Aspergillus tubigensis, methods for producing enzymes thereof, and uses thereof

By screening and optimizing Aspergillus tabineus HNZY02, an efficient fermentation process was established to form a multi-enzyme system, which solved the problem of environmental degradation of cellulose, hemicellulose and lignin in tobacco stems, and improved the utilization value of tobacco stems and the safety of cigarettes.

CN121592504BActive Publication Date: 2026-06-12CHINA TOBACCO HUNAN IND CORP

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA TOBACCO HUNAN IND CORP
Filing Date
2026-01-16
Publication Date
2026-06-12

Smart Images

  • Figure CN121592504B_ABST
    Figure CN121592504B_ABST
Patent Text Reader

Abstract

The application provides a kind of aspergillus tubingensis and its enzyme production method and application, belong to the field of microbial technology, the aspergillus tubingensis (Aspergillus tubingensis) HNZY02, preserved in China General Microbiological Culture Collection Center, and the preservation number is CGMCC No.42148.AspERGILLUS TUBINGENSIS HNZY02 shows excellent cellulase and xylanase synthesis capacity, can synergistically degrade cellulose, hemicellulose and lignin and other main structural components in tobacco stem, while breaking its dense structure and improving the reducing sugar content, the safety and application value of cigarette are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a method and application of Aspergillus tabineum and its enzyme production. Background Technology

[0002] Tobacco stems, as a biomass resource rich in cell wall components such as cellulose, offer significant economic benefits and positive ecological implications through efficient conversion and utilization, contributing to waste resource recovery and reducing environmental pollution. Currently, the main method of utilizing tobacco stems is to process them into shredded stems and re-integrate them into cigarettes to reduce production costs and minimize the release of some harmful substances. However, the combustion of tobacco stem cell wall components easily produces aldehydes, phenols, and carcinogenic polycyclic aromatic hydrocarbons, leading to a decline in smoke quality. Therefore, improving the combustion characteristics of tobacco stems by degrading components such as cellulose has become an important technological direction for overcoming its application bottlenecks. Compared to highly polluting chemical treatment methods, environmentally friendly and efficient enzymatic hydrolysis is considered an ideal alternative. However, research on this technology in the field of tobacco stem processing remains relatively weak, and there is an urgent need to screen and explore specialized enzyme resources suitable for the characteristics of tobacco stem components to provide technical support for its industrial value-added utilization. Summary of the Invention

[0003] In view of the above, in order to at least partially solve at least one of the aforementioned technical problems, the present invention provides Aspergillus tubingensis HNZY02, which is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 42148.

[0004] According to another embodiment of the present invention, an application of Aspergillus tabineus is provided, comprising at least one of the following: (1) producing carboxymethyl cellulase; (2) producing β-glucosidase; (3) producing xylanase; (4) producing filter paper enzyme system.

[0005] According to another embodiment of the present invention, an application of Aspergillus tabineus is provided, comprising at least one of the following: (1) degrading cellulose; (2) degrading lignin; (3) degrading hemicellulose; (4) degrading cellulose, hemicellulose and / or lignin in tobacco stems; (5) increasing the reducing sugar content in tobacco stems; (6) reducing the nicotine, tar and carbon monoxide content during cigarette combustion; and (7) improving the safety of cigarette smoking.

[0006] According to another embodiment of the present invention, a method for producing an enzyme is provided, comprising the steps of inoculating Aspergillus tubingensis HNZY02 into a culture medium for cultivation and then collecting the enzyme product; the enzyme produced comprises at least one of carboxymethyl cellulase, β-glucosidase or xylanase.

[0007] According to another embodiment of the present invention, a method for degrading cellulose in tobacco stems is provided, comprising the step of inoculating Aspergillus tubingensis HNZY02 into the tobacco stems and culturing it.

[0008] According to another embodiment of the present invention, a composition is provided containing Aspergillus tubingensis HNZY02.

[0009] According to another embodiment of the present invention, a culture comprising Aspergillus tubingensis HNZY02 and a culture medium comprising K2HPO4, peptone, Tween-40, KNO3, MgSO4, CaCl2 and NaCl is provided.

[0010] According to the embodiments of the present invention, a high-yield cellulase and xylanase-producing Aspergillus tabineus strain HNZY02 was successfully screened. Through systematic optimization of the culture medium composition and culture conditions, the cellulase and xylanase activities of the strain were increased by 1.6 times and 1.2 times, respectively, compared with the original values, and an efficient and stable fermentation process system was established. In tobacco stem degradation applications, this strain and its enzyme preparation exhibited excellent synergistic degradation effects, efficiently decomposing structural components such as cellulose, hemicellulose, and lignin, while simultaneously increasing the reducing sugar content. This provides a reliable biotechnological pathway for the efficient conversion and resource utilization of tobacco stems, and has good prospects for industrial application. Attached Figure Description

[0011] The above and other objects, features and advantages of the present invention will become more apparent from the following description of embodiments of the invention with reference to the accompanying drawings, in which:

[0012] Figure 1 This is a standard glucose curve diagram showing the glucose requirement for determining cellulase activity in an embodiment of the present invention.

[0013] Figure 2 This is a xylose standard curve diagram showing the xylose standard curve required to determine the xylanase activity in an embodiment of the present invention;

[0014] Figure 3 This is an electrophoresis diagram of the PCR product of strain HNZY02 in an embodiment of the present invention;

[0015] Figure 4 This is a phylogenetic tree diagram of strain HNZY02 from an embodiment of the present invention;

[0016] Figure 5 This is a graph showing the effect of corn husk mesh number on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0017] Figure 6 This is a graph showing the effect of corn husk concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0018] Figure 7 This is a graph showing the effect of nitrogen source type on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0019] Figure 8 This is a graph showing the effect of peptone concentration on cellulase activity in Aspergillus tabineus HNZY02 according to an embodiment of the present invention;

[0020] Figure 9 This is a graph showing the effect of surfactant type on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention;

[0021] Figure 10 This is a graph showing the effect of Tween-40 concentration on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0022] Figure 11 This is a graph showing the effect of K2HPO4 concentration on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0023] Figure 12 This is a graph showing the effect of MgSO4 concentration on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0024] Figure 13 This is a graph showing the effect of CaCl2 concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0025] Figure 14 This is a graph showing the effect of NaCl concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0026] Figure 15 This is a graph showing the effect of the initial pH of the culture medium on the cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0027] Figure 16 This is a graph showing the effect of inoculum size on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0028] Figure 17 This is a graph showing the effect of liquid volume on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0029] Figure 18 This is a graph showing the effect of rotational speed on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention;

