Dcaps molecular marker for identifying soybean glutamic acid content trait and application thereof

Molecular marker technology using the qGlu16-C142T SNP site solved the problem of distinguishing between genetic differences and environmental fluctuations in soybean breeding, enabling efficient screening and breeding, increasing the glutamic acid content of soybeans, and optimizing the breeding process and product quality.

CN121362851BActive Publication Date: 2026-06-02INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
Filing Date
2025-11-27
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing soybean breeding technologies struggle to accurately distinguish between genetic differences and phenotypic changes caused by environmental fluctuations, resulting in low breeding efficiency for high-glutamic acid soybean varieties. Traditional phenotypic screening is costly, and molecular marker-assisted breeding technology has limited applicability.

Method used

Using the qGlu16-C142T SNP site as a molecular marker, the genotype of the qGlu16-C142T SNP site in the soybean genome was identified by PCR amplification and AluI restriction enzyme digestion. The dCAPS molecular marker was developed to identify the glutamic acid content in soybeans, achieving efficient screening and breeding.

Benefits of technology

This method enables rapid and accurate identification of soybean glutamic acid content, improves breeding efficiency, optimizes the genotypic composition of breeding populations, and enhances the nutritional quality of soybean seeds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362851B_ABST
    Figure CN121362851B_ABST
Patent Text Reader

Abstract

The application provides a qGlu16-C142T SNP site related to soybean glutamic acid content, which is located at 35995252bp of the physical position of the 16th chromosome of a soybean genome and corresponds to the 142th base from the 5' end of the nucleotide sequence shown in SEQ ID NO:1; the site contains two allelic types: C type and T type. The application further develops a dCAPS molecular marker based on the SNP site and provides a method for identifying or assisting in identifying the genotypes of the SNP site of the soybean to be tested. Finally, the application verifies the experiment through soybean materials and finds that the glutamic acid content of the soybean to be tested with the genotype of C type is higher than or higher than the glutamic acid content of the soybean to be tested with the genotype of T type. The dCAPS molecular marker in the application has important significance for screening soybean varieties with higher glutamic acid content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to a dCAPS molecular marker for identifying the glutamic acid content trait in soybeans and its application. Background Technology

[0002] Glutamic acid, a core nutrient and quality indicator found in soybeans in extremely high proportions, is of great significance. It is a natural umami substance in food processing, significantly enhancing the flavor of soy products such as tofu and soy sauce. It is also an important fortifying ingredient in infant formula and nutritional supplements for the elderly. In the feed industry, it can optimize the amino acid balance of livestock feed, promote intestinal development and protein absorption, and reduce the amount of artificial glutamate additives used, thus lowering breeding costs. Furthermore, as a key intermediate product of plant nitrogen metabolism, it can improve soybean nitrogen use efficiency, contribute to yield formation, and enhance plant stress resistance, comprehensively enhancing the value of soybeans in food, feed, and agricultural production. However, the glutamate content of existing soybean cultivars varies significantly, and most varieties cannot meet the precise requirements of high-value-added industries for high-quality raw materials. Therefore, genetically modified, targeted breeding of high-glutamate soybean varieties has become a key direction for promoting the quality and upgrading of the soybean industry.

[0003] Traditional methods for improving soybean glutamate content rely on hybridization breeding techniques. However, because glutamate content is synergistically regulated by multiple gene accumulation effects and environmental factors, phenotypic screening is easily affected by environmental interference, making it difficult to accurately distinguish between genetic differences and phenotypic changes caused by environmental fluctuations during the breeding process. With the development of molecular breeding techniques, genome-wide association analysis (GWAS) has become a core method for discovering glutamate-related genetic markers. However, the number of glutamate-related SNP loci discovered is extremely small, making it difficult to comprehensively cover the genetic regulatory network related to glutamate synthesis and nitrogen metabolism. The adaptability of some loci is limited, and most reported loci are based on the identification of vegetable soybean germplasm. The adaptability to different varieties such as oilseed soybean and forage soybean, as well as different ecotypes such as Northeast spring soybean and Huang-Huai-Hai summer soybean, has not yet been verified. At the same time, a few high-explanation-rate loci lack cross-environment stability verification, and their association performance under different soil fertility and nitrogen levels is still unclear, limiting their widespread application in molecular breeding. These problems make it difficult to efficiently apply current molecular marker-assisted breeding techniques to the breeding of high-glutamate soybean varieties, still requiring reliance on traditional phenotypic screening, resulting in high breeding cycles and costs.

