DNA paper-cut system, method and product for anti-polymerase strand displacement

Abstract

The invention provides a DNA paper-cutting system, method and product for resisting polymerase chain displacement, and belongs to the field of DNA nanotechnology, the DNA paper-cutting system comprises: a DNA nanostructure comprising a cutting region and a non-cutting region; wherein on the template chain of the non-cutting area, a blocking sequence is arranged at the 5'end of a template chain section corresponding to at least one nicking site, and the blocking sequence is composed of one or more basic groups belonging to a target basic group type; the specific reaction buffer solution contains DNA (deoxyribonucleic acid) polymerase and a plurality of deoxyribonucleoside triphosphates except a specific deoxyribonucleoside triphosphate; wherein the type of the specific deoxyribonucleoside triphosphate deleted in the specific reaction buffer solution is complementary to the type of the target basic group.

Description

Technical Field

[0001] This application belongs to the field of DNA nanotechnology, and specifically relates to a DNA cutting system, method and product for resisting polymerase chain displacement. Background Technology

[0002] In polymerase-driven DNA sculpting technology, self-assembled DNA nanostructures are used as the substrate structure. In these self-assembled DNA structures, there are nicks between the 3' and 5' ends of adjacent component strands. When using polymerase as a sculpting agent to carve the molecular substrate, the polymerase recognizes these nicks between the component strands and, starting from the 3' end, performs polymerase chain displacement, removing the component strand that maintains the basic morphology of the structure and thus disrupting the substrate shape.

[0003] However, polymerases lack the ability to specifically recognize the numerous naturally occurring notches on the substrate, making them prone to initiating chain displacement reactions in non-target areas. This leads to the unintended removal of key component chains that maintain structural stability, thereby disrupting the overall morphology of the substrate. This non-specific overreaction is particularly severe at high polymerase concentrations, significantly limiting the accuracy of cutting and the robustness of the system. Constructing a substrate resistant to chain displacement activity in polymerase-based paper cutting is a crucial issue for improving the accuracy of the paper cutting system. Summary of the Invention

[0004] This application provides a DNA cutting system, method, and product for resisting polymerase chain displacement, used to construct a substrate with anti-chain displacement activity in polymerase cutting.

[0005] The first aspect of this application provides a DNA paper-cutting system for resisting polymerase chain displacement, the system comprising: DNA nanostructures include cleaved and uncleaved regions; wherein, on the template strand of the uncleaved region, a blocking sequence is provided at the 5' end of the template strand segment corresponding to at least one nick site, the blocking sequence consisting of one or more bases belonging to the target base type; Specific reaction buffer, containing DNA polymerase and multiple deoxyribonucleoside triphosphates except for one specific deoxyribonucleoside triphosphate; The specific deoxyribonucleoside triphosphate missing in the specific reaction buffer is complementary to the target base type.

[0006] In some embodiments, the base composition of the template chain in the trimmed region does not include bases belonging to the target base type.

[0007] In some embodiments, the target base type is thymine T; The specific deoxyribonucleoside triphosphate is deoxyadenosine triphosphate dATP; The specific reaction buffer contains three deoxyribonucleoside triphosphates: deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP).

[0008] In some embodiments, the blocking sequence consists of an arrangement of two bases belonging to the target base type.

[0009] In some embodiments, the DNA nanostructure is a single-stranded molecular tile.

[0010] In some embodiments, the single-stranded molecular structure is a rectangular grid structure, which is assembled from M rows × N columns of DNA single strands, where M and N are both integers greater than or equal to 2.

[0011] In some embodiments, the system further includes: At least one primer chain; The cut region includes a component chain with a preset primer binding site, the primer chain being configured to be complementary to the preset primer binding site.

[0012] A second aspect of this application also provides a DNA paper-cutting method, applied to the DNA paper-cutting system described in the first aspect of this application, the method comprising: Provide the DNA paper-cutting system; Incubate in the reaction environment provided by the specific reaction buffer; DNA polymerase is activated in the cut region and completes the strand displacement reaction to remove the cut region, thereby forming a target pattern on the DNA nanostructure.

[0013] The third aspect of this application also proposes a DNA nanopatterning device, which is prepared according to the DNA paper-cutting method described in the second aspect of this application.

[0014] A fourth aspect of this application also provides a DNA paper-cutting kit, comprising: Components for assembling the DNA paper-cutting system described in the second aspect of the embodiments of this application.

[0015] The beneficial effects of this application are as follows: The DNA cutting system provided by this application achieves spatially programmed control of polymerase activity by precisely coupling DNA nanostructure design with a specific reaction environment. The system pre-defines a blocking sequence composed of specific bases in front of the nick site on the template strand in the non-cutting region, and intentionally omits dNTPs complementary to these bases in the reaction environment. This design causes the DNA polymerase to automatically terminate the reaction due to raw material depletion in the non-cutting region, effectively protecting the critical structure of the substrate; simultaneously, the sequence design adapted to the target cutting region ensures that the polymerase can successfully perform strand substitution. This scheme significantly improves the accuracy, success rate, and structural stability of DNA cutting, laying a reliable foundation for the controllable preparation of complex nanopatterns.

[0016] The above description is only an overview of the technical solution of this application. In order to better understand the technical means of this application and to implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of this application more obvious and understandable, the following are specific embodiments of this application. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments or related technologies of this application, the accompanying drawings used in the description of the embodiments or related technologies will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. It should be noted that the scale in the drawings is for illustration only and does not represent the actual scale.

[0018] Figure 1 This is a schematic diagram of a polymerase chain displacement reaction process in an embodiment of this application; Figure 2 This is a schematic diagram of the structure of a DNA paper-cutting system according to an embodiment of this application; Figure 3 This is a schematic diagram of the structure of a single-chain molecular tile in an embodiment of this application; Figure 4 This is a schematic diagram of the structure of a blocking sequence in an embodiment of this application; Figure 5 This is a schematic diagram of a base mismatch structure in an embodiment of this application; Figure 6 This is a schematic diagram of the steps of a DNA paper-cutting method in an embodiment of this application; Figure 7 This is a morphological characterization diagram of a DNA nanostructure in an embodiment of this application. Detailed Implementation

[0019] To make the above-mentioned objectives, features, and advantages of this application more apparent and understandable, the technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0020] The terms "first," "second," etc., used in the specification and claims of this application are used to distinguish similar objects and not to describe a specific order or sequence. It should be understood that such terms can be used interchangeably where appropriate so that embodiments of this application can be implemented in orders other than those illustrated or described herein, and the objects distinguished by "first" and "second" are generally of the same class, not limited in number; for example, the first object can be one or at least two. Furthermore, in the specification and claims, "and / or" indicates at least one of the connected objects, and the character " / " generally indicates that the preceding and following objects are in an "or" relationship.

[0021] In polymerase-driven DNA sculpting, self-assembled DNA nanostructures are used as the sculpting substrate. In these self-assembled DNA structures, there are nicks between the 3' and 5' ends of adjacent component strands. When polymerase is used as the sculpting agent to carve the molecular substrate, the polymerase recognizes these nicks and, starting from the 3' end, performs polymerase chain displacement, removing the component strand that maintains the basic morphology of the structure and disrupting the substrate shape. Constructing a substrate resistant to chain displacement activity in polymerase sculpting is a key issue in improving the accuracy of the sculpting system.

[0022] In advancing the practical applications of structured DNA nanotechnology, research on the precise manipulation of nanostructure conformation is crucial. Tunable DNA nanostructures refer to DNA self-assembly systems that can undergo controllable conformational changes according to pre-set instructions in response to external material input or specific environmental signals, thereby performing specific functions. These structures are considered the core foundation for realizing various potential applications of DNA nanotechnology. For example, in drug delivery, by designing DNA nanostructures that can "open" and release drug molecules upon recognizing biomarkers specific to diseased cells, precise targeted therapy is expected, reducing side effects on normal tissues. In information security, utilizing the reversible conformational changes of DNA nanostructures to alter the arrangement or state of their surface coding patterns can provide novel physical carriers and solutions for information encryption and decryption. Therefore, in-depth exploration and enrichment of the dynamic regulation mechanisms of DNA nanostructures are key steps in realizing their broad application potential in biomedicine, information storage, and molecular computing.

[0023] In the field of DNA nanotechnology, existing cuttable substrate structures are mainly based on DNA origami. After establishing the target pattern, polymerase-driven removal of the area to be cut leaves the strokes to present the final pattern, i.e., relief etching. This relief etching method requires the removal of a significant number of component chains from the DNA nanostructure substrate, which somewhat compromises the structural stability.

[0024] In macroscopic engraving techniques, besides "positive engraving," "negative engraving" is also a commonly used method. This involves directly removing the strokes during engraving to reveal the target pattern on a relatively intact base. However, in paper cutting operations based on DNA origami, it's difficult to obtain "negative" patterns. This is because DNA origami contains a 7000+ nt long circular single strand as a scaffold strand. If designing a "negative" pattern, only the staple strand can be removed from the area to be cut, making it difficult to remove the scaffold strand. The remaining scaffold strand will affect the pattern's imaging, making the "negative" pattern difficult to observe.

[0025] In related technologies, structural tailoring based on single-stranded tile (SST) substrates is driven by Toehol-mediated chain substitution. This involves designing a one-to-one intrusive chain for each component chain in the region to be tailored, and removing these component chains through a Toehol chain substitution reaction to achieve substrate tailoring. Therefore, dozens or even hundreds of intrusive chains need to be designed for each target structure, resulting in high design complexity. Utilizing polymerase chain substitution as the tailoring driving force fully leverages the "one-to-many" advantage of primer-substrate in polymerase chain substitution, allowing a few short primer chains to replace most long intrusive chains, significantly reducing the complexity of tailoring design.

