Methylation site marker for assisting early diagnosis of esophageal squamous cell carcinoma and application thereof

By detecting specific methylation sites cg05064044, cg03395511, and cg21548813 in peripheral blood mononuclear cells and combining this with pyrosequencing, a kit for the early diagnosis of esophageal squamous cell carcinoma was developed. This kit addresses the shortcomings of existing technologies in terms of diagnostic sensitivity and specificity, and enables efficient and non-invasive detection of esophageal squamous cell carcinoma.

CN121496057BActive Publication Date: 2026-06-30SHANDONG PROVINCIAL HOSPITAL AFFILIATED TO SHANDONG FIRST MEDICAL UNIVERSITY (SHANDONG PROVINCIAL HOSPITAL)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511651776.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-12
Publication Date
2026-06-30
Estimated Expiration
2045-11-12

AI Technical Summary

Technical Problem

Current technologies lack non-invasive molecular markers with high sensitivity and specificity for the early diagnosis of esophageal squamous cell carcinoma (ESCC), and traditional examination methods suffer from poor tolerance and high invasiveness.

Method used

Using specific methylation sites cg05064044, cg03395511, and cg21548813 in peripheral blood mononuclear cells (PBMCs) as biomarkers, and combined with techniques such as pyrosequencing, a diagnostic kit was developed for the early detection of esophageal squamous cell carcinoma.

Benefits of technology

It improves the sensitivity and specificity of esophageal squamous cell carcinoma diagnosis, provides a stable and minimally invasive detection method, and helps clinicians quickly and accurately grasp the patient's condition and provide personalized treatment plans.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to a methylation site marker for assisting in the early diagnosis of esophageal squamous cell carcinoma and its application, belonging to the field of biomedical technology. The methylation site marker is one or a combination of methylation sites cg05064044, cg03395511, and cg21548813 in human peripheral blood mononuclear cells, with nucleotide sequences shown in SEQ ID NO. 1-3. This invention uses methylation chip detection to find that the methylation levels of cg05064044, cg03395511, and cg21548813 in peripheral blood mononuclear cells of esophageal squamous cell carcinoma patients were significantly higher than those in healthy controls. Further analysis revealed that the methylation levels of cg05064044, cg03395511, and cg21548813 in PBMCs of esophageal squamous cell carcinoma patients in both the training and validation cohorts were significantly higher than those in healthy controls. Finally, ROC curve analysis confirmed that the three methylation sites cg05064044, cg03395511, and cg21548813 have good specificity and sensitivity, and have high diagnostic efficacy when used alone or in combination for the diagnosis of esophageal squamous cell carcinoma. They can be used as potential molecular markers for the diagnosis of esophageal squamous cell carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a methylation site marker for assisting in the early diagnosis of esophageal squamous cell carcinoma and its application, belonging to the field of biomedical technology. Background Technology

[0002] Esophageal cancer, a common malignant tumor of the digestive system, ranks 7th in incidence and 6th in mortality among all malignant tumors worldwide. Esophageal squamous cell carcinoma (ESCC), the most common pathological type of esophageal cancer in my country, sees over 220,000 new cases and over 200,000 new deaths annually, posing a significant threat to people's lives and health. Because many ESCC patients lack typical clinical symptoms in the early stages and the disease progresses rapidly, some patients are already in the middle or late stages at initial diagnosis, leading to poor prognosis. Therefore, early detection and diagnosis are crucial for improving the prognosis of ESCC patients. Currently, the main screening methods for ESCC patients in clinical practice are esophageal cytology and imaging examinations such as upper gastrointestinal barium meal and chest and abdominal CT scans, but these have potential risks such as poor tolerance and contrast agent allergies. Furthermore, although tumor markers such as carbohydrate antigen 19-9 (CA19-9), squamous cell antigen (SCC), and cytokeratin 19 fragment-associated antigen (CYFRA21-1) have some indicative value in the diagnosis of ESCC, their sensitivity and specificity are both low. Therefore, it is of great significance to further explore non-invasive molecular markers with high sensitivity and specificity that can be used for early screening of ESCC.