[0004] Therefore, discovering novel SNP sites related to glutamate content that possess both high phenotypic explanatory power and strong environmental stability, and can be widely adapted to soybean germplasm across multiple uses and ecological regions, is crucial to breaking through the current limitations of molecular breeding technology in the targeted improvement of soybean glutamate content. This breakthrough not only provides core technical support for the precise and targeted improvement of soybean quality but also effectively strengthens the core competitiveness of the soybean industry. It has profound theoretical guiding significance and significant industrial application value for promoting innovation in soybean breeding theory and upgrading industrial applications. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a qGlu16-C142TSNP site related to soybean glutamic acid content and its application.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0007] A SNP locus associated with soybean glutamate content, located at 35,995,252 bp on chromosome 16 of the soybean genome, is named qGlu16-C142T SNP locus. This locus contains two allele types: C type and T type. Different genotypes of soybeans have different glutamate contents.

[0008] On the other hand, the present invention also includes a composition for detecting the above-mentioned SNP site polymorphism or genotype, which is as follows: A1), A2), or A3).

[0009] A1) The composition contains a PCR primer set for amplifying soybean genomic DNA fragments;

[0010] A2) The composition is a PCR reagent containing the PCR primer combination;

[0011] A3) A kit containing the PCR primer combination described in A1) or the PCR reagent described in A2).

[0012] As a preferred embodiment of the present invention, the PCR primer combination includes the front primer F shown in SEQ ID NO: 2 and the back primer R shown in SEQ ID NO: 3.

[0013] As a preferred embodiment of the present invention, the PCR reagent or kit contains at least an AluI restriction endonuclease component.

[0014] On the other hand, the present invention also includes the application of any of the above-described compositions, wherein the application is any of the following:

[0015] B1) Application in identifying or assisting in the identification of soybean glutamic acid content;

[0016] B2) Application in the preparation of products for identification or auxiliary identification of soybean glutamic acid content;

[0017] B3) Application in screening or assisting in the screening of soybean varieties with high glutamic acid content;

[0018] B4) Application in the preparation of products for screening or assisting in the screening of soybean varieties with high glutamic acid content;

[0019] B5) Applications in soybean breeding and / or assisted breeding;

[0020] B6) Application in the preparation of products for soybean breeding and / or assisted breeding.

[0021] On the other hand, the present invention also includes a product, wherein the product prepared based on the above application is any one of the following:

[0022] C1) Products that detect the polymorphism or genotype of the above qGlu16-C142T SNP site in soybeans;

[0023] C2) Products used for identifying or assisting in the identification of soybean glutamic acid content;

[0024] C3) Products used for soybean breeding and / or assisted breeding.

[0025] On the other hand, the present invention also includes a method for detecting the genotype of the above-mentioned qGlu16-C142T SNP site in the soybean genome, characterized in that it includes the following (1) or (2):

[0026] (1) Direct sequencing;

[0027] (2) Perform PCR amplification using the above composition, identify the amplification products by enzyme digestion, and determine the genotype based on the electrophoretic banding of the enzyme digestion products.

[0028] As a preferred technical solution of the present invention, the above method (2) specifically involves: performing PCR amplification on the soybean genomic DNA to be tested using the above composition to obtain PCR amplification products; digesting the obtained PCR amplification products with AluI enzyme to obtain digestion products; if the PCR product cannot be cut into B band type and the band size is 690bp, then the soybean genotype to be tested at the locus is T type; if the PCR product can be cut into A band type and two products of 141bp and 549bp are formed after cutting, then the soybean genotype to be tested at the locus is C type.