[0026] DNA polymerases, as common catalytic molecules in life processes, naturally possess the ability to regulate the dynamic behavior of DNA, making them an ideal driving force for nanostructure modulation. Among these methods, polymerase-driven DNA cutting is a representative regulatory approach. DNA cutting utilizes the strand displacement activity of polymerases to achieve shape cutting, referencing... Figure 1 , Figure 1 A schematic diagram of a polymerase chain displacement reaction process is shown, as follows: Figure 1 As shown, Figure 1 The 'a' in the diagram illustrates the polymerase chain displacement process. The substrate consists of imperfectly complementary double strands, with one single strand having a 3' overhang that binds to the primer strand. The polymerase recognizes the 3' nick at the primer strand and performs DNA polymerization in a dNTP-rich solution, replacing the shorter single strand in the substrate. The final product includes the newly formed double strand and the replaced single strand. Figure 1 Figure b illustrates a schematic diagram of DNA cutting driven by polymerase chain displacement. The component strands in the region of the DNA nanostructure to be cut are considered as the reaction substrate, as shown in b. The 3' end of the component strand to be removed extends into a hanging region, which binds to the primer strand. The polymerase, starting from the 3' nick site of the primer, uses the component strand to be removed as a substrate to generate a double-stranded product, simultaneously displacing the component strand from the main structure. By deploying 3' end extensions for all component strands within the region to be cut, the overall shape of the structure can be cut.

[0027] In polymerase chain displacement reactions (PCRs), the lack of specificity in polymerase recognition of 3′ nick sites can threaten the structural stability of the DNA molecular substrate. Typical DNA self-assembled structures usually consist of hundreds of component chains, each with a potential nick site at its 3′ end, which can be used as the starting point for DNA polymerization. If the polymerase mistakenly recognizes a non-target nick site, a critical component chain that maintains the basic structural morphology may be improperly removed, leading to disruption of the substrate configuration. Although studies have shown that steric hindrance within nanostructures can protect internal component chains from such excessive reactions to some extent, the overall shape of the molecular substrate can still be significantly disrupted at high polymerase concentrations.

[0028] In view of the above problems, this application provides a DNA cutting system, method, and product for resisting polymerase chain displacement, used to construct a molecular substrate against chain displacement activity in polymerase cutting. Specifically, the DNA cutting system provided in this application achieves spatially programmed control of polymerase activity by precisely coupling DNA nanostructure design with a specific reaction environment. The system pre-defines a blocking sequence composed of specific bases in front of the nick site of the template strand in the non-cutting region, and intentionally omits dNTPs complementary to these bases in the reaction environment. This design causes the DNA polymerase to automatically terminate the reaction due to the depletion of raw materials in the non-cutting region, effectively protecting the key structure of the substrate; at the same time, the sequence design adapted to the target cutting region ensures that the polymerase can successfully perform chain displacement. This approach significantly improves the accuracy, success rate, and structural stability of DNA cutting, laying a reliable foundation for the controllable preparation of complex nanopatterns.

[0029] The first aspect of this application proposes a DNA cutting system for resisting polymerase chain displacement, referring to... Figure 2 , Figure 2 A schematic diagram of a DNA paper-cutting system is shown, as follows: Figure 2 As shown, the system includes: DNA nanostructures include cleaved and uncleaved regions; wherein, on the template strand of the uncleaved region, a blocking sequence is provided at the 5' end of the template strand segment corresponding to at least one nick site, the blocking sequence consisting of one or more bases belonging to the target base type; Specific reaction buffer, containing DNA polymerase and multiple deoxyribonucleoside triphosphates except for one specific deoxyribonucleoside triphosphate; The specific deoxyribonucleoside triphosphate missing in the specific reaction buffer is complementary to the target base type.

[0030] The above-described DNA cutting system is configured such that, under the reaction environment provided by the specific reaction buffer, DNA polymerase can initiate and complete a strand displacement reaction in the cutting region to remove the region, while in the non-cutting region where the blocking sequence is provided, the strand displacement reaction is effectively inhibited.

[0031] In this embodiment, the DNA cutting system described above can be composed of a molecular substrate and a corresponding buffer solution. The system is based on a pre-designed DNA self-assembly nanostructure (such as a single-stranded molecular tile SST), which is divided into cutting regions (to be removed to form a pattern) and non-cutting regions (which need to be protected to maintain structural stability). In the non-cutting regions that need protection, a blocking sequence is designed at the critical position of the template strand (i.e., the strand that serves as the blueprint for synthesis) (the starting point of the template strand segment corresponding to each notch site, i.e., the 5' end). This sequence consists of one or more consecutive identical target bases (e.g., two consecutive thymine Ts).

[0032] The system uses a specially formulated reaction solution that provides DNA polymerase and most of the synthesis precursors (dNTPs), but intentionally omits a specific dNTP (e.g., dATP). This missing dNTP (e.g., dATP) is precisely complementary to the target base (e.g., T) of the blocking sequence. When the polymerase mistakenly initiates in the non-split region, its extension immediately encounters the target base (e.g., T) on the blocking sequence. Due to the lack of the necessary complementary precursor (e.g., dATP) in the environment, the synthesis reaction is forcibly terminated, thus protecting the region. Conversely, the template strand in the split region is designed to function normally under this absence, allowing for precise removal.

[0033] In some embodiments, the base composition of the template chain in the trimmed region does not include bases belonging to the target base type.

[0034] To remove the DNA strand from the cut region in a specific reaction buffer (i.e., lacking a specific dNTP, such as dATP), if the template strand of the cut region contains a base of the target base type (e.g., thymine T), then when DNA polymerase synthesizes a new strand along that template strand, it will need to add a specific dNTP that complements it (e.g., dATP is needed when encountering T). To avoid the aforementioned contradiction leading to cut failure, the embodiments of this application propose that the template strand corresponding to the cut region cannot contain a base of the target base type in its base sequence (e.g., it cannot contain the base T). This ensures that in a reaction environment lacking a specific dNTP (such as dATP), the DNA polymerase will not request the missing raw material (specific deoxyribonucleoside triphosphate) from the system throughout its extension along the template strand of the cut region. Therefore, the polymerase can complete the entire strand displacement reaction smoothly, thereby successfully removing the DNA strand from the cut region.

[0035] In some embodiments, the target base type is thymine T; The specific deoxyribonucleoside triphosphate is deoxyadenosine triphosphate dATP; The specific reaction buffer contains three deoxyribonucleoside triphosphates: deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP).

[0036] Specifically, the target base type is thymine. In the non-split region requiring protection, the blocking sequence designed on the template strand consists of one or more consecutive T bases (e.g., a "TT" dinucleotide sequence). The specific deoxyribonucleoside triphosphate is deoxyadenosine triphosphate, meaning that to achieve the protective function, the reaction system must deliberately not provide dATP. When DNA polymerase erroneously initiates in the non-split region and encounters a T on the template strand, it must add dATP to continue synthesis. Since there is no dATP in the environment, the polymerization reaction is forcibly and precisely terminated here, thus protecting the structure. Simultaneously, the template strand in the split region is designed to be T-free (or have a very low T content), so the polymerase does not require dATP when working in this region, and can successfully synthesize a new strand to replace the old one, completing the splitting process.

[0037] In this embodiment, the target base type in the blocking sequence can be any type, as described in the following embodiments.

[0038] In some embodiments, the target base type is adenine A; The specific deoxyribonucleoside triphosphate is deoxythymidine triphosphate dTTP; The specific reaction buffer contains three deoxyribonucleoside triphosphates: deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), and deoxyguanosine triphosphate (dGTP).

[0039] In some embodiments, the target base type is guanine G; The specific deoxyribonucleoside triphosphate is deoxycytidine triphosphate dCTP; The specific reaction buffer contains three deoxyribonucleoside triphosphates: deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP).

[0040] In some embodiments, the target base type is cytosine C; The specific deoxyribonucleoside triphosphate is deoxyguanosine triphosphate (dGTP); The specific reaction buffer contains three deoxyribonucleoside triphosphates: deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), and deoxythymidine triphosphate (dTTP).

[0041] In some embodiments, the blocking sequence consists of an arrangement of two bases belonging to the target base type.

[0042] In this embodiment, the blocking sequence consists of two consecutive bases of the same type side by side (e.g., TT, AA, GG, or CC). This design of consecutive double bases terminates polymerase elongation more effectively and reliably than a single base.

[0043] In some embodiments, the DNA nanostructure is a single-stranded molecular tile.

[0044] In some embodiments, the single-stranded molecular structure is a rectangular grid structure, which is assembled from M rows × N columns of DNA single strands, where M and N are both integers greater than or equal to 2.

[0045] In this embodiment, the DNA nanostructure is a DNA molecular substrate of the single-stranded molecular tile type, and the entire structure is composed of multiple short DNA single strands with different sequences (i.e., "molecular tiles" or "component strands") pieced together. Figure 1 The sample is assembled directly through complementary base pairing, eliminating the need for a long scaffold. Because the SST structure is free from the constraint of a long scaffold, after cutting (removing part of the strand), especially during "intaglio" carving, the target pattern area can be completely clear, with no residual scaffold strand interfering with imaging. This perfectly solves the problem of achieving clear intaglio patterns on DNA origami substrates. Furthermore, its entirely short-stranded nature allows each strand to function as an independent operational unit, providing a foundation for precise cutting.

[0046] This embodiment uses a single-stranded molecular tile DNA nanostructure as a molecular substrate, as shown in the schematic diagram below. Figure 3 As shown, Figure 3 A schematic diagram of a single-stranded molecular tile is shown. Exemplarily, this molecular tile is assembled from 375 DNA strands arranged in 25 rows and 15 columns. To clearly show the details, only a portion is depicted in the schematic diagram; the remaining portion is arranged periodically, as detailed in the DNA strand sequences in the later embodiments. The arrowed segments in the diagram represent single DNA strands, assembled into a rectangular structure through complementary base pairing. The strands in the middle row with 3' overhangs are the strands to be cut; therefore, after DNA cutting, a line segment can be left on the base plate. The light-colored area at the 3' end of the base plate represents the blocking sequence, such as... Figure 3 The circled area shows details as follows: Figure 4 As shown, Figure 4 A schematic diagram of a blocking sequence is shown. Blocking sequences are designed into all component strands in the non-pruned region to improve the stability of the structure at high polymerase concentrations.