[0003] DNA methylation, as an important epigenetic regulatory mechanism, is increasingly revealing its role in tumor diagnosis, development, and treatment. Studies have shown that DNA methylation often occurs in the early stages of tumors and remains stable throughout the entire process of tumor development. Therefore, DNA methylation has broad application prospects in the early diagnosis of tumors. Currently, research on DNA methylation in tumors mainly focuses on circulating tumor DNA (ctDNA) in plasma and tumor tissue. However, these examinations have certain limitations: plasma ctDNA is unstable and has a low concentration, while obtaining tumor tissue samples is highly invasive. In recent years, due to the stable presence of peripheral blood mononuclear cells (PBMCs) in peripheral blood and their advantages of simple, non-invasive, and low-cost isolation, the detection of DNA methylation sites in PBMCs has shown broad application prospects in non-invasive tumor examination and is expected to become a potential biomarker for non-invasive tumor detection. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a methylation site marker for assisting in the early diagnosis of esophageal squamous cell carcinoma and its application.

[0005] The technical solution of the present invention is as follows:

[0006] A methylation site marker for assisting in the early diagnosis of esophageal squamous cell carcinoma, wherein the methylation site marker is one or a combination of human peripheral blood mononuclear cell methylation sites cg05064044, cg03395511, and cg21548813.

[0007] According to a preferred embodiment of the present invention, the nucleotide sequence of the methylation site cg05064044 methylation region is shown in SEQ ID NO.1; the nucleotide sequence of the methylation site cg03395511 methylation region is shown in SEQ ID NO.2; and the nucleotide sequence of the methylation site cg21548813 methylation region is shown in SEQ ID NO.3.

[0008] A specific amplification primer for detecting the above-mentioned methylation site markers, wherein the nucleotide sequence of the specific amplification primer for methylation site cg05064044 is shown in SEQ ID NO. 4-5; the nucleotide sequence of the specific amplification primer for methylation site cg03395511 is shown in SEQ ID NO. 6-7; and the nucleotide sequence of the specific amplification primer for methylation site cg21548813 is shown in SEQ ID NO. 8-9.

[0009] Application of reagents for quantitatively detecting the methylation level of the above-mentioned methylation site markers in the preparation of products for diagnosing esophageal squamous cell carcinoma.

[0010] According to a preferred embodiment of the present invention, the reagent comprises a reagent for detecting the methylation level of the above-mentioned methylation site markers by at least one of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method, and quantitative fluorescence method.

[0011] More preferably, the reagent is the same as that used in pyrosequencing.

[0012] Most preferably, the reagents used in the pyrosequencing method include the specific amplification primers for detecting the methylation site markers described above; wherein, the nucleotide sequence of the specific amplification primer for methylation site cg05064044 is shown in SEQ ID NO. 4~5; the nucleotide sequence of the specific amplification primer for methylation site cg03395511 is shown in SEQ ID NO. 6~7; and the nucleotide sequence of the specific amplification primer for methylation site cg21548813 is shown in SEQ ID NO. 8~9.

[0013] According to a preferred embodiment of the present invention, the product for diagnosing esophageal squamous cell carcinoma includes at least one of a reagent kit, a test strip, and a chip.

[0014] A diagnostic kit for esophageal squamous cell carcinoma includes reagents for quantitatively detecting the methylation levels of the aforementioned methylation site markers.

[0015] A method for detecting the methylation levels of cg05064044, cg03395511, and cg21548813 for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting DNA samples from peripheral blood mononuclear cells;

[0017] (2) Pyrosequencing was used to detect the methylation levels of cg05064044, cg03395511, and cg21548813 in DNA samples using specific amplification primers.

[0018] Beneficial effects:

[0019] 1. DNA methylation is a novel biomarker. Unlike traditional biomarkers, it is not only stable, minimally invasive, and easy to detect, but also provides precise quantification, which will greatly improve the sensitivity and specificity of disease diagnosis. The discovery of methylation characteristics in esophageal cancer patients helps clinicians quickly and accurately grasp the patient's disease status and severity, enabling timely and more personalized prevention and treatment plans. Based on this, this invention uses methylation chip detection to discover that the methylation levels of cg05064044, cg03395511, and cg21548813 in peripheral blood mononuclear cells (PBMCs) of esophageal squamous cell carcinoma patients were significantly higher than those in healthy controls. Further analysis revealed that the methylation levels of cg05064044, cg03395511, and cg21548813 sites in PBMCs of esophageal squamous cell carcinoma patients in both the training and validation cohorts were significantly higher than those in healthy controls. Finally, ROC curve analysis confirmed that the three methylation sites cg05064044, cg03395511, and cg21548813 have good specificity and sensitivity, and have high diagnostic efficacy when used alone or in combination for the diagnosis of esophageal squamous cell carcinoma. They can be used as potential molecular markers for the diagnosis of esophageal squamous cell carcinoma.