[0030] Figure 19 This is a graph showing the effect of temperature on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention;

[0031] Figure 20 This is a graph showing the effect of culture time on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention;

[0032] Figure 21 This is a graph showing the effect of carbon source type on xylanase activity produced by Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0033] Figure 22 This is a graph showing the effect of corn husk particle size on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0034] Figure 23 This is a graph showing the effect of nitrogen source type on xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0035] Figure 24 This is a graph showing the effect of maize husk concentration on xylanase activity produced by Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0036] Figure 25 This is a graph showing the effect of tryptone concentration on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0037] Figure 26 This is a graph showing the effect of inoculum size on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0038] Figure 27 This is a graph showing the effect of liquid volume on the xylanase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention;

[0039] Figure 28 This is a graph showing the effect of the initial pH of the culture medium on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0040] Figure 29 This is a graph showing the effect of surfactant type on xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0041] Figure 30 This is a graph showing the effect of fermentation time on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0042] Figure 31 This is a graph showing the effect of Tween-20 concentration on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0043] Figure 32 This is a graph showing the effect of temperature on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0044] Figure 33 This is a graph showing the effect of rotation speed on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention;

[0045] Figure 34 This is a Pareto chart of the standardized effects of the PB experiment according to an embodiment of the present invention.

[0046] Figure 35A , Figure 35B , Figure 35C The images show three-dimensional response surface plots illustrating the effects of the interactions between temperature and nitrogen source concentration, temperature and surfactant concentration, and nitrogen source concentration and surfactant concentration on the xylanase activity of Aspergillus tabineus HNZY02, as described in the embodiments of the present invention.

[0047] Figure 36 This is a graph showing the optimal pH results for xylanase produced by Aspergillus tabingus as determined in an embodiment of the present invention;

[0048] Figure 37 The figure shows the pH stability results of xylanase produced by Aspergillus tabineus as determined in an embodiment of the present invention.

[0049] Figure 38 The optimal temperature for xylanase produced by Aspergillus tabingus, as determined in the implementation of this invention, is shown in the figure.

[0050] Figure 39 The figure shows the temperature stability results of xylanase produced by Aspergillus tabingus as measured in an embodiment of the present invention. Detailed Implementation

[0051] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the invention. In the following detailed description, numerous specific details are set forth to provide a thorough understanding of the embodiments of the invention for ease of explanation. However, it will be apparent that one or more embodiments may be practiced without these specific details. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0052] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "comprising" as used herein indicates the presence of features, steps, or operations, but does not exclude the presence or addition of one or more other features.

[0053] When using expressions such as "at least one of A, B and C", they should generally be interpreted in accordance with the meaning that is commonly understood by those skilled in the art (e.g., "a system having at least one of A, B and C" should include, but is not limited to, a system having A alone, a system having B alone, a system having C alone, a system having A and B, a system having A and C, a system having B and C, and / or a system having A, B and C, etc.).

[0054] In realizing the concept of this invention, it was discovered that, to achieve efficient degradation and high-value utilization of tobacco stems, enzymatic hydrolysis is gradually replacing highly polluting traditional chemical methods due to its environmental friendliness and high specificity. However, existing enzymatic hydrolysis research mainly focuses on tobacco leaves, lacking systematic exploration of the more structurally complex tobacco stems, and failing to fully assess their specific enzyme system requirements. Therefore, screening dedicated enzyme resources capable of efficiently degrading tobacco stem fiber components has become a key challenge in this field. Based on this, this invention aims to screen a strain capable of simultaneously producing novel cellulase and xylanase, and to conduct a preliminary analysis of the application effects of its produced enzymes in tobacco stem degradation, with the goal of providing important enzyme resources for the enzymatic hydrolysis application of tobacco stems.

[0055] Specifically, according to one embodiment of the present invention, Aspergillus tubingensis HNZY02 is provided.

[0056] Preservation Instructions

[0057] Strain name: Aspergillus tubingensis;

[0058] Strain number: HNZY02;

[0059] Preservation period: July 30, 2025;

[0060] Preservation Center: China General Microbiological Culture Collection Center (CGMCC);

[0061] Address: No. 1, Beichen West Road, Chaoyang District, Beijing;

[0062] Registered with the China National Collection Center (CGMCC) No. 42148.

[0063] According to the embodiments of the present invention, a high-yield cellulase and xylanase-producing Aspergillus tabineus strain HNZY02 was successfully screened. Through systematic optimization of the culture medium composition and culture conditions, the cellulase and xylanase activities of the strain were increased by 1.6 times and 1.2 times, respectively, compared with the original values, and an efficient and stable fermentation process system was established. In tobacco stem degradation applications, this strain and its enzyme preparation exhibited excellent synergistic degradation effects, efficiently decomposing structural components such as cellulose, hemicellulose, and lignin, while simultaneously increasing the reducing sugar content. This provides a reliable biotechnological pathway for the efficient conversion and resource utilization of tobacco stems, and has good prospects for industrial application.

[0064] According to another embodiment of the present invention, an application of Aspergillus tabineus is provided, comprising at least one of the following: (1) producing carboxymethyl cellulase; (2) producing β-glucosidase; (3) producing xylanase; (4) producing filter paper enzyme system.

[0065] According to an embodiment of the present invention, *Aspergillus tabineum* HNZY02 can simultaneously and efficiently produce multiple key enzymes, including carboxymethyl cellulase, β-glucosidase, xylanase, and filter paper enzyme system. Using this single strain, a complete enzyme system required for the degradation of lignocellulose can be obtained, which not only reduces the preparation cost of complex enzyme preparations but also ensures the natural compatibility and synergistic efficiency among the enzyme components. This provides a core enzyme resource for developing efficient and stable tobacco stem biodegradation processes, demonstrating its potential for industrial application.

[0066] According to another embodiment of the present invention, an application of Aspergillus tabineus is provided, comprising at least one of the following: (1) degrading cellulose; (2) degrading lignin; (3) degrading hemicellulose; (4) degrading cellulose, hemicellulose and / or lignin in tobacco stems; (5) increasing the reducing sugar content in tobacco stems; (6) reducing the nicotine, tar and carbon monoxide content during cigarette combustion; and (7) improving the safety of cigarette smoking.

[0067] According to an embodiment of the present invention, *Aspergillus tabineum* HNZY02 effectively disrupts the dense cell wall structure of tobacco stems by degrading cellulose, hemicellulose, and lignin, creating favorable conditions for subsequent processing. Based on its highly efficient enzymatic hydrolysis of lignocellulose, this strain can increase the reducing sugar content in tobacco stems, thereby effectively improving the quality and usability of the stems. During the tobacco stem degradation process, through its specific degradation action, it can reduce the content of harmful substances such as nicotine, tar, and carbon monoxide produced during the combustion of the final cigarette product. The combined effect of these multiple actions ultimately improves the safety of cigarette consumption, possessing significant health benefits and market application value.