[0047] To ensure the blocking sequence functions effectively, the reaction system (specific reaction buffer) provides only dCTP, dGTP, and dTTP (three deoxyribonucleoside triphosphates), and not dATP. Therefore, the sequence of the strand to be cut (i.e., the template strand of the cut region) consists only of A, G, and C, ensuring that the polymerase can still successfully extend and remove the strand during the strand displacement reaction. The adjacent uncut strand retains the blocking sequence (i.e., an AA sequence before the 3' nick). Since the strand to be cut does not contain T, a two-base mismatch will occur at the interface during hybridization, such as... Figure 5 As shown, Figure 5 A schematic diagram of a base mismatch structure is shown. This mismatch has little impact on the overall structural stability and helps to reduce the binding strength of the chain to be pruned, thereby promoting its selective removal; therefore, it is retained in the design.

[0048] In some embodiments, the system further includes: At least one primer chain; The cut region includes a component chain with a preset primer binding site, the primer chain being configured to be complementary to the preset primer binding site.

[0049] Specifically, a primer chain is a short, single-stranded DNA molecule, typically 15-30 nucleotides in length. The primer chain sequence is carefully designed to bind highly specifically to a pre-exposed single-stranded region (called a "primer binding site" or "3' overhang sequence") on a specific component strand (the strand to be cut) within the DNA nanostructure cutting region through complementary base pairing (AT, CG). The primer chain does not bind randomly; its target is a pre-designed primer binding site (i.e., a pre-defined primer binding site) on a specific component strand within the cutting region. This site is usually a 3' overhang sequence on the strand to be cut. The term "complementary" defines the interaction between the primer and the target as base pairing. In this system, the DNA nanostructure provides a cuttable substrate and a protected region; a specific buffer (lacking specific dNTPs) creates a selective environment; and the primer chain, by binding to the pre-defined primer binding site, precisely guides the DNA polymerase to initiate a strand displacement reaction at the correct location (the cutting region).

[0050] This application proposes to use blocking sequences to reinforce the nicked positions of adjacent component chains on a molecular substrate (i.e., DNA nanostructure), thereby limiting the chain displacement reaction of polymerase at these sites. This allows the polymerase to act more accurately on the component chains that need to be removed, protecting the structural stability of conventional components and providing a more precise and structurally stable molecular substrate for polymerase-driven DNA cutting systems.

[0051] The molecular substrate proposed in this application is based on a single-stranded molecular tile-type DNA nanostructure, which enables the cutting of etched patterns. Since there is no backbone chain constraint in the SST, the target pattern can be observed under a microscope after removing the component chains corresponding to the etched areas. The etched pattern retains more of the molecular substrate structure, thus improving the structural stability of the target pattern.

[0052] The second aspect of this application also proposes a DNA paper-cutting method, applied to the DNA paper-cutting system described in the first aspect of this application, with reference to... Figure 6 , Figure 6 A schematic diagram illustrating the steps of a DNA paper-cutting method is shown, as follows: Figure 6 As shown, the method includes: Step S101: Provide the DNA paper-cutting system; Step S102: Incubate in the reaction environment provided by the specific reaction buffer; Step S103 involves initiating DNA polymerase in the cut region and completing the strand displacement reaction to remove the cut region, thereby forming a target pattern on the DNA nanostructure.

[0053] To address the aforementioned issues, this application introduces a strategy based on blocking sequences for constructing DNA molecular substrates resistant to polymerase chain displacement activity. This is achieved by introducing specific sequences into the nanostructure to regulate the self-assembly process. The mechanism of action of the blocking sequences is as follows: Figure 4 As shown: The strand to be replaced, preceding the 3′ nick site on the primer strand, has its 5′ end designed with two consecutive adenines (AA), and the complementary template strand corresponds to two thymines (TT). Only dCTP, dGTP, and dTTP (three deoxyribonucleoside triphosphates) are provided in the reaction system, with dATP intentionally omitted. Since polymerase cannot incorporate dATP into the T template, strand elongation is inhibited at this point, effectively terminating the strand replacement reaction. When constructing the DNA molecular substrate, a "TT" sequence is introduced into the template strand for all nick sites corresponding to component strands (i.e., non-cut regions) that maintain structural stability. This design effectively blocks non-specific polymerase activity, significantly enhances the substrate's resistance to strand replacement reactions, and achieves structural reinforcement.

[0054] The above system and paper-cutting method will be described below through an embodiment.

[0055] First, a molecular substrate meeting the requirements of this application (i.e., the DNA nanostructure corresponding to the DNA cutting system described in the first aspect of this application, which can be a molecular substrate) was obtained, and sequence adjustments and optimizations were performed on specific functional strands (such as the strand to be cut and the T-Barrier modified strand). In this embodiment, a single-stranded molecular tile DNA nanostructure is used as the molecular substrate, and the structural schematic diagram is shown below. Figure 3 As shown, the molecular structure is assembled from 375 DNA strands arranged in 25 rows and 15 columns, all of which were purified using the High Affinity Purification (HAP) method. The DNA sequence was in dry powder form and needed to be dissolved and its concentration measured. First, the dry DNA powder was centrifuged at 8000 rpm for 3 minutes. The sample tube was carefully removed, and an appropriate amount of deionized water was added (the amount is indicated on the packaging tube). The tube was vortexed for 3 minutes, and the solution was collected at the bottom of the tube using a handheld centrifuge. The concentration of the dissolved DNA was then measured.

[0056] The sequence information of the 375 DNA strands in the molecular substrate is as follows, including: The conventional component strands (corresponding to the non-split regions in the DNA nanostructure) are numbered Bxy, where x is the row number and y is the column number. They are used to maintain structural shape stability. B-1-1,AATCGAGGGATTTTTTTTTTTT;B-1-2,AACCGCTCGACGATATCGAGC;B-1-3,AACTTAGTTTGGGAGGGCCTC;B-1-4,AAAAGCATCCTAAAGCGTATC;B-1-5,AAGAATATCCAATCTTAGGTG;B-1-6,AATATGCTTAGGCCAATAAAC;B-1-7,AACTTAGGCTCCAACAAGGTG;B-1-8,AATGCTATGATTGCACTCACT;B-1-9,AAATTAGGAAGTACATCCGTT;B-1-10,AACATACAGGCCTTAGGAGTT;B-1-11,AACCGGTCGGGAATAGTTGAT;B-1-12,AATAACACGTGTAGGGATTTC;B-1-13,AAATAACCTAAGTATGAGCTG;B-1-14,AACGTCCGTAGGTCAAAGCGA;B-1-15,TCCTACCGATCCGCGGAAGCC.

[0057] B-2-1,TCCCTCGATTGCTCGATATCGTTTACTCTGAGCTTAAAGGCC;B-2-2,TCGAGCGGTTGAGGCCCTCCCAAAAAGCAATCGGCCTATCAA;B-2-3,AAACTAAGTTGATACGCTTTAAAAGAACGCTCGGCCATGTTT;B-2-4,GGATGCTTTTCACCTAAGATTAATCCAGCTCCACGCCTTGTG;B-2-5,GGATATTCTTGTTTATTGGCCAATCATATTTCGCGGGACTGA;B-2-6,TAAGCATATTCACCTTGTTGGAAAGGATTAAACCTACCGTGC;B-2-7,AGCCTAAGTTAGTGAGTGCAAAAATATGAATTAGGTATCGTA;B-2-8,TCATAGCATTAACGGATGTACAAGATACTCTGGACGGGCTTC;B-2-9,TTCCTAATTTAACTCCTAAGGAAATCAACACGCGCGATGATG;B-2-10,CCTGTATGTTATCAACTATTCAACATCATATAACGTATTTCT;B-2-11,CCGACCGGTTGAAATCCCTACAAAGCAGACCCAATCCTCCTG;B-2-12,ACGTGTTATTCAGCTCATACTAAACGCGTAGTTTAGGCACTG;B-2-13,TAGGTTATTTTCGCTTTGACCAAGTTTGCGCCCATGCGGTTG;B-2-14,TACGGACGTTGGCTTCCGCGGAAACTCTACTAACGGGCGTGA;B-2-15,ATCGGTAGGATTTTTTTTTTTAATGGGCGTTTTTTTTTTTTT。

[0058] B-3-1,TCAGAGTAAATTTTTTTTTTTAAGCATTTCATTTTTTTTTTT;B-3-2,ATTGCTTTTTGGCCTTTAAGCAATCCTAGCCGAATCAGGAAC;B-3-3,AGCGTTCTTTTTGATAGGCCGCTGTGGCTTTACCCGCTTATA;B-3-4,GAGCTGGATTAAACATGGCCGTGTTCTTCTTC TTTCTTGTCG;B-3-5,AAATATGATTCACAAGGCGTGGTCCGTTCTGTTTGCCTCGTG;B-3-6,TTAATCCTTTTCAGTCCCGCGTTTCGTTCGTGTCGGGTGTTT;B-3-7,ATTCATATTTGCACGGTAGGTTGCTGCCCTGTTCTCCTCTGC;B-3-8,AGAGTATCTTTACGATACCTA AACTCCGTGGCGTGGCCGTTT;B-3-9,GTGTTGATTTGAAGCCCGTCCTTGTTGCCTTCGCAATTTCGA;B-3-10,ATATGATGTTCATC ATCGCGCTCGTCCCTTTCTTTCTTTGGT;B-3-11,GGTCTGCTTTAGAAATACGTTCTTTCTTGTTTCGTGTGTTCT;B-3-12,CTACGCG TTTCAGGAGGATTGTTGGCTTGTTTGTTGTTGGCC;B-3-13,GCGCAAACTTCAGTGCCTAAATCTGCGTTGTGGTTGGTTCTT;B-3-14, OWNTTTCAACCGCATGGAATGGGTGGACTTCTTGCTGC;B-3-15,AACGCCCATTTCACGCCCGTTTGAAGGCCTACGGAAACACGC。