[0020] 2. Methylation kits are systematic and comprehensive diagnostic kits that help reflect the methylation levels of different subjects. Combined with the subject's genotype and transcriptome data, they can rapidly determine the onset of tumors, providing a powerful supplement to previous auxiliary diagnoses of esophageal cancer. Based on this, this invention designs primers that can specifically amplify these three methylation sites: cg05064044, cg03395511, and cg21548813, providing a kit for diagnosing esophageal squamous cell carcinoma. This helps clinicians quickly and accurately understand the patient's condition and evaluate the clinical treatment effect. Attached Figure Description

[0021] Figure 1 The methylation levels of cg05064044, cg03395511, and cg21548813 in PBMC samples from 6 healthy controls and 6 ESCC patients were detected using a methylation chip assay.

[0022] Figure 2 The methylation levels of cg05064044, cg03395511, and cg21548813 in the training cohort PBMC samples were detected by pyrosequencing.

[0023] Figure 3 ROC curves for ESCC diagnosis of cg05064044, cg03395511, and cg21548813 methylation levels in the training cohort PBMC samples.

[0024] Figure 4 ROC curves for the combined use of the methylation levels of cg05064044, cg03395511, and cg21548813 in the training cohort PBMC samples for ESCC diagnosis.

[0025] Figure 5 The methylation levels of cg05064044, cg03395511, and cg21548813 in the validation cohort PBMC samples were detected by pyrophosphate sequencing.

[0026] Figure 6 To verify the use of methylation levels of cg05064044, cg03395511, and cg21548813 in cohort PBMC samples for ESCC diagnosis, ROC curves were plotted.

[0027] Figure 7 To verify the ROC curve of the combined use of cg05064044, cg03395511, and cg21548813 methylation levels in cohort PBMC samples for ESCC diagnosis. Detailed Implementation

[0028] The embodiments of the present invention will be described in detail below with reference to the examples. The following examples are implemented under the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given. Unless otherwise specified, the reagents and medicines involved in the examples are all commercially available products. Unless otherwise specified, the experimental steps involved in the examples are all conventional operations in the art. However, the protection scope of the present invention is not limited thereto.

[0029] This invention consists of three stages: screening, training, and validation. In the screening stage, the methylation levels of each CpG site in PBMC samples from 6 healthy controls and 6 ESCC patients were detected using a Gillumina 935K methylation chip, identifying three aberrantly expressed methylation sites: cg05064044, cg03395511, and cg21548813. In the training stage, pyrosequencing and ROC curve analysis were used to analyze the methylation levels and diagnostic efficacy of cg05064044, cg03395511, and cg21548813 sites in the training cohort (25 healthy controls and 25 ESCC patients) PBMCs. In the validation phase, methylation levels and diagnostic efficacy of cg05064044, cg03395511, and cg21548813 sites in the PBMCs of the validation cohort (25 healthy controls and 25 ESCC patients) were further validated by pyrosequencing and ROC curve analysis.

[0030] This invention included 56 patients with esophageal squamous cell carcinoma (ESCC) who underwent esophagectomy and lymph node dissection at the Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong First Medical University and Qilu Second Hospital of Shandong University from February to May 2024 as the ESCC group, and 56 healthy volunteers as the control group. None of the included esophageal squamous cell carcinoma patients had received neoadjuvant chemoradiotherapy or immunotherapy prior to surgery. Inclusion criteria: histologically confirmed ESCC; no history of other malignant tumors; complete clinicopathological data; complete tumor resection (R0 resection) achieved during surgery; and ≥12 lymph nodes dissected.

[0031] Example 1

[0032] 1. Collection of peripheral blood mononuclear cell (PBMC) samples

[0033] Two days before surgery and during physical examinations, approximately 3 mL of peripheral blood was collected from 56 ESCC patients and 56 healthy volunteers. The blood was placed in vacuum tubes containing EDTA anticoagulant and mixed by inverting. An appropriate volume of Ficoll solution was added from the bottom of the test tube to a 15 mL centrifuge tube. The peripheral blood was gently mixed with a pipette and then slowly added along the tube wall to the centrifuge tube containing Ficoll solution, allowing the Ficoll solution and peripheral blood to separate into layers. The ratio of Ficoll solution to blood was 1:(1~2).