[0068] According to another embodiment of the present invention, a method for producing an enzyme is provided, comprising the steps of inoculating Aspergillus tabineum HNZY02 into a culture medium for cultivation and then collecting the enzyme product; the enzyme produced comprises at least one of carboxymethyl cellulase, β-glucosidase or xylanase.

[0069] According to an embodiment of the present invention, the specific steps for producing the enzyme are as follows: A spore suspension is inoculated into a culture medium and cultured on a constant-temperature shaker. After the culture is completed, the fermentation broth is centrifuged, and the supernatant is collected to obtain the enzyme product.

[0070] According to an embodiment of the present invention, the culture medium satisfies at least one of the following conditions: (1) the initial pH of the culture medium is 4 to 6; (2) the culture medium contains 4 to 11 g / L of surfactant; (3) the culture medium contains surfactant, the surfactant including at least one of glycerol or Tween-40; (4) the culture medium contains 1 to 15 g / L of peptone.

[0071] According to embodiments of the present invention, the initial pH of the culture medium can be 4, 5, or 6, but is not limited to the values ​​listed. Preferably, the pH is 5.45 when promoting cellulase production and 6 when promoting xylanase production.

[0072] According to an embodiment of the present invention, the surfactant may be selected from one of Tween-20, Tween-40, Tween-60, Tween-80, Triton-100, Triton-114 or glycerol.

[0073] According to embodiments of the present invention, the concentration of the surfactant can be 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, or 11 g / L, but is not limited to the values ​​listed. Preferably, when promoting cellulase production, the concentration of Tween-40 is 10.4 g / L.

[0074] According to embodiments of the present invention, the concentration of peptone in the culture medium can be 1 g / L, 2 g / L, 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, or 15 g / L, but is not limited to the listed values. Preferably, 12.1 g / L of peptone is used to promote cellulase production, and 13.7 g / L of trypsin is used to promote xylanase production.

[0075] According to an embodiment of the present invention, the enzyme-producing culture medium of Aspergillus tabineum HNZY02 further comprises at least two components selected from the group consisting of: 5-7 g / L K2HPO4; 1-3 g / L MgSO4; 0.4-0.6 g / L CaCl2; 1-3 g / L NaCl; 0.5-0.7 g / L KH2PO4; and 0.2-0.4 g / L FeSO4.

[0076] According to an embodiment of the present invention, the method for producing enzymes shall meet at least one of the following conditions: (1) the culture time is 3 to 5 days; (2) the culture temperature is 30°C to 35°C.

[0077] According to embodiments of the present invention, the cultivation time can be 3 days, 4 days, or 5 days, but is not limited to the values ​​mentioned above. Preferably, the fermentation time for Aspergillus tabineum HNZY02 to promote cellulase production is 80.5 hours.

[0078] According to embodiments of the present invention, the culture temperature can be 30°C, 31°C, 32°C, 33°C, 34°C, or 35°C, but is not limited to these values. Preferably, the culture temperature for Aspergillus tabineum HNZY02 to promote cellulase production is 31.5°C.

[0079] According to an embodiment of the present invention, the conditions for cellulase production by Aspergillus tabineum HNZY02 also include the following parameters: inoculum size of 4-6%, such as 4%, 5%, 6%, etc.; liquid volume of 25-50 mL / 250 mL, such as 25 mL / 250 mL, 37.5 mL / 250 mL, 50 mL / 250 mL, etc.; and shaking speed of 180-200 r / min, such as 180 r / min, 190 r / min, 200 r / min, etc.

[0080] According to an embodiment of the present invention, the conditions for xylanase production by Aspergillus tabineis HNZY02 further include the following parameters: inoculum size of 1×10⁻⁶. 6 ~1×10 8 For example, 1×10 6 1×10 7 1×10 8 Etc., preferably 1×10 7 The liquid volume is 15~30mL, such as 15mL, 20mL, 25mL, 30mL, etc., preferably 15mL; the rotation speed is 130~150rpm, such as 130rpm, 140rpm, 150rpm, etc., preferably 140rpm.

[0081] According to another embodiment of the present invention, a method for degrading cellulose in tobacco stems includes the step of inoculating Aspergillus tabineum HNZY02 into tobacco stems for cultivation; specifically, the degradation method includes in vitro enzymatic hydrolysis of tobacco stems and fermentation degradation of tobacco stems.

[0082] According to an embodiment of the present invention, the specific operational steps for enzymatic hydrolysis of tobacco stems by Aspergillus tabineus HNZY02 are as follows: Accurately weigh the pretreated tobacco stem sample into an Erlenmeyer flask, add the corresponding enzyme solution according to the enzyme activity assay results, and add an appropriate amount of buffer solution to the set material-to-liquid ratio. Place all samples in a constant temperature water bath shaker and carry out the enzymatic hydrolysis reaction at a suitable temperature and shaking speed.

[0083] In one specific embodiment, the cellulase and xylanase produced by *Aspergillus tabingensis* HNZY02 showed a significant effect on the degradation of tobacco stems through synergistic action. When the two enzymes were used in equal proportions for synergistic hydrolysis, the degradation rates of cellulose, hemicellulose, and lignin reached 57.7%, 51.9%, and 50.8%, respectively. The overall degradation effect was significantly better than any single enzyme-based treatment, demonstrating the high efficiency of dual-enzyme synergy in tobacco stem degradation.

[0084] According to an embodiment of the present invention, the specific operation steps of Aspergillus tabineensis HNZY02 fermentation and degradation of tobacco stems are as follows: the only carbon source in the optimized culture medium is replaced with tobacco stem filaments, Aspergillus tabineensis strain HNZY02 is inoculated, and simultaneous fermentation and enzyme production and degradation reaction are carried out under suitable conditions, and the mixture is cultured at a constant temperature for several days.

[0085] In one specific embodiment, when tobacco stems were used as the sole carbon source, the enzyme activity of Aspergillus tabineum HNZY02 was somewhat inhibited (xylanase activity 37.8 U / mL, cellulase activity 81.7 U / mL), but it still showed a high efficiency in degrading tobacco stem components, with degradation rates of cellulose, hemicellulose and lignin reaching 78.6%, 68.8% and 54.1% respectively, demonstrating a significant degradation effect.