[0059] B-4-1,TGAAATGCTTGTTCCTGATTCCCTGAAGCGGCTCCCTAGATA;B-4-2,GGCTAGGATTTATAAGCGGGTAATAGGGAGTAGTTCCCTCCT;B-4-8,CCACGGAGTTTCGAAATTGCGAAGGAATGAGGGTACACATGC;B-4-14,TCCACCCATTGCGTGTTTCCGAATAAACTTAATTGAGTTAGT;B-4-15,TAGGCCTTCATTTTTTTTTTTAACCGACCCTTTTTTTTTTTT。

[0060] B-5-1,CCGCTTCAGGTTTTTTTTTTTAAGCACATTGTTTTTTTTTTT;B-5-2,ACTCCCTATTTATCTAGGGAGAAGAGACTACGGGATCCTAAG;B-5-3,TCGTCGTTGGAGGAGGGAACTGGCTTTGTCCTAGTTAATCAC;B-5-4,TTTGTTGTTCCTGGTTGCTCTAAGTCCTGTGTCCGTTGCGTC;B-5-5,CCTCCTCTTTTGTTCTGCTCTAAATAAGCGTCTTTGCAAATG;B-5-6,TTTTGTTTCTTCGGCCCTGTTAAAGGCGAGCGTGTGAAAGTC;B-5-7,GTCTCTGCGCTTGTTTTGTTCAAATTGTATTACAAAGCTATA;B-5-8,CTCATTCCTTTTTGGCTCTTGTTTGTGGTTCGCTTTCGGCCG;B-5-9,GTCTTTTGTTGCATGTGTACCAATGAACTTGGTTTCTTCTTG;B-5-10,GTCCGTGCGTTGCCTGTGCTCAATAGAGCCCTATCGCCCTTA;B-5-11,CCTTCTTGCCGGGTTGCCCTGAAGTGCTTGTGGGAGCGGAGA;B-5-12,CGCCCGGGCTTGCGTTGCTCGAATGCTTTAAGACCCGCGTGA;B-5-13,TTCTTGCTTTTGTTTCTCTGCTTGTCCCGTTGCCTCTATACA;B-5-14,TAAGTTTATTTGGTTTCGTCTAACGCCGGAAGTTCTTCGCTC;B-5-15,AGGGTCGGTTACTAACTCAATTGTACAGCAACTACTTTAATA。

[0061] B-6-1,CAATGTGCTTCTTAGGATCCCAATCCCTATCATAAAGCCCAC;B-6-2,GTAGTCTCTTGTGATTAACTAAAACGGCTAGTTTTCTCTTCT;B-6-4,CACAGGACTTCATTTGCAAAGAACCCGTTACTAGGGTAGCAA;B-6-5,ACGCTTATTTGACTTTCACACAATGCCATTGGGTCGTCCACG;B-6-6,GCTCGCCTTTTATAGCTTTGTAATAATCGGTGGCTTCATGAG;B-6-7,AATACAATTTCGGCCGAAAGCAACGGTCCTCGGGTGCTCTGT;B-6-9,CAAGTTCATTTAAGGGCGATAAACCGCCGACCGACAGGAGTA;B-6-10,GGGCTCTATTTCTCCGCTCCCAAGTTCTCCTCGATGGTCAGC;B-6-11,ACAAGCACTTTCACGCGGGTCAAGTATTAGGTAATCGAATCG;B-6-12,TTAAAGCATTTGTATAGAGGCAAACCATCCGCGTCGCTTCGC;B-6-14,TTCCGGCGTTTATTAAAGTAGAATTAGGAATACTGAATCTCG;B-6-15,TTGCTGTACATTTTTTTTTTTAACGTAAGAGTTTTTTTTTTT。

[0062] B-7-1,GATAGGGATTTTTTTTTTTAAACTCCCATTTTTTTTTTTTTT;B-7-2,CTAGCCGTTTGTGGGCTTTATCGCTGGCAGCTGAATCGGGAG;B-7-4,GTAACGGGTTTGTTGCTTGTTAACTCTTTCCTTCCCGTCTCC;B -7-5,CAATGGCATTTTGCTACCCTAAAGTTACGGGTAGACACGT;B-7-6,ACCGATTATTCGTGGACGACCAAACTGACAGGAATGGAAAGG;B-7-7,GAGGACCGTTCTCATGAAGCCAAGTTAAGGGTCAAAGAATG;B-7-6 7-9,GTCGGCGGTTGGTCGTTCTCTCTAACGAAAGTCTCCGTTGTTCT;B-7-10,AGGAGAACTTTACTCCTGTCGAACCTTAATAGCTCTCTATAT;B-7-11,CCTAATACTTGCTGACCATCGAACGCGTTTGTTCCAACTTCA;B -7-12,CGGATGGTTTCGATTCGATTAAAGGCTTCCTGGTTCATCAGC;B-7-14,ATTCCTAATTTGTTTGTTTGGAATTACGGTGGCTTTCTTCTT;B-7-15,CTCTTACGTTCGAGATTCAGTCTTTGCTCTCGAACTGGAATT。。

[0063] B-8-1,ATGGGAGTTTCTCCCGATTCACGGAGGTAAACACTGCAAGCG;B-8-2,GCTGCCAGTTTGTTGTTTCTTAACTTGACTATTCGGTTCTGC;B-8-4,GGAAAGAGTTACGTGTCTACCAAGCACCTCCCTCCCTGCACT;B-8-5,CGTAACTTTTCCTTTCCATTCAACTCTAGGGCAAATGCAAAG;B-8-6,CTGTCAGTTTCAATTCTTTGAAACGATTTAACAGGCCGGATC;B-8-7,CCCTTAACTTTGTCGTCGTGGAATCGCGGATTCCTGTGGTCT;B-8-9,GACTTTCGTTATATAGAGAGCAACAAAGTTACCGCGACCCAT;B-8-10,TATTAAGGTTTGAAGTTGGAAAAGGCTCTTTAATACCTCCAA;B-8-11,CAAACGCGTTGCTGATGAACCAATACGCAGGAGTCGATGACG;B-8-12,AGGAAGCCTTTGCGCGTTTGGAATTTACGCGGTTTCTTTCGG;B-8-14,CACCGTAATTAATTCCAGTTCAATGGGAACCTGGGAGCCGTG;B-8-15,GAGAGCAAAGTTTTTTTTTTTAAGCGGTTGATTTTTTTTTT。

[0064] B-9-1,TTTACCTCCGTTTTTTTTTTTAACGAAGGAATTTTTTTTTTT;B-9-2,TAGTCAAGTTCGCTTGCAGTGTCCAGAAGAAGCGTGGCTGCG;B-9-4,GGAGGTGCTTTGTTTCTTCTTAATCAATCCCTCCCTCTTGGC;B-9-5,CCCTAGAGTTAGTGCAGGGAGAATATAATTATCCCTTTACGA;B-9-6,TTAAATCGTTCTTTGCATTTGAAAGCTGGCCGATCTACTTCC;B-9-7,ATCCGCGATTGATCCGGCCTGAAACCATGCACGAGCGACCTG;B-9-9,TAACTTTGTTTTTGGGCTGGTAATGTCAGACCCTTTTGTGTT;B-9-10,AAAGAGCCTTATGGGTCGCGGAAGTAATGTGGATTGCGACAC;B-9-11,CCTGCGTATTTTGGAGGTATTAAAGGCTACCGCGAACTTGTC;B-9-12,CGCGTAAATTCGTCATCGACTAAGCCGGTAGCCTTAAAGTGC;B-9-14,GGTTCCCATTTTCTGCGCTGCAACTCTTCGCGTTTGGTTGTC;B-9-15,TCAACCGCTTCACGGCTCCCAATGTACCACTATCCCGCGCTG。

[0065] B-10-1,TTCCTTCGTTCGCAGCCACGCGTAGACCGCTGTTTCTTCGGT;B-10-2,TTCTTCTGTTTGCTTTGCTCCAACACAGACGTCTTGGTTCTC;B-10-4,GGGATTGATTTCGTAAAGGGAAAACCAGAATCAATGTGACTC;B-10-5,TAATTATATTGGAAGTAGATCAACATTTCAGCGGCACCTCCT;B-10-6,GGCCAGCTTTCAGGTCGCTCGAAGCTGACCCTGTTCGGTGTA;B-10-7,TGCATGGTTTTGTCTTGGCCTAAAGAATTTAGCTTTCTTCTC;B-10-9,GTCTGACATTGTGTCGCAATCAAGGAGCCCTGCCCTAAGCAC;B-10-10,CACATTACTTGACAAGTTCGCAAACACGAAGATGATGACGCA;B-10-11,GGTAGCCTTTGCACTTTAAGGAAAGATAGGGAAAGACTGGCT;B-10-12,CTACCGGCTTGGTTGTTCTTGAACGCCAGAAGGGTTGTTGTT;B-10-14,GCGAAGAGTTCAGCGCGGGATAATCAACATAGGGCTTTGGCC;B-10-15,AGTGGTACATTTTTTTTTTTTAATTAGTGCTTTTTTTTTTTT。