[0034] Then, centrifuge at 700×g for 30 min at room temperature, with acceleration and deceleration rates of 3 and 3, respectively. After centrifugation, four layers appeared in the centrifuge tube from top to bottom. The top layer, a pale yellow liquid, was plasma; the second layer, a white, cloudy layer, was PBMCs; the third layer was a clear Ficoll separation solution; and the bottom layer was dark red, consisting of erythrocytes and granulocytes. Insert a 1 ml pipette tip above the PBMC layer (near the boundary between the first and second layers) and slowly aspirate the PBMCs into a 15 ml centrifuge tube. Resuspend the PBMCs in 1 ml of 1×PBS, and continue adding 1×PBS to a final volume of 10 ml, gently inverting to mix. Centrifuge at 450g for 5 min at 4°C, discard the supernatant, and obtain a peripheral blood mononuclear cell (PBMC) sample.

[0035] 2. Methylation chip detection

[0036] PBMC samples from 6 healthy controls and 6 ESCC patients were randomly selected from 56 samples and sent for testing. Shanghai Whale Gene Technology Co., Ltd. performed Illumina 935K methylation chip detection, with |Δβ|≥0.20. P ≤0.01 was used as a threshold to screen differentially expressed methylation sites, and the results are as follows: Figure 1 As shown.

[0037] Depend on Figure 1 It was found that, compared with the healthy control group, the methylation levels of cg05064044, cg03395511, and cg21548813 were significantly increased in the PBMCs of ESCC patients. This indicates that cg05064044, cg03395511, and cg21548813 are abnormally expressed in ESCC patients and have the potential to serve as diagnostic markers for esophageal squamous cell carcinoma.

[0038] Example 2

[0039] 1. Design primers

[0040] The information of cg05064044, cg03395511, and cg21548813 was confirmed based on the Illumina 935K methylation chip detection results in Example 1.

[0041] The nucleotide sequence of the methylation site cg05064044 is shown below:

[0042] AGGCCGCCGCACAGAAAGCCCTGCCCTCCACGCCGGGTCTCTGGAGCGCCCTGGGTTGCC[CG]GCCGGTCCCTGCCGCTGACTTGTTGACACTGCGAGCACTCAGTCCCTCCCGCGCGCCTCC (SEQ ID NO. 1).

[0043] The nucleotide sequence of the methylation site cg03395511 methylation region is shown below:

[0044] ATTAGCACCTGATTCACGGAGGCAGCCAAGGCTGGGTAGCGACTGCTGGTAACTGGCCCC[CG]GAGTCGCCCCAGGGGAAAAGGCCAAAGGGGGATCTGGAGACCCCCGGCCGGGGAGCGGGC (SEQ ID NO. 2).

[0045] The nucleotide sequence of the methylation site cg21548813 methylation region is shown below:

[0046] CCCCCAGAGACCAGGCCTCTGATTAGCACCTGATTCACGGAGGCAGCCAAGGCTGGGTAG[CG]ACTGCTGGTAACTGGCCCCCGGAGTCGCCCCAGGGGAAAAGGCCAAAGGGGGATCTGGAG (SEQ ID NO. 3).

[0047] Based on the above sequence information, specific amplification primers for detecting cg05064044, cg03395511, and cg21548813 are provided below:

[0048] Forward primer cg05064044: 5′-TTGGAGAGTTTTGGGTTGT-3′ (SEQ ID NO.4)

[0049] cg05064044 Reverse primer: 5′-AAACTAAATACTCCCAATATCAACAAATCA-3′ (SEQ ID NO.5)

[0050] Sequencing primers for cg05064044: 5′-GGAGAGTTTTGGGTTGTT-3′;

[0051] Forward primer cg03395511: 5′-TTGGGTAGAGATTGTTGGTAATTGGT-3′ (SEQ ID NO.6).

[0052] cg03395511 Reverse primer: 5′-CAAATCCCCCTTTAACCTTTTCC-3′ (SEQ ID NO.7)

[0053] Sequencing primers for cg03395511: 5′-GATTGTTGGTAATTGGTT-3′;

[0054] Forward primer for cg21548813: 5′-AGAGATTAGGTTTTTGATTAGTATTTGA-3′ (SEQ ID NO.8).

[0055] cg21548813 reverse primer: 5′-AAATCCCCCTTTAACCTTTTCC-3′ (SEQ ID NO.9)

[0056] Sequencing primers for cg21548813: 5′-GGTAGTTAAGGTTGGGTA-3′.

[0057] Then, Shanghai Whale Gene Technology Co., Ltd. was commissioned to artificially synthesize the above primers according to the sequence information.