[0086] According to another aspect of the present invention, a composition is provided containing Aspergillus tabineum HNZY02.

[0087] According to embodiments of the present invention, the active ingredient of the composition may be Aspergillus tabineum HNZY02 and / or metabolites of Aspergillus tabineum HNZY02 and / or cultures of Aspergillus tabineum HNZY02.

[0088] According to embodiments of the present invention, the composition is a microbial agent. Its dosage forms include liquid formulations such as liquids, emulsions, and suspensions, as well as solid formulations such as powders, granules, wettable powders, and water-dispersible granules. The final product form of the composition includes solid compositions, liquid compositions, or compound bio-fertilizers. Furthermore, in addition to the effective microorganisms, its composition may also contain suitable carriers and other adjuvants.

[0089] According to another embodiment of the present invention, a culture comprising Aspergillus tabineum HNZY02 and a culture medium comprising K2HPO4, peptone, Tween-40, KNO3, MgSO4, CaCl2 and NaCl is provided.

[0090] According to an embodiment of the present invention, the culture comprises *Aspergillus tabineum* HNZY02 and a fermentation medium. The medium for promoting cellulase production has the following composition: 6 g / L K₂HPO₄, 12.1 g / L peptone, 10.4 g / L Tween 40, 2 g / L MgSO₄, 0.5 g / L CaCl₂, and 2 g / L NaCl; the medium for promoting xylanase production has the following composition: 0.6 g / L KH₂PO₄, 13.7 g / L trypone, 0.75 g / L Tween 20, 0.3 g / L MgSO₄, 0.3 g / L CaCl₂, and 0.3 g / L FeSO₄.

[0091] In summary, this invention successfully screened and obtained a strain of *Aspergillus tabineum* HNZY02, which can efficiently synthesize multiple key enzymes, including carboxymethyl cellulase, β-glucosidase, xylanase, and filter paper enzymes, forming a complete lignocellulose-degrading enzyme system. Through systematic optimization of key components and culture parameters of the fermentation medium, a highly efficient enzyme production process system for this strain was established, enhancing its cellulase activity. Further application of the produced enzyme preparation or strain directly to tobacco stem degradation showed that it can synergistically and efficiently hydrolyze cellulose, hemicellulose, and some lignin in tobacco stems. This synergistic degradation effect is superior to single enzyme treatment, not only achieving deep conversion of tobacco stem components and effective enrichment of reducing sugars, but also reducing the release of harmful substances during cigarette combustion, effectively improving the safety of cigarette smoking. This invention provides a reliable technical approach for the high-value utilization of tobacco stem resources, demonstrating broad application prospects.

[0092] The present invention will be further explained below through specific embodiments. Unless otherwise specified, all reagents used are commercially available and all experimental methods used are conventional experimental methods in the art. In the following experiments, each experimental group has three parallel replicates, and the experimental results are expressed as mean ± standard deviation (x ± s). In the attached figures, a, b, c, d, and e are statistical significance markers.

[0093] The materials used in the following embodiments are as follows:

[0094] Daqu: Originated from Songhe Winery in Henan Province;

[0095] Tobacco stem shreds: sourced from Hunan Tobacco Industry Co., Ltd., and prepared as follows: using tobacco stems produced in Longshan, Hunan in 2024 as raw materials, processed according to the requirements of the "Hunan Tobacco Stem Shred Process Specification", through water washing, stem moistening, stem cutting (stem shred width 0.17mm) and drying processes;

[0096] Corn husk screening medium (1L): 20g corn husk powder, 4g NaNO3, 2g KH2PO4, 0.5g MgSO4, 0.4g CaCl2, 0.5g NaCl, 1L distilled water, natural pH;

[0097] PDA solid medium (1L): 200g potato, 20g glucose, 20g agar, 1L distilled water, natural pH;

[0098] YPD liquid medium (1L): 20g glucose, 20g tryptone, 10g yeast extract, 1L distilled water, natural pH;

[0099] Huchinson's medium (1L): 1g KH2PO4, 0.1g NaCl, 0.3g MgSO4, 2.5g NaNO3, 0.01g FeCl3, 0.1g CaCl2, 1L distilled water, pH 7.2-7.4;

[0100] Basic fermentation medium for cellulase production (1L): 20g corn husks, 4g NaNO3, 2g K2HPO4, 0.5g MgSO4, 0.4g CaCl2, 0.5g NaCl, 1L distilled water, natural pH;

[0101] Basic fermentation medium for xylanase production (1L): 30g corn cob (2040 mesh), 10g yeast extract, 0.3g CaCl2, 0.6g KH2PO4, 0.3g MgSO4·7H2O, 0.3g FeSO4, dispensed into 30 mL bottles.

[0102] All the above culture media were sterilized in an autoclave at 121°C for 20 minutes.

[0103] The measurement methods involved in the following embodiments are all conventional techniques and may be as follows:

[0104] Preparation of crude enzyme solution: Inoculate the spore suspension at a rate of 5% (v / v) into the cellulase fermentation medium and culture at 30℃ and 180 r / min on a constant temperature shaker for 3 days. After the culture is completed, centrifuge the fermentation broth at 10000 r / min for 10 min, collect the supernatant to obtain the crude enzyme solution, and store it at 4℃ for later use.

[0105] 1. Determination of carboxymethyl cellulase (CMCase) activity

[0106] Take four centrifuge tubes and add 0.15 mL of 1% sodium carboxymethyl cellulose (CMC-Na) solution to each, with one tube serving as a blank control. Add 0.05 mL of diluted crude enzyme solution to each of the remaining three sample tubes, mix well, and incubate at 50°C for 30 minutes. After the reaction, add 0.05 mL of enzyme inactivation solution to the blank tube, then add 0.2 mL of DNS reagent to all tubes, incubate in a boiling water bath for 10 minutes, and then cool. Add 1 mL of distilled water to each tube and mix well. Zero the microscope using the blank tube and measure the absorbance at 540 nm. Calculate the reducing sugar production and enzyme activity based on the glucose standard curve.

[0107] 2. Determination of β-glucosidase activity (βDGlucosidase, βGase)

[0108] Take four centrifuge tubes and add 0.15 mL of 1% salicin solution to each, with one tube serving as a blank control. Add 0.05 mL of diluted crude enzyme solution to the remaining three sample tubes, mix well, and incubate at 50°C for 30 minutes. After the reaction, add 0.05 mL of enzyme inactivation solution to the blank tube, then add 0.2 mL of DNS reagent to all tubes, incubate in a boiling water bath for 10 minutes, and cool. Add 1 mL of distilled water to each tube and mix well. Zero the microscope using the blank tube and measure the absorbance at 540 nm. Calculate the reducing sugar production and enzyme activity based on the glucose standard curve.