[0066] B-11-1,AGCGGTCTACTTTTTTTTTTTAACGCATCTCTTTTTTTTTTT;B-11-2,CGTCTGTGTTACCGAAGAAACTCGCGAGCCGCTAGGTGTGGA;B-11-4,ATTCTGGTTTGGGCTGTGGCCAAGGTATGTATGTTCGTGTCC;B-11-5,CTGAAATGTTGAGTCACATTGAATGAAAGGGTCTCATATGGC;B-11-6,GGGTCAGCTTAGGAGGTGCCGAAAGGACCGTCTGAAACAGGC;B-11-7,TAAATTCTTTTACACCGAACAAAACCATGACAGCTCCCGCTG;B-11-9,AGGGCTCCTTCCTTTCGTGGGAACAGGTAGGCCGTTTCTTTC;B-11-10,CTTCGTGTTTGTGCTTAGGGCAATGTACAATTTACCGGTCAT;B-11-11,CCCTATCTTTTGCGTCATCATAATCACTGACTCCATATCCCG;B-11-12,TTCTGGCGTTAGCCAGTCTTTAAAACAACACACGCCACTGTA;B-11-14,TATGTTGATTTGCTCTGTTGTAAAGAACGGACTGTTTGTTTC;B-11-15,AGCACTAATTGGCCAAAGCCCAGGTTAGTTGTGGAACCTCGC。

[0067] B-12-1,GAGATGCGTTTCCACACCTAGTTGAGTCGTTATGTAGCCTCT;B-12-2,CGGCTCGCTTTGGCTGGTTGGAAAGACGCGTTCTTTCTCTTG;B-12-4,TACATACCTTGCCATATGAGAAATAGCGGAGATTGGTCACCT;B -12-5,CCCTTTCATTGCCTGTTTCAGAATAGCCGTATTGTCGCTTCA;B-12-6,ACGGTCCTTTCAGCGGGAGCTAATTATTACTTATGAGGGCTA;B-12-7,GTCATGGTTTGTGCTGTTGCTAAGTTATCTCCGCGGTCCGCT;B- 12-9,CCTACCTGTTATGACCGGTAAAAAGAAACACATATAGTCAGG;B-12-10,ATTGTACATTCGGGATATGGAAAGTGAAAGCTTACCTAAGAG;B-12-11,GTCAGTGATTTACAGTGGCGTAACGGTTGGGCGCGAGGGCAT;B -12-12,GTGTTGTTTTTTTGTCTCGCTAAGCAGACTATTCTTCGTTTG;B-12-14,TCCGTTCTTTGCGAGGTTCCAAACCATCCATATAAGGAACGC;B-12-15,CAACTAACCTTTTTTTTTTTTAATTTATTTTTTTTTTTTT.

[0068] B-13-1,AACGACTCAATTTTTTTTTTTAAAAGGTCCATTTTTTTTTTT;B-13-2,ACGCGTCTTTAGAGGCTACATAAAAGCCTATATGCTTTACTG;B-13-4,CTCCGCTATTGCTTCTTCTTGAAGTGTCTGGGCGCTTCCTTG;B-13-5,TACGGCTATTAGGTGACCAATAAATTGAGGTGTGGGCGGGCT;B-13-6,AGTAATAATTTGAAGCGACAAAAACCCTTAGGACGGCATTTG;B-13-7,GAGATAACTTTAGCCCTCATAAACTCCAACCGGCTTTGTGTA;B-13-9,GTGTTTCTTTTGTGTGTTTTGAATGGTCACGTGGGTCGTGGT;B-13-10,GCTTTCACTTCCTGACTATATAAACCGCTCAATCGCCGTTAG;B-13-11,CCCAACCGTTCTCTTAGGTAAAAGCAGCGTCGACACAATCGT;B-13-12,TAGTCTGCTTATGCCCTCGCGAAAACCAGCCAGACGTTCAGG;B-13-14,ATGGATGGTTGTGGTTGCTTTAATTAATACACTTGGTTTGGT;B-13-15,AATATAAATTGCGTTCCTTATGCAGTGATTTACAGGGCTCAA。

