high number of connections and a relatively small modularity value, at 420 and 0.018, respectively. The high connectivity of TYF-NHY-Klk002 may indicate that it plays a central role in co-metabolic processes, capable of utilizing multiple carbon sources to obtain energy and nutrients.

[0077] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Klebsiella pneumoniae ( Klebsiella sp.) TYF-NHY-Klk002, characterized in that, The Klebsiella TYF-NHY-Klk002 strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 6, 2024, with accession number CGMCC NO.32523.

2. The application of Klebsiella TYF-NHY-Klk002 as described in claim 1 in the degradation of nitroglycerin.

3. Use of Klebsiella typhi TYF-NHY-Klk002 for degrading intermediates of nitrated glycerol metabolism according to claim 1, characterized in that, The intermediate products of the metabolism of nitroglycerin are 1,2-dinitroglycerin and 1,3-dinitroglycerin.

4. A microbial inoculant that degrades nitroglycerin and / or nitroglycerin metabolites, characterized in that, The microbial agent contains Klebsiella TYF-NHY-Klk002 as described in claim 1; The intermediate products of nitroglycerin metabolism are 1,2-dinitroglycerin and 1,3-dinitroglycerin.

5. The microbial inoculant of claim 4, wherein, The effective viable cell number of Klebsiella TYF-NHY-Klk002 in the microbial inoculant is 1 x 10 5 CFU / mL.

6. The application of the microbial agent according to claim 4 or 5 in the degradation of wastewater containing nitroglycerin and / or nitroglycerin metabolic intermediates; characterized in that, The intermediate products of nitroglycerin metabolism are 1,2-dinitroglycerin and 1,3-dinitroglycerin.

7. Use according to claim 6, characterized in that, The application includes the following steps: adding the microbial agent to wastewater for degradation.

8. The application according to claim 7, characterized in that, The volume ratio of the microbial agent to the wastewater is 0.8~20:

100.

9. The application according to claim 7, characterized in that, The degradation conditions include a temperature of 30°C and a rotation speed of 140 rpm.