[0109] 3. Determination of Filter Paper Activity (FPA)

[0110] Take four centrifuge tubes and add 0.15 mL of pH 4.8 citrate buffer and a 1 cm × 0.6 cm starch-free filter paper strip to each. One tube should be used as a blank control. Preheat all centrifuge tubes in a 50°C water bath for 5 minutes. Then, add 0.05 mL of diluted crude enzyme solution to each of the three sample tubes and continue the reaction for 30 minutes. After the reaction, add 0.05 mL of inactivated enzyme solution to the blank tube, and add 0.2 mL of DNS reagent to all tubes. Heat in a boiling water bath for 10 minutes, cool, and then add 1 mL of distilled water to mix. Zero the microscope using the blank tube and measure the absorbance at 540 nm. Calculate the enzyme activity based on the glucose standard curve.

[0111] 4. Enzyme activity calculation

[0112] (1) Definition of enzyme activity unit (U / mL): In an enzyme activity assay system, the amount of cellulase required to catalyze the hydrolysis of a specific substrate and generate 1 μg of glucose within a 1 min time span is defined as 1 enzyme activity unit (U).

[0113] (2) The formula for enzyme activity conversion is as follows:

[0114] Enzyme activity = X × N × 1000 / (A × T).

[0115] In the formula, X refers to the glucose content obtained from the glucose standard curve, in milligrams (mg); N refers to the dilution factor of the enzyme solution; T refers to the enzyme reaction time, in minutes (min); and A refers to the amount of enzyme solution added, in milliliters (mL).

[0116] (3) Determination of glucose standard curve

[0117] Take nine 2mL centrifuge tubes, numbered 08. Prepare glucose solutions of different concentrations by adding distilled water and glucose standard solution to the volumes shown in Table 1. Add 0.2mL of 3,5-dinitrosalicylic acid (DNS) reagent to each tube, mix well, and heat in a boiling water bath for 10 minutes. After cooling to room temperature, add 1mL of distilled water and mix thoroughly. Zero the microscope using the solution in tube 0 as a blank, and measure the absorbance (OD value) of each tube at a wavelength of 540nm. Plot the glucose content (mg) on ​​the x-axis, and the corresponding OD value... 540 The value is the ordinate; plot the standard curve ( ). Figure 1 ).

[0118] Table 1. Preparation of Glucose Standard Solution

[0119]

[0120] Figure 1 This is a glucose standard curve diagram for determining cellulase activity in an embodiment of the present invention.

[0121] Depend on Figure 1 It can be seen that the linear regression equation of the standard curve is y = 7.7517x − 0.056, and the coefficient of determination R is... 2 =0.9935, indicating that the curve has excellent linear correlation, meets the requirements for enzyme activity determination, and can be used as a standard for quantitative analysis. In the enzyme activity determination process, the crude enzyme solution of each strain was diluted, and its OD was measured using a UV spectrophotometer. 540 The value is calculated and converted into glucose content based on the standard curve, and then the enzyme activity value is calculated.

[0122] 5. Xylanase activity assay

[0123] (1) Add 225 μL of substrate (1% beech xylan) to a centrifuge tube, preheat in a 50℃ water bath for 3 min, then add 25 μL of enzyme solution appropriately diluted with 50 mmol / L pH 6.5 sodium dihydrogen phosphate and disodium hydrogen phosphate buffer, mix thoroughly, react precisely for 10 min, then immediately add 250 μL of DNS solution, vortex to mix, stop the reaction, centrifuge, boil in water for 15 min, remove and cool in cold water, mix well, and measure OD using a UV spectrophotometer. 540 The amount of reducing sugar is calculated using a standard curve (made with xylose).

[0124] (2) Determination of xylose standard curve

[0125] During the assay, the diluted crude enzyme solutions of each strain were placed in a UV spectrophotometer, and their OD values ​​were recorded. 540 Value. Based on experimental results, using OD... 540 Plot a xylose standard curve with the xylose content (µmol / L) as the x-axis and the x-axis as the x-axis. Figure 2 This method allows for the determination of xylose content, which in turn enables the calculation of enzyme activity values ​​for each strain. This provides a reliable quantitative basis for subsequent enzyme activity analysis.

[0126] Figure 2 This is a xylose standard curve diagram for determining the xylanase activity in an embodiment of the present invention.

[0127] Depend on Figure 2 It can be seen that the regression equation of the standard curve is y = 0.7221x - 0.2871, and the variance R0 is 0.7221x - 0.2871. 2 The value is 0.9991, which indicates that the curve has a good linear relationship, meets the requirements for determination, and can be used as a standard curve for enzyme activity determination.

[0128] 6. Determination of cellulose, hemicellulose, and lignin content

[0129] (1) Acid treatment of the sample

[0130] Accurately weigh 0.30±0.01 g of dried tobacco stem sample into a stoppered test tube, add 3.00±0.01 mL of 72% (w / w) sulfuric acid solution, stir well, and incubate in a water bath at 30±3℃ for 60±5 min, stirring every 5–10 min. Then transfer the mixture to a 200 mL Erlenmeyer flask, add 84.00±0.04 mL of deionized water to dilute the sulfuric acid to 4% (w / w), seal, and autoclave at 121℃ for 1 h. After cooling, filter, collect the hydrolysate, and store at 4℃ for later use.

[0131] (2) Determination of cellulose and hemicellulose content

[0132] Take 10 mL of hydrolysate, adjust to neutral with calcium carbonate, allow to stand and precipitate, then take 1 mL of the supernatant, centrifuge at 10000 rpm for 5 min, filter through a 0.22 μm filter membrane, and determine the glucose and xylose contents using high-performance liquid chromatography (HPLC). Chromatographic conditions: BioRad Aminex HPX87H column, column temperature 35℃, mobile phase 5 mM sulfuric acid solution, flow rate 0.5 mL / min, detector temperature 35℃. Cellulose and hemicellulose contents were calculated using the following formula:

[0133] Cellulose % = (C 葡 ×86.73×10^(3)×0.90) / m0×100;

[0134] Hemicellulose % = (C 木 ×86.73×10^(3)×0.88) / m0×100.

[0135] In the formula C 葡 This indicates the glucose concentration after HPLC detection, in g / mL; C 木 The xylose concentration after HPLC detection is expressed in g / mL; m0 represents the oven-dry weight of the hydrolyzed sample raw material in g; 0.9 is the conversion factor between glucose and glucan; and 0.88 is the conversion factor between xylose and xylan.