[0069] B-14-1,TGGACCTTTTCAGTAAAGCATTAGGAGTCCAGGTAATCATAA;B-14-2,ATAGGCTTTTTTTGCTTTCTTAAGCAGAATTGTTCTTCTTCT;B-14-4,CCAGACACTTAGCCCGCCCACAATTCTCTGTGCACCCAGATA;B-14-5,ACCTCAATTTCAAATGCCGTCAAAAGACGAATAGAAATTGAC;B-14-6,CTAAGGGTTTTACACAAAGCCAACCTCTAAAGCAGTCGCTCT;B-14-7,GGTTGGAGTTCGTTTCTGTTGAACTTATAGCCGTCGCGTGGC;B-14-9,CGTGACCATTCTAACGGCGATAACCGCACGTTAGTAACTGTG;B-14-10,TGAGCGGTTTACGATTGTGTCAAATAATTCAAGCGGGCCTCT;B-14-11,GACGCTGCTTCCTGAACGTCTAAGCTGGCCTGGAATGGTAAA;B-14-12,GGCTGGTTTTCGGTCTTTGCTAAGCCGGTACTCTTGTCCTGT;B-14-14,TGTATTAATTTTGAGCCCTGTAACACCAGATCTATGGGTATC;B-14-15,AAATCACTGCTTTTTTTTTTTAATCTGGAAGTTTTTTTTTTT; B-15-1,TGGACTCCTATTTTTTTTTTTAACTTGCCCTTTTTTTTTTTT;B-15-2,AATTCTGCTTTTATGATTACCAATACCCATGCTGTTTATGTA;B-15-4,ACAGAGAATTTTTCTTGTTGTAATTGGGAAACGGCCTGGTGT;B-15-5,TTCGTCTTTTTATCTGGGTGCAATCTATATATAAAGTTCTGA;B-15-6,TTTAGAGGTTGTCAATTTCTAAATCCATGGCCAGCCCAAGAG;B-15-7,GCTATAAGTTAGAGCGACTGCAAAATAGGGCGAATTACGGTA;B-15-9,ACGTGCGGTTTTTTGCTCTGGAAATACAACCTCTTCCGTTCT;B-15-10,TGAATTATTTCACAGTTACTAAAGACTAAATGTGAGTGTCCC;B-15-11,AGGCCAGCTTAGAGGCCCGCTAAAGTACAAAGCAAAGAGTAA;B-15-12,GTACCGGCTTTTTACCATTCCAATAACAATCATGCCAAAGGA;B-15-14,ATCTGGTGTTGCTTTCTTTGCAAAGAGCAAACTTGGTGTGTC;B-15-15,CTTCCAGATTGATACCCATAGGCATGAGCTCCTGGCGTTGCT; B-16-1,AGGGCAAGTTTACATAAACAGAGAGTTGCGCCGGACCGACTC;B-16-2,CATGGGTATTCTTCGCGTGCGAAAATATCACCTTTCTGTGTT;B-16-4,TTTCCCAATTTCAGAACTTTAAATAAGATTCGTAACCTGCCC;B-16-5,TATATAGATTCTCTTGGGCTGAATCTGTCTATTAACCTAGAT;B-16-6,GCCATGGATTTACCGTAATTCAAATGTGTGCGACGCGAGACC;B-16-7,GCCCTATTTTTTCGTCTTTGGAAGATAGGTCGTGTGGTGCTT;B-16-9,GGTTGTATTTGGGACACTCACAACCGGTAGAGAGTGGTCCAA;B-16-10,ATTTAGTCTTTTACTCTTTGCAAACAGATCGACGTTTGATTG;B-16-11,TTTGTACTTTTCCTTTGGCATAAAAAGTTTGTTCTCGGTCTG;B-16-12,GATTGTTATTCGCGGCTGTGTAATCGGTCGCTGTTCGTTCTG;B-16-14,TTTGCTCTTTAGCAACGCCAGAAGCTGAGCGAACGTAGGCCG;B-16-15,GAGCTCATGCTTTTTTTTTTTAAGGGAGTAGTTTTTTTTTTT; B-17-1,GCGCAACTCTTTTTTTTTTTTAATGTATGAGTTTTTTTTTTT;B-17-2,GTGATATTTTGAGTCGGTCCGAAGCACGGGTAAGCACATAAT;B-17-4,GAATCTTATTTGTTTGGGCTTAAGGCTTCCTCGGCTTGTTCC;B-17-5,TAGACAGATTGGGCAGGTTACAACTGCAAACGAGTGAATTTA;B-17-6,GCACACATTTATCTAGGTTAAAATGTGAGACGGCGAGTACCG;B-17-7,GACCTATCTTGGTCTCGCGTCAAATGTGATAATCCTCCCGCT;B-17-9,TCTACCGGTTCCTTTGTGTGCAACCGTGCACGCTGTCCCTTC;B-17-10,CGATCTGTTTTTGGACCACTCAACCCTCCATGAGGGTTTAGC;B-17-11,CAAACTTTTTCAATCAAACGTAAATCAATAAGCTCGCGTATG;B-17-12,GCGACCGATTCAGACCGAGAAAATAGAGTGCTCCATCTCTCT;B-17-14,CGCTCAGCTTGCTGTTGTTTCAATTGTTTAAGCGTCCGGTCC;B-17-15,CTACTCCCTTCGGCCTACGTTATCTCTCTAACCTATCCCTGA; B-18-1,CTCATACATTATTATGTGCTTATTGCCGGGTCTGTTGCTCTT;B-18-2,ACCCGTGCTTGTCGTCTGCTTAAAAATCATTGGCCGCGCCCT;B-18-4,AGGAAGCCTTTAAATTCACTCAACTAACTGGAAACCACCAAC;B-18-5,GTTTGCAGTTCGGTACTCGCCAAGTCATACGAATAATGTGCG;B-18-6,GTCTCACATTAGCGGGAGGATAAAAGAGAGGCCTAATTTCCT;B-18-7,TATCACATTTTCTCCTCTCTCAAGTCACCACGTCGTTCTTTG;B-18-9,GTGCACGGTTGCTAAACCCTCAAATCACGTCTACCGATGCAT;B-18-10,ATGGAGGGTTCATACGCGAGCAAATTACCGAGACAACTTTGG;B-18-11,TTATTGATTTAGAGAGATGGAAAACGTGGGTACCATCTGCTA;B-18-12,GCACTCTATTCCTTTCGTCCTAAGCACCGCTGTTCGTCGGCT;B-18-14,TTAAACAATTTCAGGGATAGGAACTAACGTTTAACGCTAGAT;B-18-15,TTAGAGAGATTTTTTTTTTTTAACGGTCATGTTTTTTTTTTT; B-19-1,ACCCGGCAATTTTTTTTTTTTAATGAGCGGATTTTTTTTTTT;B-19-2,AATGATTTTTAAGAGCAACAGAAAGAACTATTGATTGTAAAG;B-19-4,CCAGTTAGTTTTGCTTTCTTTAAACGATAACGCTCTAGCCTT;B-19-5,CGTATGACTTGTTGGTGGTTTAAGACTTACGCTACCCTCGAT;B-19-6,CCTCTCTTTTCGCACATTATTAATAAACAGGCGGTAGTTCTT;B-19-7,GTGGTGACTTAGGAAATTAGGAAGAATAATATCTGATCCACA;B-19-9,GACGTGATTTCCTTCGCTGTCAAACCCTACTCATTCATACTC;B-19-10,TCGGTAATTTATGCATCGGTAAAGTGGAGATCGAGATTTGAA;B-19-11,ACCCACGTTTCCAAAGTTGTCAAGCGTGTAGGCTACTCTGTT;B-19-12,AGCGGTGCTTTAGCAGATGGTAAGCTTCGCGCGAGACTCCTA;B-19-14,AACGTTAGTTCTTCTGCGGCTAAAGAACGACCAGAAACGAAT;B-19-15,CATGACCGTTATCTAGCGTTATGAAGGATGTAGTGGTTTAGA; B-20-1,TCCGCTCATTCTTTACAATCACTATTTACGTGAATGTACAAT;B-20-2,ATAGTTCTTTGTTTGTGTCGTAACGTACCGCCTTTGCTTGGT;B-20-3,CGTCGTCCTTAAGGCTAGAGCGTTTCGTCTTGGTGTGGTCCT;B-20-4,GTTATCGTTTATCGAGGGTAGGGCTGTCTTCCGCTCTGTTTC;B-20-5,CGTAAGTCTTAAGAACTACCGTTCCGTCTTGGCTCGTTTCGT;B-20-6,CCTGTTTATTTGTGGATCAGAGTTCTGTTCTTTCGCGTCCTT;B-20-7,TATTATTCTTGTGCTTTTGCTCGTCTGGTGTAAGCCGCCCTC;B-20-8,CTGTTGTGTGGAGTATGAATGAACCCACCGTCTTTGCTTGCG;B-20-9,AGTAGGGTTTTTCAAATCTCGTGGTTCTTGTTTCCGGGTCTG;B-20-10,ATCTCCACTTAACAGAGTAGCGTCTCGGTCGTTGCTTTTCCG;B-20-11,CTACACGCTTTAGGAGTCTCGGGTCGTCCTCTTTGGTGGTGT;B-20-12,CGCGAAGCTTTGTGGTCCCGTGCGGGTTTGTTCTTTCTTCTT;B-20-13,TTCGTGTTGGATTCGTTTCTGCTTGTTTCTTAGCATCTTTAT;B-20-14,GTCGTTCTTTTCTAAACCACTAATCCAGGGACCTAATAAACT;B-20-15,ACATCCTTCATTTTTTTTTTTAACATGCTGGTTTTTTTTTTT; B-21-1,ACGTAAATAGTTTTTTTTTTTAATTCTATGATTTTTTTTTTT;B-21-2,GCGGTACGTTATTGTACATTCAATGCCGACTCTTTCCCATCG;B-21-8,ACGGTGGGTTGAGGGCGGCTTAACGAGCCTCCTCTGTTAGTT;B-21-14,TCCCTGGATTATAAAGATGCTAATGGGCACCAATAGGCGGGA;B-21-15,CCAGCATGTTAGTTTATTAGGCGGCACCCGGAAGCACATTCT; B-22-1,TCATAGAATTCGATGGGAAAGCCGTCTCGATGATGTACAACG;B-22-2,AGTCGGCATTTTTTGCCTCGTAAGCCAGCCAGGCAGTTTAAG;B-22-3,TCTTGTTCTGGTGGTTTCTGTAAACGAACGGTAGCTCGGGCC;B-22-4,GCCCGGGTTTCCTTCCTGGGTAAGCGCCTGCTATAAGCCGCT;B-22-5,TCTGGCCTTGCCGTCTTCTTCAAGCACTCAATCGAGTTGGTT;B-22-6,TTTCCGGGCGTCTTTCTCCGGAATATGCCTAGACATTCTACA;B-22-7,TTTCTTCGGGAACTAACAGAGAAGATAGGACCACCACTCTTT;B-22-8,GAGGCTCGTTTCTCCGTGTTGAACCTAGGTCGCAGAACCCGC;B-22-9,CTTGGTCGCGCTTGTCTTGTTAACAAAGAGGAATCAGTAATT;B-22-10,GCTTCTTGGTTTTGTCTTGTCAAGTGGATAATATGCTCTTTG;B-22-11,TGCCTTTTCCGGCGCTTCCTTAAAGGCGACTAATGTATTTAC;B-22-12,CGTTTTGCCCTGCCCTCCTTTAATGTCATTGTCCCACACGCA;B-22-13,GTGCTCTTGTTCCCGCCTATTAAACTATAAGGATGTGATGCC;B-22-14,GGTGCCCATTAGAATGTGCTTAAGACCGTTCGCTGTACCCGT;B-22-15,CCGGGTGCCGTTTTTTTTTTTAACTGCACAATTTTTTTTTTT; B-23-1,ATCGAGACGGTTTTTTTTTTTAAGAGTATACTTTTTTTTTTT;B-23-2,TGGCTGGCTTCGTTGTACATCAATGGACCGCGTCTACCTAGT;B-23-3,CCGTTCGTTTCTTAAACTGCCAATTATCTATGGTATACGCTG;B-23-4,GCAGGCGCTTGGCCCGAGCTAAACCTGACGAGACAAAGCCCG;B-23-5,TTGAGTGCTTAGCGGCTTATAAAGAGGGCGTGCCGCAGGGCC;B-23-6,TAGGCATATTAACCAACTCGAAAATACAACGTCTCCCAACCG;B-23-7,GTCCTATCTTTGTAGAATGTCAACCGGTTATGCCGCTGAGGT;B-23-8,GACCTAGGTTAAAGAGTGGTGAACCATTGTAGAATAAAGAAG;B-23-9,CCTCTTTGTTGCGGGTTCTGCAAGACACGCAAGGAAGCTATC;B-23-10,TTATCCACTTAATTACTGATTAAACGTGCGCACTAAGACCCA;B-23-11,AGTCGCCTTTCAAAGAGCATAAACATAATCCAGTGATAAATC;B-23-12,CAATGACATTGTAAATACATTAAACGCAGACAAGGGCTGTCA;B-23-13,CTTATAGTTTTGCGTGTGGGAAATTAATGACGGAGGTGCTTG;B-23-14,GAACGGTCTTGGCATCACATCAAGATACTGTTTAAACCCACG;B-23-15,TTGTGCAGTTACGGGTACAGCCTAACTTCCTAAGTAAACCTG; B-24-1,GTATACTCTTACTAGGTAGACCCGTGGTCTTGTCCGGGAAGT;B-24-2,GCGGTCCATTCAGCGTATACCAATATGCCTTTTATGGAGTTA;B-24-3,ATAGATAATTCGGGCTTTGTCAATACCTCTTTGACGGAATAG;B-24-4,TCGTCAGGTTGGCCCTGCGGCAATCCCGATTATCGCGGTTTA;B-24-5,ACGCCCTCTTCGGTTGGGAGAAATGGCTATTTGCACAATCTG;B-24-6,CGTTGTATTTACCTCAGCGGCAAGTTGAGTTGGTCCAGGGCC;B-24-7,ATAACCGGTTCTTCTTTATTCAAGGTATATTTTCCTGTTTAT;B-24-8,TACAATGGTTGATAGCTTCCTAAACTAAGTTTGAGGAAGGGC;B-24-9,TGCGTGTCTTTGGGTCTTAGTAAACGCCCTTGTAAGGATTTA;B-24-10,GCGCACGTTTGATTTATCACTAACGAGAGTTACTTTAACATC;B-24-11,GGATTATGTTTGACAGCCCTTAATCCAGCTTGCAAGCGCTAA;B-24-12,GTCTGCGTTTCAAGCACCTCCAAGCACCATTTGAAACTACCT;B-24-13,GTCATTAATTCGTGGGTTTAAAAGTTTGATTTCATTTGCGTC;B-24-14,ACAGTATCTTCAGGTTTACTTAAAGGGCCTTTAGTCAGCTAA;B-24-15,AGGAAGTTAGTTTTTTTTTTTAAAGAGGTACTTTTTTTTTTT。

[0070] B-25-1,AAGACCACGGTTTTTTTTTT;B-25-2,AAGGCATATTACTTCCCGGAC;B-25-3,AAGAGGTATTTAACTCCATAA;B-25-4,AATCGGATTCTATTC CGTCA;B-25-5,AATAGCCATTTAAACCGCGAT;B-25-6,AACTCAACTTCAGATTGTGCA;B-25-7,AATATACCTTGGCCCTGGACC;B-25-8,AACTTAGTTT ATAAACAGGAA;B-25-9,AAGGCGTTTGCCCTTCCTCA;B-25-10,AACTCTCGTTTTAAATCCTTAC;B-25-11,AAGCTGGATTGATGTTAAAGT;B-25-12,A ATGGTGCTTTTAGCGCTTGC;B-25-13,AATCAAACTTAGGTAGTTTCA;B-25-14,AAGGCCCTTTGACGCAAATGA;B-25-15,GTACCTCTTTTTAGCTGACTA.