[0029] On the other hand, the present invention also includes a method for detecting or assisting in the detection of soybean glutamic acid content. The method described above for detecting the genotype of the qGlu16-C142T SNP site in the soybean genome is used to determine the genotype of the qGlu16-C142T SNP site in the soybean to be tested, and the specific trait of soybean in terms of glutamic acid content is determined based on the genotype. The glutamic acid content is: soybeans with genotype C have a higher or candidate higher glutamic acid content than soybeans with genotype T.

[0030] Finally, the present invention also includes a method for soybean breeding, which first detects the polymorphism of the above-mentioned SNPs in the soybean genome, and selects soybeans with the SNP sites in the soybean genome that are homozygous for C as parents for breeding.

[0031] The beneficial effects of adopting the above technical solution are as follows: This application provides a dCAPS molecular marker for identifying the glutamic acid content of soybeans and its application. This molecular marker can identify or assist in identifying the glutamic acid content of soybeans by detecting the genotype of the qGlu16-C142T SNP site in the genome of the soybean to be tested, helping to select soybean plants with high glutamic acid content. The qGlu16-C142T SNP site contains two allele types: C-type and T-type, located at position 35995252bp on chromosome 16, corresponding to the 142nd base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1. The dCAPS molecular marker can be used for soybean-assisted breeding, accelerating the screening and breeding process of soybeans with high glutamic acid content. In soybean breeding, it can accurately screen individual plants with high glutamic acid genotypes, thereby optimizing the genotypic composition of the breeding population and improving the nutritional quality of soybean grains.

[0032] This invention also provides compositions and / or kits for detecting the qGlu16-C142T SNP site. By detecting the genotype of the qGlu16-C142T SNP site, the screening and typing of soybean materials to be tested can be rapidly achieved, enabling the breeding of soybean varieties with high glutamic acid content. Attached Figure Description

[0033] Figure 1 This is a schematic diagram showing the glutamic acid content in the parent seeds.

[0034] Figure 2 This is a schematic diagram of a high-density genetic linkage map.

[0035] Figure 3 This is a schematic diagram showing the distribution of QTL sites for glutamate content.

[0036] Figure 4 This is a schematic diagram illustrating the effect of dCAPS molecular marker application. Detailed Implementation

[0037] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0038] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0039] Example 1: Discovery of the qGlu16-C142T SNP site related to soybean glutamate content

[0040] 1. Preparation of experimental materials

[0041] Using Nannong 26 and Williams82, provided by the Soybean Center of Nanjing Agricultural University, as parents, an F6 recombinant inbred line (RIL) population containing 131 families was constructed through single-seed propagation. Nannong 26 is a high-protein variety with a black seed coat, with a protein content of 47% as determined by the Grain Quality Testing Center of the Ministry of Agriculture and Rural Affairs of the People's Republic of China. Williams82 is a low-protein public genome reference germplasm introduced from the United States, with a laboratory protein content of approximately 41%. In November 2023, this RIL population and the parental materials were sown at three breeding experimental sites in Sanya (E1), Lingshui (E2), and Yacheng (E3). Each family was planted in three-row plots with a row length of 2m, a row spacing of 0.5m, and a plant spacing of 0.1m. During the growing season, diseased seedlings, weak seedlings, and other abnormal plants were removed. After natural maturity, the plants were harvested in mixed plots, dried, and then plump and uniform grains were selected for later use.

[0042] 2. Methods for determining soybean glutamic acid content, statistical analysis, and visualization of data.

[0043] Subsequently, characteristic spectra of the tested seeds under three environments were obtained using a Bruker MATRIX-I near-infrared analyzer. The spectra were then fitted using the instrument's built-in protein and amino acid models to predict glutamate content. Each plot of sample was measured individually in triplicate, and the average value was used as the final percentage content data. Differences in glutamate content among parents were analyzed using GraphPad Prism 5 software, and bar charts were generated. Genetic analysis of glutamate traits under multiple environments was performed using built-in formulas in Excel software. The generalized heritability was calculated using R language, with the following formula: h 2 b =σ 2 g / (σ 2 g +σ 2 ge / n+σ 2 ε / nr)), where h 2 b Represents the generalized heritability, σ 2 g σ represents the variance of genotypes. 2 ε σ represents the variance of the error. 2 ge The variance of the interaction between genotype and environment is represented by , where n represents the number of environments and r represents the number of replicates per environment. The Pearson function from the psych package in R is used to calculate the correlation coefficients between different traits.