[0136] (3) Determination of acid-insoluble lignin content

[0137] The acid hydrolysis residue was washed with distilled water until neutral. The sand core funnel, along with the residue, was then dried in a 105°C oven to constant weight. It was transferred to a desiccator and cooled to room temperature. The mass was weighed using a four-position analytical balance and recorded as M1. The constant-weighted sand core funnel and residue were then ignited in a muffle furnace at (575±5)°C for 4 hours. After ignition, they were again placed in a desiccator and cooled to room temperature. The mass was weighed using a four-position analytical balance and recorded as M2. The acid-insoluble lignin content was calculated using the following formula:

[0138] Acid-insoluble lignin % = (M1M2) / m0×100%.

[0139] (4) Determination of acid-soluble lignin content

[0140] The absorbance of the acid-hydrolyzed solution was measured at 280 nm using a UV-Vis spectrophotometer. Deionized water was used as a blank control for zeroing. Samples were appropriately diluted according to the absorbance range (0.700-1.000), and the dilution factor and absorbance (accurate to 0.001) were recorded. Each sample required at least two parallel measurements, and all operations had to be completed within 6 hours after hydrolysis. The acid-soluble lignin content was calculated using the following formula:

[0141] Acid-soluble lignin % = (A×D×V) / (96×m0)×100%.

[0142] In the formula, A is the absorbance of the sample to be tested; D is the dilution factor of the sample to be tested; V is the volume of the sample hydrolysate, 0.087 L; 96 is the absorption coefficient; and m0 is the oven-dry mass of the hydrolysate sample, in g.

[0143] 7. Determination of reducing sugar content

[0144] After centrifuging the enzymatic hydrolysate or fermentation broth at 10,000 rpm for 1 min, collect the supernatant and dilute it with deionized water to an appropriate concentration. Mix 250 μL of the diluted solution with 250 μL of DNS, treat in a boiling water bath for 15 min, and after cooling, measure the absorbance at 540 nm using a UV spectrophotometer. Calculate the reducing sugar content in the sample based on the glucose standard curve.

[0145] Example 1 Isolation of bacterial strains

[0146] Accurately weigh 1g of Daqu sample and place it in a 25mL Erlenmeyer flask containing 9mL of sterile water and glass beads. Shake to mix thoroughly to prepare a bacterial suspension. Dilute the bacterial suspension sequentially to 10... -4 10 -5 10 -6 Each dilution was diluted 0.1 mL and spread onto corn husk selection medium, with three replicates for each gradient. Plates were incubated at 30°C, observed periodically, and colonies of different morphologies were streaked for purification to obtain single colonies. The activities of three cellulases (CMCase, βGCase, and FPA) in each colony were measured, and the colony with the optimal enzyme activity was selected and named HNZY02.

[0147] Example 2 Identification of bacterial strains

[0148] 2.1 Extraction of genomic DNA

[0149] By scraping the bacterial strain from the culture medium near the flame of an alcohol lamp, and then grinding it in liquid nitrogen in a mortar. Transfer the ground bacterial cells to a sterile 1.5 mL centrifuge tube and label it with the strain name. Next, add 0.6 mL of TE buffer (pH 8.0) and repeatedly pipette to ensure the cells are fully and evenly suspended. Add 250 µL of 10% SDS and gently invert to mix. Add 3 µL of proteinase K (20 ng / µL), gently mix, and incubate at 37 °C for 1 h. Add 150 µL of 5 mol / L NaCl and gently mix. Add 150 µL of 2% CTAB, gently mix, and incubate at 65 °C for 20 min. Centrifuge at 12000 rpm for 20 min. Carefully transfer the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix thoroughly, incubate at room temperature for 30 min, and then centrifuge at 12000 rpm at 4 °C for 10 min. Remove the supernatant, air dry the liquid on absorbent paper, add 750µL of 70% ethanol, gently tap the tube wall to suspend the precipitate, and invert the tube several times. Centrifuge at 12000rpm, 4℃ for 2min. Add 30µL of purified water (with RNase added to the water, final concentration 10ng / µL) to each tube to dissolve the precipitate, gently tap the tube wall, and dissolve overnight at 4℃.

[0150] 2.2 PCR amplification

[0151] During strain identification, the genomic DNA of strain HNZY02 was amplified by PCR using universal primers ITS1 and ITS4 for the internal transcribed spacer region of fungi. ITS sequences are highly conserved in eukaryotes and are suitable for molecular species identification. The PCR reaction system and conditions are shown in Tables 2 and 3, respectively. The amplification products were detected by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown.

[0152] The ITS universal primer sequence is as follows:

[0153] ITS1: 5'GGAAGTAAAAGTCGTAACAAGG3' (SEQ ID No. 1);

[0154] ITS4: 5'TCCTCCGCTTATTGATATGC3' (SEQ ID No. 2).

[0155] Table 2 PCR reaction system

[0156]

[0157] Table 3 PCR reaction conditions

[0158]

[0159] Figure 3This is an electrophoresis diagram of the PCR product of strain HNZY02 in an embodiment of the present invention.

[0160] Depend on Figure 3 As can be seen, this figure shows the migration of the amplification products, which can be used for further analysis and identification of the molecular characteristics of strain HNZY02.

[0161] 2.3 Construction of the phylogenetic tree

[0162] The PCR amplification products were sent to BGI Genomics Co., Ltd. in Beijing for sequencing. After software correction and assembly, the nucleotide sequence of the strain was obtained. The sequence length of strain HNZY02 was 537 bp. Next, the nucleotide sequence of this strain was compared for homology on the NCBI website. Subsequently, a phylogenetic tree was constructed using the Neighbor Joining method in the analysis software. The results are as follows: Figure 4 As shown.

[0163] Figure 4 This is a phylogenetic tree diagram of strain HNZY02 from an embodiment of the present invention.

[0164] Depend on Figure 4 It can be seen that this strain clusters with Aspergillus tabingensis on the same branch of the phylogenetic tree, indicating a close phylogenetic relationship. Combined with the ITS sequence amplification results ( Figure 3 As can be seen, strain HNZY02 shares over 99% homology with strains such as Aspergillus niger and Aspergillus tabineensis. Therefore, strain HNZY02 is identified as Aspergillus tabineensis.

[0165] Example 3: Optimization of culture medium composition for cellulase production by Aspergillus tabingensis HNZY02

[0166] 3.1 Preparation of spore suspension

[0167] 10 mL of sterile physiological saline was added to PDA agar plates that had been cultured at 30°C for 3 days. Then, a sterile inoculation loop was used to gently scrape the surface of the medium to prepare a spore suspension. After thoroughly mixing the suspension, the number of spores was counted using a hemocytometer, and finally, the concentration of the spore suspension was adjusted to 10. 8 spores / mL.