[0071] This also includes the sequences to be cut (corresponding to the regions to be cut in the DNA nanostructure), with each DNA strand of the sequence to be cut numbered Pxy, where x is the row number and y is the column number: The sequence to be cut in the DNA strand in line 1 has an extended region that is complementary to the primer strand Primer_1: P1-4-3,AAAGCCACAGCGACAAGAAAGCCAACGACGAAGAGCAACCAGTTCTACTATGTGCAGA;P1-4-4,AAGAAGAACACACGAGGCAAAGAACAACAAAAGAGCAGAACATTCTACTATGTGCAGA;P1-4-5,CAGAACGGACAAACACCCGACAAAGA GGAGGAACAGGGCCGATTCTACTATGTGCAGA;P1-4-6,ACGAACGAAAGCAGAGGAGAAAGAAACAAAAGAACAAAACAATTCTACTATGTGCAGA;P1-4-7,CAGGGCAGCAAAACGGCCACGGCGCAGAGACCAAGAGCCAAATTCTACTATGTGCAGA.

[0072] The sequence to be cut in the DNA strand in line 2 has an extended region that is complementary to the Primer_2 primer strand: P2-4-9,AAGGCAACAAACCAAAGAAAGAACAAAAGACGAGCACAGGCATTCAGACAGCAAGGTA;P2-4-10,AAAGGGACGAAGAACACACGAACGCACGGACCAGGGCAACCCTTCAGACAGCAAGGTA;P2-4-11,AACAAGAAAGGGCCAACAACAGGCAA GAAGGCGAGCAACGCATTCAGACAGCAAGGTA;P2-4-12,AACAAGCCAAAAGAACCAACCAGCCCGGGCGGCAGAGAAACATTCAGACAGCAAGGTA;P2-4-13,ACAACGCAGAGCAGCAAGAAGAAAGCAAGAAAGACGAAACCATTCAGACAGCAAGGTA.

[0073] The sequence to be cut in the DNA strand in line 3 has an extended region that is complementary to the Primer_3 primer strand: P3-6-3, GGACAAAGCCGACGCAACGGAACAGAACAGAAACAAGCAACATTGACTCATCTCAGTA; P3-7-3, TCTGTTCTGTAGACGAGCAAAGTCTTCTCGTAAGAAACAACATTGACTCATCTCAGTA; P3-8-3, ACGAGAAGACGGAGACGGGAAACGCACGGACAAGAAGAAACATTGACTCATCTCAGTA; P3-9-3, GTCCGTGCGTGCATAACCTAAGTTGTTTGGTGGAGCAAAGCATTGACTCATCTCAGTA; P3-10-3, ACCAAACAACGCCAAGAGGGAAAACCCACAGGGCCACAGCCCTTGACTCATCTCAGTA; P3-11-3, CTGTGGGTTTGAGCACCGAGATGTCTCTGTGCCAACCAGCCATTGACTCATCTCAGTA; P3-12-3, CACAGAGACAGGACACGAACAAGACGACAAACAAGAAGAAGCTTGACTCATCTCAGTA; P3-13-3, TTTGTCGTCTCAATAGAACGATCTCCTCTGTAAGAAAGCAAATTGACTCATCTCAGTA; P3-14-3, ACAGAGGAGACAAGGAAGCGCCGAAACGAGAACAACAAGAAATTGACTCATCTCAGTA; P3-15-3, TCTCGTTTCGAGACGAAGCACCCTTCCTCTTCGCACGCGAAGTTGACTCATCTCAGTA, P3-16-3, AAGAGGAAGGACACCAGGCCGAAACAAAGACAAGCCCAAACATTGACTCATCTCAGTA; P3-17-3, GTCTTTGTTTAACGCAGACAGTTCTCCGCGTAAGCAGACGACTTGACTCATCTCAGTA; P3-18-3, ACGCGGAGAAGGAACAAGCCGCACAACAAACAAAGAAAGCAATTGACTCATCTCAGTA; P3-19-3, GTTTGTTGTGAGGGCGCGGCCAAGGACGACGACGACACAAACTTGACTCATCTCAGTA。

[0074] The sequence to be excised in the DNA strand of the 4th row, whose protruding region is complementary to the primer strand Primer_4: P4-6-8,GAACCACAAACAAGAAGAAACACGAACAGGAAGAGAACGACCTTTACTATTCAGAACT;P4-7-8,TCCTGTTCGTACATAGCAGCCTTGTGTTTGCCCACGACGACATTTACTATTCAGAACT;P4-8-8,GCAAACACAAAGAACAACGGAACGGAAACGCACCAGCCCAAATTTACTATTCAGAACT;P4-9-8,GCGTTTCCGTAGAACACATGACCCTTTCGTCAGGCCAAGACATTTACTATTCAGAACT;P4-10-8,GACGAAAGGGAACACAAAAGGCCAGACAAAACCCACGAAAGGTTTACTATTCAGAACT;P4-11-8,TTTTGTCTGGGAGCAGACAGCGTGCCCTTCGAGCAACAGCACTTTACTATTCAGAACT;P4-12-8,CGAAGGGCACGAAAGAAACGGACGGGAAGAACAAAACACACATTTACTATTCAGAACT;P4-13-8,TTCTTCCCGTAGCTGACCTCGTCTCGTTCTGCAACAGAAACGTTTACTATTCAGAACT;P4-14-8,CAGAACGAGAACCACGACCCAAGAAACACGACCAGAGCAAAATTTACTATTCAGAACT;P4-15-8,TCGTGTTTCTGCTACGCTACGTTCCTCTTTCCCAAAGACGAATTTACTATTCAGAACT;P4-16-8,GAAAGAGGAAAGAACGGAAGACGAAGCAAAAGCACACAAAGGTTTACTATTCAGAACT;P4-17-8,TTTTGCTTCGAAGTACCATACCTGTTGTCTTGAGAGAGGAGATTTACTATTCAGAACT;P4-18-8,AAGACAACAGGAAGGGACAGCACACAAAGGCGACAGCGAAGGTTTACTATTCAGAACT;P4-19-8,GCCTTTGTGTCAAAGAACGACCACACAACAGAGCAAAAGCACTTTACTATTCAGAACT。

[0075] The sequence to be cut in the DNA strand at the 5th row, whose protruding region is complementary and paired with the primer strand Primer_5: P5-6-13,AACGGGACAAGAGCGAAGAACAACAAAGAACCCAAACAAACATTGTATGAACGTCTAC;P5-7-13,GTTCTTTGTTGCTAAGCAACGCCTCCTTCCTCCAAACGCGCATTGTATGAACGTCTAC;P5-8-13,AGGAAGGAGGAAGAAGAAAGCCCAAAACCGAGCAGCGCAGAATTGTATGAACGTCTAC;P5-9-13,TCGGTTTTGGCCTAAAGCAACTTCTGCGTCGCAAGAACAACCTTGTATGAACGTCTAC;P5-10-13,CGACGCAGAAGACAACCAAACAAGAGGCCAAACAACAGAGCATTGTATGAACGTCTAC;P5-11-13,TTGGCCTCTTAATAACAATCCTTTTCGGGTTAGCGAGACAAATTGTATGAACGTCTAC;P5-12-13,AACCCGAAAAGAAACAAACAGAAGAGGCCCAAAAGCAACCACTTGTATGAACGTCTAC;P5-13-13,TGGGCCTCTTCAACCGAATAAGGTTTTGTTTAGCAAAGACCGTTGTATGAACGTCTAC;P5-14-13,AAACAAAACCACCAAACCAAGCGCGAGCCAGGCAAAGAAAGCTTGTATGAACGTCTAC;P5-15-13,CTGGCTCGCGACATGACACGAGTTCTCGGTCACACAGCCGCGTTGTATGAACGTCTAC;P5-16-13,GACCGAGAACGACACACCAAGAACGGAGAACGAAACAACAGCTTGTATGAACGTCTAC;P5-17-13,GTTCTCCGTTCATAACGAGCACGTTCTTGTTAGGACGAAAGGTTGTATGAACGTCTAC;P5-18-13,AACAAGAACGGGACCGGACGCGAGCACCAAAAGCCGCAGAAGTTGTATGAACGTCTAC;P5-19-13,TTTGGTGCTCAGCCGACGAACCCAACACGAAACGGGACCACATTGTATGAACGTCTAC。

[0076] The sequence to be cut in the DNA strand in line 6 has an extended region that is complementary to the Primer_6 primer strand: P6-21-3,AAGACGAAACACCAGCAAAGCAGAACAAGAACGAGGCAAAATTAGACAGCAATCGAG;P6-21-4,GAAGACAGCCAGGACCACACCAAACCCGGGCACAGAAACCACTTAGACAGCAATCGAG;P6-21-5,CAAGACGGAAGAAACAGAGCGCAAG GCCAGAACCCAGGAAGGTTAGACAGCAATCGAG;P6-21-6,AGAACAGAACACGAAACGAGCCGCCCGGAAAGAAGAAGACGGTTAGACAGCAATCGAG;P6-21-7,ACACCAGACGAAGGACGCGAACCCGAAGAAACCGGAGAAAGATTAGACAGCAATCGAG.