[0044] 3. Genotyping analysis of soybean RIL populations

[0045] Through molecular experiments and bioinformatics analysis, high-quality genotype data of soybean parents and F6 generation RIL population were obtained, genetic maps were constructed, and QTL sites controlling glutamate content were located, providing core support for subsequent functional gene mining and molecular marker-assisted breeding.

[0046] Young leaves were collected from parents and 131 F6 generation RIL families. DNA was extracted and quantitatively tested before being fragmented into 350bp segments for library construction. Clean data were obtained through high-throughput sequencing. The data were compared with the soybean reference genome to screen for high-confidence SNPs and Indels and perform statistical typing. Genetic maps were constructed using Join Map 3.0 based on the physical location of the markers, and QTL localization was completed using the complete interval mapping method of QTL Ici Mapping V4.1.

[0047] Glutamic acid-related quality traits were tested in two parental lines, Williams82 and Nannong 26. The results showed that the glutamate content of Nannong 26 was significantly higher than that of Williams82, and the difference between the parents was significant, indicating that the RIL population is suitable for QTL mapping analysis. Figure 1 As shown.

[0048] Genetic variation analysis of the glutamate trait in the soybean RIL population revealed that the glutamate phenotypic data of both parents fell within the extreme range of the population phenotypic values ​​and exhibited a continuous distribution, with a genetic variation coefficient of 5.23%. The glutamate trait showed significant overparental segregation, reflecting a clear differentiation between the two parents on a genetic basis. The absolute values ​​of skewness and kurtosis were both low, and the phenotypic distribution pattern closely matched the characteristics of a normal distribution, thus confirming that the glutamate trait is a quantitative trait. Heritability results showed that the heritability of the soybean glutamate trait was high (specifically, 0.958), indicating that the soybean glutamate trait is mainly controlled by genes, with relatively limited interference from environmental factors. This characteristic fully demonstrates that the RIL population constructed in this study possesses favorable conditions for subsequent QTL mapping analysis, as shown in Table 1.

[0049] Table 1. Genetic variation analysis of the RIL population

[0050]

[0051] 4. Construction of high-density genetic maps and QTL mapping of glutamate content-related traits

[0052] To aid in subsequent QTL mapping analysis, high-throughput resequencing was performed on a RIL population containing two parents and 131 recombinant inbred families. Polymorphic SNPs were screened and integrated into 4286 effective polymorphic bin markers, which were then divided into 20 linkage groups based on chromosomal physical location to construct a high-density genetic linkage map. Figure 2 As shown in the image, this map has high resolution and no obvious gaps, which can meet the requirements for subsequent QTL localization.

[0053] QTL mapping results showed that 9 potential QTL sites for the glutamate trait were detected in 3 environments, distributed across 5 chromosomes, such as... Figure 3 As shown in Table 2, chromosomes 4 and 16 have a relatively large number of potential QTLs associated with the glutamate trait, while the other chromosomes have only one potential QTL, indicating that these loci contain pleiotropic or environmentally stable QTLs. Furthermore, based on the LOD significance threshold of 3.37 returned from 1000 permutation tests across the entire genome and the physical and genetic distances between different QTL loci, a pooled screening was performed, resulting in two highly reliable QTL loci associated with glutamate, as shown in Table 2. In addition, qGlu_16 can be stably detected in three environments, indicating that this locus has significant breeding value.

[0054] Table 2 QTL mapping analysis of glutamate content

[0055]

[0056] Note: Positive '&' indicates an additive effect derived from Nanjing Agricultural University 26, while negative '&' indicates an additive effect derived from Williams 82. E1, Sanya; E2, Lingshui; E3, Yacheng.