[0168] 3.2 Optimization of Culture Medium Composition

[0169] 3.2.1 Single-factor optimization

[0170] The effects of corn husk mesh size, corn husk concentration, nitrogen source type and concentration, surfactant type and concentration, K₂HPO₄ concentration, MgSO₄ concentration, CaCl₂ concentration, and NaCl concentration on cellulase production by *Aspergillus tabingensis* HNZY02 were investigated using single-factor experiments. Specific factor level designs are shown in Table 4. Spore suspension was added to the culture medium (50 mL / 250 mL) at a 5% inoculum rate, and the medium was then incubated at 30℃ and 180 rpm for 72 h on a shaker. After incubation, the activities of CMCase, βGase, and FPA in the culture medium were measured.

[0171] Table 4 Single-factor optimization design of culture medium components

[0172]

[0173] Figure 5 The figure shows the effect of corn husk mesh number on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0174] Depend on Figure 5 It was found that corn husk powder of different fineness significantly affected the cellulase activity of the strain. With increasing corn husk mesh size, CMCase activity showed a trend of first increasing and then decreasing. The cellulase activity reached its highest level (77.1 U / mL) when 4060-mesh corn husk was added. Therefore, 4060 mesh is the optimal corn husk mesh size for cellulase production by this strain.

[0175] Figure 6 The figure shows the effect of corn husk concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0176] Depend on Figure 6 It was found that when the corn husk concentration was below 30 g / L, the cellulase activity of *Aspergillus tabineum* HNZY02 increased with increasing corn husk concentration. At a corn husk concentration of 30 g / L, the cellulase activity of *Aspergillus tabineum* HNZY02 reached its highest value of 66.7 U / mL. When the corn husk concentration exceeded 30 g / L, the cellulase activity decreased with increasing concentration. Therefore, 30 g / L is the optimal corn husk concentration for cellulase production by this strain.

[0177] Figure 7 The figure shows the effect of nitrogen source type on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0178] Depend on Figure 7It was found that the cellulase secretion capacity of *Aspergillus tabineum* HNZY02 differed significantly under different nitrogen source conditions. Specifically, the influence of organic nitrogen sources on cellulase production by *Aspergillus tabineum* HNZY02 was in the following order: peptone > beef peptone > yeast extract > urea. The influence of inorganic nitrogen sources on cellulase production by *Aspergillus tabineum* HNZY02 was in the following order: (NH4)2SO4 > NH4Cl > NaNO3 > KNO3. Except for urea, organic nitrogen sources were more conducive to cellulase secretion by *Aspergillus tabineum* HNZY02 than inorganic nitrogen sources. Therefore, peptone is the optimal nitrogen source for cellulase production in this strain.

[0179] Figure 8 The figure shows the effect of peptone concentration on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0180] Depend on Figure 8 It was observed that the activity of cellulase in the fermentation broth initially increased and then decreased with increasing peptone concentration. The cellulase activity reached its maximum value of 99.2 U / mL when the peptone concentration reached 10 g / L. An appropriate peptone concentration was found to effectively promote cellulase secretion in *Aspergillus tabingensis* HNZY02. Therefore, a peptone concentration of 10 g / L is the optimal nitrogen source concentration for cellulase production by this strain.

[0181] Figure 9 The figure shows the effect of surfactant type on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0182] Depend on Figure 9 It was found that, compared with the blank control group, the Triton series surfactants exhibited an inhibitory effect on cellulase activity, while most Tween series surfactants promoted cellulase secretion. Specifically, Tween 40 and Tween 60 showed the best effects on cellulase secretion from *Aspergillus tabineus* HNZY02. Tween 40 showed the best promoting effect on *Aspergillus tabineus* HNZY02; therefore, Tween 40 is the most suitable surfactant for cellulase production.

[0183] Figure 10 The figure shows the effect of Tween 40 concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0184] Depend on Figure 10It can be seen that the cellulase activity in the fermentation broth first increases and then decreases with increasing Tween 40 concentration. Specifically, the cellulase activity reaches its maximum value of 94.1 U / mL when the Tween 40 concentration is 8 g / L; when the Tween 40 concentration is less than 8 g / L, the cellulase activity of the strain gradually increases with increasing concentration; when the Tween 40 concentration exceeds 8 g / L, the cellulase activity of the strain decreases. Therefore, 8 g / L of Tween 40 is the optimal initial concentration for cellulase production by this strain.

[0185] Figure 11 The figure shows the effect of K2HPO4 concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0186] Depend on Figure 11 It can be seen that the cellulase activity of *Aspergillus tabineum* HNZY02 initially increases and then decreases with increasing K2HPO4 concentration. Specifically, the cellulase activity of *Aspergillus tabineum* HNZY02 reaches its maximum value of 110.7 U / mL when the K2HPO4 concentration is 6 g / L; when the K2HPO4 concentration is below 6 g / L, the cellulase activity of *Aspergillus tabineum* HNZY02 also increases with increasing concentration; when the K2HPO4 concentration exceeds 6 g / L, the cellulase activity decreases.

[0187] Figure 12 The figure shows the effect of MgSO4 concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0188] Depend on Figure 12 It was found that the cellulase activity of *Aspergillus tabineum* HNZY02 initially increased and then decreased with increasing MgSO4 concentration. Specifically, the cellulase activity of *Aspergillus tabineum* HNZY02 reached its maximum value of 104.3 U / mL at a MgSO4 concentration of 2 g / L. When the MgSO4 concentration was less than 2 g / L, the cellulase activity increased with increasing MgSO4 concentration; conversely, when the MgSO4 concentration exceeded 2 g / L, the cellulase activity decreased with increasing concentration.

[0189] Figure 13 The figure shows the effect of CaCl2 concentration on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0190] Depend on Figure 13It was found that the cellulase activity of *Aspergillus tabineum* HNZY02 showed a trend of first increasing and then decreasing with increasing CaCl2 concentration. Specifically, the cellulase activity of the strain reached its maximum value of 109.1 U / mL when the CaCl2 concentration was 0.5 g / L. When the CaCl2 concentration was less than 0.5 g / L, the cellulase activity of *Aspergillus tabineum* HNZY02 increased with increasing CaCl2 concentration; however, when the CaCl2 concentration was greater than 0.5 g / L, the enzyme activity decreased with increasing concentration.