[0077] The sequence to be cut in the DNA strand in line 7 has an extended region that is complementary to the Primer_7 primer strand: P7-21-9,ACAAGAACCACGCAAGCAAAGCGCGACCAAGCAACACGGAGATTAAGCATAACACCTA;P7-21-10,CGACCGAGACCAGACCCGGAAACCAAGAAGCAACAAGACAAGTTAAGCATAACACCTA;P7-21-11,GAGGACGACCCGGAAAAGCAAGGAA AAGGCAGACAAGACAAATTAAGCATAACACCTA;P7-21-12,ACAAACCCGCACACCACCAAAGGGCAAAACGAAGGAAGCGCCTTAAGCATAACACCTA;P7-21-13,AAGAAACAAGAAGAAGAAAGAACAAGAGCACAAAGGAGGGCATTAAGCATAACACCTA.

[0078] This also includes 7 primer chains: Primer_1,TCTGCACATAGTAG;Primer_2,TACCTTGCTGTCTG;Primer_3,TACTGAGATGAGTC;Primer_4,AGTTCTGAATAGTA;Primer_5,GTAGACGTTCATAC;Primer_6,CTCGATTGCTGTCT;Primer_7,TAGGTGTTATGCTT.

[0079] The optical density (OD) value of the solution was measured using a micro-spectrophotometer. First, the sample stage was cleaned with anhydrous ethanol, and 2 μL of deionized water was added as a blank control. The OD value of each DNA sequence was measured at 260 nm, and the concentration of each DNA single strand was calculated based on the oligonucleotide molecular weight.

[0080] All component strands were mixed at equimolar concentrations (110 nM). The sample environment was 0.5× TE buffer (5 mM Tris-HCl, pH 8.0, 1 mM EDTA), and MgCl2 was added to a final concentration of 15 mM to promote stable hybridization and structural folding between DNA strands.

[0081] The above mixture was subjected to programmed annealing in a polymerase chain reaction (PCR) amplification instrument, using a multi-stage thermal cycling annealing program, as shown in Table 1 below, so that each single strand could spontaneously assemble into the target SST nanostructure through base complementary pairing.

[0082] Table 1

[0083] After annealing, specific primers were added to the system, with a total molar amount 1.5 times the number of corresponding binding sites on the substrate. This ensured that the 3′ overhang region of the strand to be cut was fully bound to the primers, providing an initiation point for the subsequent polymerase-driven cutting reaction. After the primers were added, the sample was annealed again slowly: the temperature was uniformly reduced from 35°C to 24°C over approximately 2 hours to promote specific hybridization between the primers and the template, while avoiding non-specific binding or structural disturbance.

[0084] To test the structural stability of the molecular substrate under high-concentration polymerase environment, Klenow polymerase with a final concentration of 64 kU / L and excess dCTP, dGTP and dTTP (corresponding to the specific reaction buffer in the DNA paper-cutting system of this application embodiment) were added to the solution and incubated at 37°C for 6 hours.

[0085] To verify the structural integrity and morphological characteristics of the prepared DNA molecular substrate, atomic force microscopy (AFM) was used for imaging characterization.

[0086] The molecular substrate sample was diluted with 0.5× TE buffer (5 mM Tris-HCl, pH 8.0, 1 mM EDTA) containing 15 mM MgCl2 to a final concentration of approximately 1 nM to obtain a suitable monodisperse sample concentration for AFM imaging, avoiding structural aggregation or overlap that could affect morphology interpretation.

[0087] Take 5 µL of the above diluted solution and add it dropwise to the surface of a freshly peeled mica sheet. Incubate for 5 minutes to allow the DNA nanostructure to pass through the Mg2+. 2+ The mediated electrostatic interaction firmly adsorbed onto the mica substrate. Subsequently, 15 µL of 0.5× TE buffer containing 15 mM MgCl2 was gently added to the imaging region to create a liquid-phase imaging environment, which maintains the native conformation of the DNA structure and reduces non-specific interactions between the probe and the sample.

[0088] Through the above characterization process, the rectangular outline and shape of the SST base plate can be clearly observed, such as... Figure 7 As shown, Figure 7 A morphological characterization image of a DNA nanostructure is shown, obtained using an atomic force microscope (AFM). The AFM characterization results indicate that after treatment with high-concentration DNA polymerase, most of the SST nanostructures retain their intact rectangular morphology, confirming that the designed blocking sequence effectively mitigates the non-specific extension and degradation of non-target regions by the polymerase, significantly improving the structural stability of the molecular substrate under harsh enzymatic reaction conditions. This result fully demonstrates that the DNA cutting system provided in this application can serve as a highly robust platform for achieving precise and controllable DNA cutting operations, providing a reliable technical foundation for nanoscale patterning and functionalization.

[0089] The third aspect of this application also proposes a DNA nanopatterning device, which is prepared according to the DNA paper-cutting method described in the second aspect of this application.

[0090] The DNA nanopatterned device has a preset pattern on its surface formed by the strand displacement reaction at the micrometer or nanometer scale, which is used for information encoding, biosensing, or as a substrate for molecular computing elements.

[0091] A fourth aspect of this application also provides a DNA paper-cutting kit, comprising: Components for assembling the DNA cutting system described in the second aspect of this application. The components may include: premixed single-stranded DNA (for assembling a specific molecular substrate), lyophilized or liquid specific reaction buffer, primer strands, DNA polymerase, etc.

[0092] In some embodiments, the kit specifically includes: DNA nanostructures include cleaved and uncleaved regions; wherein, on the template strand of the uncleaved region, a blocking sequence is provided at the 5' end of the template strand segment corresponding to at least one nick site, the blocking sequence consisting of one or more bases belonging to the target base type; Specific reaction buffer, containing DNA polymerase and multiple deoxyribonucleoside triphosphates except for one specific deoxyribonucleoside triphosphate; The specific deoxyribonucleoside triphosphate missing in the specific reaction buffer is complementary to the target base type.

[0093] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0094] Finally, it should be noted that in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0095] The foregoing provides a detailed description of a DNA paper-cutting system, method, and product for resisting polymerase chain displacement. Specific examples have been used to illustrate the principles and implementation methods of this application. The descriptions of the above embodiments are only for the purpose of helping to understand the method and core ideas of this application. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this application. Therefore, the content of this specification should not be construed as a limitation of this application.

[0096] Other embodiments of this application will readily occur to those skilled in the art upon consideration of the specification and practice of the invention disclosed herein. This application is intended to cover any variations, uses, or adaptations of this application that follow the general principles of this application and include common knowledge or customary techniques in the art not disclosed herein. The specification and examples are to be considered exemplary only, and the true scope and spirit of this application are indicated by the following claims.

[0097] It should be understood that this application is not limited to the precise structure described above and shown in the accompanying drawings, and various modifications and changes can be made without departing from its scope. The scope of this application is limited only by the appended claims.

[0098] The terms "an embodiment," "embodiment," or "one or more embodiments" as used herein mean that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least one embodiment of this application. Furthermore, please note that the examples of the phrase "in one embodiment" do not necessarily all refer to the same embodiment.

[0099] Numerous specific details are set forth in the specification provided herein. However, it will be understood that embodiments of this application may be practiced without these specific details. In some instances, well-known methods, structures, and techniques have not been shown in detail so as not to obscure the understanding of this specification.

[0100] In the claims, any reference signs placed between parentheses should not be construed as limiting the claims. The word "comprising" does not exclude the presence of elements or steps not listed in the claims. The word "a" or "an" preceding an element does not exclude the presence of a plurality of such elements. This application can be implemented by means of hardware comprising several different elements and by means of a suitably programmed computer. In a unit claim enumerating several means, several of these means may be embodied by the same item of hardware. The use of the words first, second, and third, etc., does not indicate any order. These words can be interpreted as names.

[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of this application.

Claims

1. A DNA paper-cutting system for resisting polymerase chain displacement, characterized in that, include: DNA nanostructures include cleaved and uncleaved regions; wherein, on the template strand of the uncleaved region, a blocking sequence is provided at the 5' end of the template strand segment corresponding to at least one nick site, the blocking sequence consisting of one or more bases belonging to the target base type; Specific reaction buffer, containing DNA polymerase and multiple deoxyribonucleoside triphosphates except for one specific deoxyribonucleoside triphosphate; The specific deoxyribonucleoside triphosphate missing in the specific reaction buffer is complementary to the target base type.

2. The DNA paper-cutting system according to claim 1, characterized in that, The base composition of the template chain in the cut region does not include bases belonging to the target base type.

3. The DNA paper-cutting system according to claim 1, characterized in that, The target base type is thymine T; The specific deoxyribonucleoside triphosphate is deoxyadenosine triphosphate dATP; The specific reaction buffer contains three deoxyribonucleoside triphosphates: deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP).

4. The DNA paper-cutting system according to claim 1, characterized in that, The blocking sequence consists of an arrangement of two bases belonging to the target base type.

5. The DNA paper-cutting system according to claim 1, characterized in that, The DNA nanostructure is a single-stranded molecular structure.

6. The DNA paper-cutting system according to claim 5, characterized in that, The single-stranded molecular structure is a rectangular grid structure, which is assembled from M rows × N columns of DNA single strands, where M and N are both integers greater than or equal to 2.

7. The DNA paper-cutting system according to claim 1, characterized in that, The system also includes: At least one primer chain; The cut region includes a component chain with a preset primer binding site, the primer chain being configured to be complementary to the preset primer binding site.

8. A DNA paper-cutting method, characterized in that, The method, applied to the DNA paper-cutting system according to any one of claims 1-7, comprises: Provide the DNA paper-cutting system; Incubate in the reaction environment provided by the specific reaction buffer; DNA polymerase is activated in the cut region and completes the strand displacement reaction to remove the cut region, thereby forming a target pattern on the DNA nanostructure.

9. A DNA nanopatterning device, characterized in that, It is prepared by the DNA paper-cutting method according to claim 8.

10. A DNA paper-cutting kit, characterized in that, include: Components for assembling the DNA paper-cutting system according to any one of claims 1 to 7.

Images