[0057] 5. Screening for SNPs related to soybean glutamic acid content

[0058] Based on the parental resequencing results, high-quality SNP variant sites were screened within or near the candidate physical region of the QTL site qGlu_16. These sites were required to have a sequencing depth greater than 5, a sequencing quality greater than 10, and be homozygous. A single SNP site associated with soybean glutamate content was detected at chromosome 16 at base 35,995,252, named qGlu16-C142T SNP site. This site exhibits two genotypes in the natural soybean population: C and T.

[0059] Refer to the sequence information shown in SEQ ID NO: 1:

[0060] TTGTCTCCACATAATTAATTAATTATTGAATTATATTATCTACAGAATATTTTTTTAATCTTTTTTTTAGAATATATATTCTATGTTTATCATATTACTCATTTTATTTCACACTTTTTTCTTTTTTAATTGTAAAAAAAGYTATGTATAAGTTTTGTATAATTTTTATTTTTAACTGCTTCAATTAAGGCTTTTTGGCTCTTATTAATTTGGTGAGATTTTGATGTATCTTTAGAAGCCTCCATTTTTTAGATTGAATATGAGATTATTTTTTAATTTAAAATTTAGTCACATTTAAATTTTTTTTACCTCTTCCCAAAGAAGTGCTGTATAATTAATAATTCTCATTAGCAGTTAAGTGTGAGTGACTGCTGAATCAAAGGTTAACCAAGGTAGCAGGGATAAATGAAAATATATTTTTTTAATTCTCTTGATTTAGAATAACAGGGACCAGTTACATTTTTTGGCAGGACCTTATTTAATTTATCTTTATTCAAAAATCTGAGTTTAATCCTTGATCTTTTTTTTCTTCTTATTTTTAATTCGGTTCTTTTTAGTCTATTTTGGTGAATGTATCTTTGTCTGTCAGAAATTATTTTGTTGACCATCATCACTAAAACCAATATGTTGATAAAAAAATATTAAAACAAAAATATATATAAACAATGAAGTTGAGAAAAGAGATAAGAG

[0061] (SEQ ID NO: 1; wherein, Y at position 142 is C or T).

[0062] Example 2. Development of dCAPS molecular marker for genotyping qGlu16-C142T SNP locus

[0063] Based on the physical location of the qGlu16-C142T SNP site, 30 bp sequences upstream and downstream of the site were extracted from the genome. dCAPS molecular markers were designed using the online website "dCAPS Finder" based on these sequences. If the SNP variation did not induce restriction enzyme site variation, a single nucleotide mismatch was introduced near the SNP site, causing the restriction endonuclease AluI to generate a recognition site for one of the sequences amplified using one of the parents as a template in the amplified PCR product. The following primer sequences were developed using the above markers:

[0064] Pre-primer F: TTGTCTCCACATAATTAATTAA (SEQ ID NO: 2)

[0065] Back primer R: CTCTTATCTCTTTTCTCAACTTCATT (SEQ ID NO: 3)

[0066] Endonuclease AluI: AGCT

[0067] Example 3: Method for detecting the qGlu16-C142T SNP genotype in soybean

[0068] Genomic DNA was extracted from soybeans to be tested. The extracted DNA was amplified by PCR using primers F and R from Example 2 to obtain the PCR amplification product. The PCR reaction system was 25 μL, and the components and amounts were as follows: 2.5 μL 10×Ex Tag HS buffer, 2.0 μL 0.2 mM dNTP, 1.0 μL template DNA, 0.5 μL upstream primer F (10 μM), 0.5 μL downstream primer R (10 μM), 0.2 μL Ex Taq HS enzyme, and the remaining volume was made up with 18.3 μL ddH2O. The PCR reaction conditions were: 95℃ for 2 min; followed by 30 cycles of 95℃ for 30 s, 53℃ for 30 s, and 72℃ for 30 s; after the cycles, the mixture was incubated at 72℃ for 10 min; finally, the amplification product was stored at 16℃.

[0069] PCR amplification products were digested with the restriction endonuclease AluI to obtain digested products. The digested products were then detected by 1% agarose gel electrophoresis. Products with a single band were further digested for detection. The total digestion volume was 25 μL, with the following components and volumes: 2.5 μL 10×NEB buffer, 1.0 μL restriction endonuclease, 10 μL PCR amplification product, and the remaining volume made up to 11.5 μL ddH2O. Digestion was performed at the enzyme's operating temperature for 30 min, followed by detection of the digested products by 1% agarose gel electrophoresis and observation of the results using a gel imaging system. The different genotypes of the qGlu16-C142T SNP site were determined based on the fragment size of the digested products.