[0058] 2. From the remaining 50 pairs of samples, 25 healthy controls and 25 ESCC patients were randomly selected as the training cohort. Pyrophosphate sequencing was performed on the methylation levels of cg05064044, cg03395511, and cg21548813 sites, and the diagnostic efficacy was analyzed by ROC curve analysis. The specific method is as follows.

[0059] Pyrophosphate sequencing:

[0060] (1) Sample quality control: DNA was extracted from the PBMC samples obtained in Example 1 using the Qiagen DNeasy Blood & Tissue Kit (50) #69504; then the DNA was quantified using the Qubit® 3.0 Fluorometer kit and NanoDrop One spectrophotometer; gel electrophoresis was then used to determine whether the DNA was degraded and whether there was protein and RNA contamination; DNA extraction and DNA quantification were performed in accordance with the kit instructions.

[0061] (2) Sulfite treatment: The DNA obtained in step (1) was converted to bisulfite using the EZ DNA Methylation Kits (Zymo, D5001 / D5003) strictly following the standard procedure manual provided by the kit manufacturer. The converted DNA was quantified using a NanoDrop One spectrophotometer.

[0062] (3) PCR amplification: Using the DNA obtained in step (2) as a template, PCR amplification was performed using the primers described above to obtain...

[0063] PCR amplification system: DNA template 2µL, forward primer (50pM) 1µL, reverse primer (50pM) 1µL, 5×buffer GC (KAPA) 10µL, dNTP (10mM) 1µL, Taq high-fidelity enzyme (5U / μL) 0.2µL, ddH2O 34.8µL, total volume 50µL.

[0064] PCR amplification program: pre-denaturation, 95℃ for 3 min; denaturation, 95℃ for 15 sec; annealing, 58℃ for 15 sec; extension, 72℃ for 90 sec (30 cycles); termination extension, 72℃ for 10 min; final incubation at 4℃.

[0065] (4) Pyrosequencing detection: Add 2 μL of reaction binding beads, 38 μL of binding buffer, and 40 μL of PCR product to a 96-well PCR reaction plate and mix thoroughly at room temperature for 10 min. Turn on the vacuum pump to aspirate the binding beads and PCR product suspension and immerse them in 70% ethanol, 0.2M NaOH, and washing buffer for 5 s each. Turn off the vacuum pump and place the binding beads and PCR product on the probe in 40 μL of annealing buffer (containing 1.5 μL of sequencing primers) and denature at 85℃ for 2 min. Cool to room temperature to allow the primers to anneal and hybridize with the template. According to the dose calculated by the sequence design information in the Pyrosequencing software, add the substrate mixture, enzyme mixture, and four dNTPs (QIAGEN) to the reagent chamber in sequence. Place the reagent chamber and the 96-well reaction plate into the Pyrosequencing instrument (PyroMarkQ96 ID, QIAGEN) for reaction.

[0066] The training cohort pyrophosphate sequencing results are as follows Figure 2 As shown, GraphPad Prism 9.5.0 software was used for further statistical analysis of the pyrosequencing data. The methylation levels of cg05064044, cg03395511, and cg21548813 sites in the PBMCs of healthy volunteers and ESCC patients in the training cohort were compared using t-tests. Based on the pyrosequencing results, receiver operating characteristic (ROC) curves were used to evaluate the specificity and sensitivity of cg05064044, cg03395511, and cg21548813 alone in the diagnosis of ESCC. The results are as follows. Figure 3As shown in the figure. Finally, ROC curves were used to evaluate the specificity and sensitivity of the combined use of cg05064044, cg03395511, and cg21548813 in the diagnosis of ESCC. The results are shown in the figure. Figure 4 As shown.

[0067] Depend on Figures 2-4 It can be seen that, consistent with the methylation chip detection results, the methylation levels at sites cg05064044, cg03395511, and cg21548813 in the PBMCs of ESCC patients in the training cohort were significantly higher than those in the healthy control group. P <0.001, Figure 2 Then, when cg05064044, cg03395511, and cg21548813 were used for ESCC diagnosis, the areas under the ROC curve (AUC) were 0.9056, 0.8744, and 0.8792, respectively, with sensitivities of 84.00%, 80.00%, and 84.00%, and specificities of 80.00%, 80.00%, and 80.00%, respectively. Figure 3 When all three are used together for ESCC diagnosis, the area under the ROC curve, sensitivity, and specificity are 0.9744, 91.67%, and 88.46%, respectively, indicating that they have high diagnostic efficacy for ESCC. Figure 4 ).