[0070] If the PCR product cannot be cleaved by the AluI restriction enzyme into a B-band pattern, with a band size of 690 bp, then the soybean genotype at that locus is T. If the PCR product can be cleaved into an A-band pattern, resulting in two products of 141 bp and 549 bp, then the soybean genotype at that locus is C. The A and B bands after enzyme digestion can be clearly distinguished on a 1% agarose gel.

[0071] For any given material, if only band A or band B is amplified, it indicates that the qGlu16-C142T SNP site in that soybean material is homozygous. If both band A and band B are amplified simultaneously, it indicates that the soybean material is still heterozygous at the qGlu16-C142TSNP site, and segregation will occur at this site in the offspring after self-pollination.

[0072] Example 4: Application of dCAPS molecular markers in identifying soybean glutamic acid traits

[0073] 1. Selection of experimental materials and genotyping of qGlu16-C142T SNP loci

[0074] Using Nannong 26 as the high-glutamic acid parental donor material and Wandou 37 and Wandou 38, which have low glutamic acid content, as the recipient parental materials, the genotype of the soybean qGlu16-C142T SNP site was detected using the method described in Example 3. The genomic DNA digestion product of Nannong 26 showed an A-band pattern, indicating a C-type genotype for the qGlu16-C142T SNP site; the genomic DNA digestion products of Wandou 37 and Wandou 38 showed a B-band pattern, indicating a T-type genotype for the qGlu16-C142T SNP site. The genotypes of the qGlu16-C142T SNP sites of different donor materials are shown in Table 4.

[0075] 2. Phenotypic determination of glutamic acid content in soybean materials

[0076] Soybeans from different experimental materials were naturally air-dried to a moisture content below 7%. Mature, plump soybean seeds without damage or mold were selected as test samples and kept at a constant temperature of approximately 25℃ for at least 48 hours. The glutamic acid content of the samples was obtained by spectroscopic determination using a near-infrared spectroscopy instrument. The glutamic acid content of Nannong 26 was 9.36 g / 100g, while that of Wandou 37 and Wandou 38 were 8.10 g / 100g and 8.43 g / 100g, respectively. The results showed that the glutamic acid content of Nannong 26 was 15.58% and 11.01% higher than that of Wandou 37 and Wandou 38, respectively, indicating a significant difference in glutamic acid content between the donor and recipient parents, making it suitable for verifying the effectiveness of molecular marker applications. The glutamic acid content of different parental materials is shown in Table 3.

[0077] Table 3. Glutamic acid content and qGlu16-C142T SNP genotype of the three parental materials

[0078]

[0079] 3. Breeding population construction and material cultivation

[0080] Using soybean variety Nannong 26 as the female parent, two hybrid combinations were prepared by crossing it with Wandou 37 and Wandou 38, respectively. The hybridization was carried out using conventional sexual hybridization techniques. In the F2 segregating generation of the second generation of hybrids, 150-200 robust single plants were selected and retained for each hybrid combination. Subsequently, continuous self-pollination was carried out using the single-seed propagation method until the F4 generation was reached.

[0081] Young leaves were collected from each F4 plant for genotyping to clarify the genetic background information of each plant. After genotyping, the F4 plants were harvested individually and their seeds were preserved. In mid-June of the following year, all F4 family seeds were planted in plots of 1m x 3 rows at the Longkang experimental base, with uniform field management standards applied. In October of the same year, after the soybeans matured, they were harvested centrally according to the plot rows, ensuring that the seeds of each family were collected separately.

[0082] To ensure the reliability of phenotypic data, each family was replicated three times. During seed treatment, abnormal seeds such as those with developmental abnormalities or shriveled kernels were first removed, and then the glutamate content in the seeds was determined using near-infrared spectroscopy. The average value of the three replicate measurements was calculated as the final phenotypic data for the glutamate content of that family. Following the above screening and identification, 100 genetically stable breeding families with reliable phenotypic data were retained from each of the two hybrid combinations for subsequent genetic analysis.

[0083] 4. Molecular marker screening and phenotypic analysis

[0084] The DNA of the 200 selected breeding families was used for genotyping using the method described in Example 3 for detecting the soybean qGlu16-C142T SNP genotype. The results showed that 48 families with the A band pattern and 70 families with the B band pattern were detected in the two populations. The remaining families were heterozygous or had missing bands. Since heterozygous band patterns tend to segregate later, they were excluded. Glutamic acid content was measured in the 118 individual plants with clearly defined band patterns. The results showed that the average glutamate content of the A band pattern (qGlu16-C142T SNP genotype C) and the B band pattern (qGlu16-C142T SNP genotype T) were 8.770 g / 100 g and 8.463 g / 100 g, respectively, with standard deviations of 0.499 g / 100 g and 0.347 g / 100 g, respectively. In the A-band group, the highest glutamate content was 9.780 g / 100 g, and the lowest was 7.959 g / 100 g. In the B-band group, the highest glutamate content was 9.216 g / 100 g, and the lowest was 7.776 g / 100 g. The absolute values ​​of skewness and kurtosis for both groups were less than 1, indicating that the phenotypes of the two groups conformed to a normal distribution. Student's T-test showed a significant difference in glutamate content between the A-band and B-band groups, with the A-band group generally having a higher glutamate content than the B-band group. Directional selection using molecular markers significantly increased the average glutamate content by 3.63%. These results indicate that this molecular marker can be used for genetic breeding improvement to increase soybean glutamate content. (See Table 4.) Figure 4 As shown.

[0085] Table 4. Variation analysis of glutamate content in different genotype populations

[0086]

[0087] Note: The genotype of the A-banded qGlu16-C142T SNP locus is C, and the genotype of the B-banded qGlu16-C142T SNP locus is T.

[0088] In summary, soybeans with the C genotype at the qGlu16-C142T SNP site have a higher or candidate higher glutamate content than soybeans with the T genotype. The aforementioned dCAPS molecular markers can rapidly and effectively identify the glutamate content trait in soybeans.

[0089] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. The application of a composition for detecting SNP site polymorphisms, characterized in that: The SNP site is located at position 142 of the sequence shown in SEQ ID NO: 1 and is named qGlu16-C142T SNP site. This site contains two allele types: C type and T type. Different genotypes of soybeans have different glutamic acid contents. Soybeans with genotype C have a higher glutamic acid content than soybeans with genotype T. The composition is a PCR primer combination, comprising the front primer F shown in SEQ ID NO: 2 and the back primer R shown in SEQ ID NO: 3; The application is any one of the following: B1) Application in identifying or assisting in the identification of soybean glutamic acid content; B2) Application in the preparation of products for identification or auxiliary identification of soybean glutamic acid content; B3) Application in screening or assisting in the screening of soybean varieties with high glutamic acid content; B4) Application in the preparation of products for screening or assisting in the screening of soybean varieties with high glutamic acid content.

2. A method for assisting in the detection of soybean glutamic acid content, characterized in that: The genotype of the qGlu16-C142TSNP locus in the soybean to be tested was determined, and the glutamic acid content of the soybean was determined based on the genotype. Soybeans with genotype C have a higher glutamic acid content than soybeans with genotype T. The SNP site is located at position 142 of the sequence shown in SEQ ID NO: 1, and this site contains two allele types: C type and T type. The methods for determining the genotype of the qGlu16-C142T SNP site in the soybean genome include the following (1) or (2): (1) Direct sequencing; (2) The soybean genomic DNA to be tested is amplified by PCR using the composition described in claim 1 to obtain PCR amplification products; the obtained PCR amplification products are digested with AluI enzyme to obtain digestion products; if the PCR product cannot be digested and the band size is 690bp, then the soybean genotype to be tested at the locus is T type; if the PCR product can be digested and two products of 141bp and 549bp are formed after digestion, then the soybean genotype to be tested at the locus is C type.