[0068] Example 3

[0069] Using PBMC samples from 25 remaining healthy controls and 25 ESCC patients as a validation cohort, pyrophosphate sequencing was performed on the methylation levels at cg05064044, cg03395511, and cg21548813 sites, and diagnostic efficacy was validated using ROC curves. The pyrophosphate sequencing and ROC curve validation methods are as described in Example 2.

[0070] The validation cohort pyrophosphate sequencing results are as follows Figure 5 As shown, GraphPad Prism 9.5.0 software was used for further statistical analysis of the pyrosequencing data. The methylation levels of cg05064044, cg03395511, and cg21548813 sites in the PBMCs of healthy volunteers and ESCC patients were compared and validated using t-tests. Based on the pyrosequencing results, ROC curves were applied to validate the specificity and sensitivity of cg05064044, cg03395511, and cg21548813 alone in the diagnosis of ESCC. The results are as follows. Figure 6As shown in the figure. ROC curves were then used to verify the specificity and sensitivity of the combined use of cg05064044, cg03395511, and cg21548813 in the diagnosis of ESCC. The results are as follows. Figure 7 As shown in the figure. P < 0.05 is considered statistically significant.

[0071] Depend on Figures 5-7 As shown in the results consistent with the methylation chip detection and training cohort, the methylation levels at cg05064044, cg03395511, and cg21548813 sites in the PBMCs of ESCC patients in the validation cohort were significantly higher than those in the healthy control group (P<0.001). Figure 5 Furthermore, ROC curve results showed that cg05064044, cg03395511, and cg21548813, when used for ESCC diagnosis, had areas under the ROC curves of 0.8952, 0.8816, and 0.9120, respectively, with sensitivities of 84.00%, 80.00%, and 80.00%, and specificities of 80.00%, 76.00%, and 80.00%, respectively. Figure 6 When all three are used in combination for ESCC diagnosis, the area under the ROC curve, sensitivity, and specificity are 0.9728, 92.00%, and 92.00%, respectively. This demonstrates that the three methods have high diagnostic efficacy for ESCC. Figure 7 ).

[0072] In summary, this invention, using methylation chip detection, revealed significantly higher methylation levels of cg05064044, cg03395511, and cg21548813 in peripheral blood mononuclear cells (PBMCs) of esophageal squamous cell carcinoma patients compared to healthy controls. Further analysis showed that the methylation levels of these three sites in the PBMCs of both the training and validation cohorts were significantly higher than in the healthy controls. Finally, ROC curve analysis confirmed that these three methylation sites (cg05064044, cg03395511, and cg21548813) possess good specificity and sensitivity, demonstrating high diagnostic efficacy when used alone or in combination for the diagnosis of esophageal squamous cell carcinoma, and can serve as potential molecular markers for the diagnosis of esophageal squamous cell carcinoma.

[0073] The embodiments described above are merely preferred implementations of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a reagent for quantitatively detecting the methylation level of methylation site markers in human peripheral blood mononuclear cells in the preparation of products for diagnosing esophageal squamous cell carcinoma, wherein the methylation site markers are one of the methylation sites cg05064044, cg03395511, and cg21548813 in human peripheral blood mononuclear cells, or any combination thereof.

2. The application as described in claim 1, characterized in that, The reagents are specific amplification primers for methylation site markers, wherein the nucleotide sequences of the specific amplification primers for methylation site cg05064044 are shown in SEQ ID NO. 4~5; the nucleotide sequences of the specific amplification primers for methylation site cg03395511 are shown in SEQ ID NO. 6~7; and the nucleotide sequences of the specific amplification primers for methylation site cg21548813 are shown in SEQ ID NO. 8~9.

3. The application as described in claim 1, characterized in that, The reagents include those for detecting the methylation level of the methylation site markers by at least one of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method, and quantitative fluorescence method.

4. The application as described in claim 3, characterized in that, The reagents are those used in pyrosequencing; the reagents used in pyrosequencing include specific amplification primers for detecting the methylation site markers; wherein, the nucleotide sequences of the specific amplification primers for methylation site cg05064044 are shown in SEQ ID NO. 4~5; the nucleotide sequences of the specific amplification primers for methylation site cg03395511 are shown in SEQ ID NO. 6~7; and the nucleotide sequences of the specific amplification primers for methylation site cg21548813 are shown in SEQ ID NO. 8~9.

5. The application as described in claim 1, characterized in that, The product for diagnosing esophageal squamous cell carcinoma is selected from at least one of the following: reagent kits, test strips, and chips.

Citation Information

Patent Citations

  • Test for detecting alzheimers disease

    US20200080132A1