[0191] Figure 14 The figure shows the effect of NaCl concentration on the cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0192] Depend on Figure 14 It was found that the cellulase activity of *Aspergillus tabineum* HNZY02 showed a trend of first increasing and then decreasing with increasing NaCl concentration. Specifically, the cellulase activity of this strain reached its highest value of 116.3 U / mL at a NaCl concentration of 2 g / L. When the NaCl concentration was less than 2 g / L, the cellulase activity of *Aspergillus tabineum* HNZY02 increased with increasing NaCl concentration; however, when the NaCl concentration was greater than 2 g / L, the enzyme activity decreased with increasing concentration.

[0193] 3.2.2 PB test of cellulase production conditions by Aspergillus tabingensis HNZY02

[0194] The effects of seven nutrients in the fermentation medium for enzyme production on the cellulase activity of *Aspergillus tabineus* HNZY02 were investigated using the Plackett-Burman experimental design method. These seven nutrients were corn husk, potassium nitrate, Tween 80, K₂HPO₄, MgSO₄, CaCl₂, and NaCl. The results showed that these nutrients significantly affected the cellulase activity of the strain. Based on the optimization results of single-factor experiments, high (+1) and low (1) levels for the seven factors were determined. Fifteen experimental combinations were designed using the Plackett-Burman experimental design method to examine the significance of the effects of each factor on the cellulase activity of *Aspergillus tabineus* HNZY02.

[0195] Based on the results of the single-factor experiment of Aspergillus tabbini HNZY02, and according to the PB experimental design method, the significance of the concentrations of corn husk (X1), peptone (X2), Tween 40 (X3), dipotassium hydrogen phosphate (X4), magnesium sulfate (X5), calcium chloride (X6), and sodium chloride (X7) in the fermentation enzyme production medium on the activity of cellulase in strain Aspergillus tabbini HNZY02 was analyzed. The experimental results are shown in Table 5.

[0196] Table 5. PB Experimental Design and Results

[0197]

[0198] The above experimental results were fitted using computational analysis software, and the regression equation is as follows:

[0199] Enzyme activity = 97.85 - 1.1608X1 + 1.712X2 + 1.040X3 - 0.004X4 + 0.292X5 + 0.88X6 - 0.225X7.

[0200] Table 6 Factor Levels and Statistical Analysis of PB Experimental Design

[0201]

[0202] The results of the ANOVA and significance analysis in Table 6 show that the F-value of the regression model is 65.69, with a corresponding P-value of 0.002, significantly lower than 0.01. This indicates that the model is statistically significant and can effectively describe the factors affecting the cellulase activity of *Aspergillus tabingensis* HNZY02. Further ANOVA revealed the varying degrees of influence of different nutrients on the cellulase activity of this strain. Specifically, the addition of corn husks, K₂HPO₄, and NaCl had a negative impact on the cellulase activity of *Aspergillus tabingensis* HNZY02. Conversely, other nutrients generally showed a positive effect, indicating that they effectively promoted enzyme synthesis and activity. These results provide important theoretical basis for subsequent optimization of culture medium formulation and improvement of enzyme production capacity.

[0203] 3.2.3 Steepest Climb Test

[0204] In-depth analysis of the PB experiment on *Aspergillus tabingensis* HNZY02 clarified the significant effects of corn husk concentration, peptone concentration, and Tween 40 concentration on the cellulase activity of *Aspergillus tabingensis* HNZY02. These factors are particularly important in the experimental design, especially in the steepest ramp design experiment, and their adjustment direction has been determined to facilitate subsequent optimization experiments. Furthermore, combining the results obtained from single-factor experiments, previous experimental experience, and the basic principles of the steepest ramp design method, appropriate step sizes were determined for each factor. These step sizes will help to more effectively adjust the concentrations of different nutrients in the experiment, thereby maximizing cellulase activity and improving production efficiency. The steepest ramp experimental design and its results are shown in Table 7 below.

[0205] Table 7. Experimental Design and Results for the Steepest Climb

[0206]

[0207] According to the experimental results in Table 7, as the number of experimental groups increased, the cellulase activity of *Aspergillus tabineum* HNZY02 exhibited a classic parabolic trend. This indicates that with proper adjustment of nutrient concentrations, enzyme activity can reach an optimal level. In experimental group 4, the cellulase activity of *Aspergillus tabineum* HNZY02 reached a peak of 116.6 U / mL, showing that the concentrations of various nutrients in the culture medium were precisely within the optimal range for promoting cellulase production. Therefore, it was decided to use the concentrations of each nutrient in experimental group 4 as the center point for each factor in the subsequent response surface methodology design to further optimize and improve the production efficiency of cellulase.

[0208] 3.2.4 Response Surface Experiment

[0209] Three nutrients that most significantly affected the cellulase activity of *Aspergillus tabingensis* HNZY02, as determined in the PB experiment, were selected for response surface methodology (RSM) design. The optimal experimental combination determined from the steepest climb experiment was used as the center value of the RSM. Based on the RSM design methodology, 17 RSM experimental combinations were designed, including 5 center value experimental groups.

[0210] Based on the results of the PB experiment and the steepest climb experiment, a three-factor, three-level response surface experiment was designed using three factors: corn husk concentration (X1), peptone concentration (X2), and Tween 40 concentration (X3). The specific design is shown in Table 8.

[0211] Table 8 Response Surface Design

[0212]

[0213] The response surface methodology and results of Aspergillus tabineum HNZY02 are shown in Table 9. The experimental results were analyzed using computational analysis software, yielding the following multiple quadratic regression equation between the cellulase activity of Aspergillus tabineum HNZY02 and three factors: corn husk concentration (X1), peptone concentration (X2), and Tween 40 concentration (X3): Y = -504.8 + 13.05X1 + 41.71X2 + 42.29X3 - 0.2678X1 2 -1.403X2 2 -2.255X3 2 -0.2900X1X2+0.268X1X3-0.120X2X3.

[0214] Table 9 Response Surface Experimental Design and Results

[0215]

[0216] Based on the analysis of variance results of the response surface methodology (see Table 10), the F-value of the multiple quadratic regression equation was found to be 38.03, while the corresponding P-value was less than 0.001. This result indicates that the regression equation is highly significant, demonstrating the reliability of the model. Meanwhile, the P-value for the lack-of-fit term was 0.606, significantly higher than 0.05, indicating a good correlation between the actual measured values ​​and the predicted values, suggesting very high applicability of the model. Furthermore, the R-value of the quadratic regression equation... 2 The value is 99%, while the corrected R 2 The value was 98.4%, further indicating that the regression model had a good fit, high reliability and practical feasibility, and could accurately reflect the relationship between cellulase activity and its independent variables. Therefore, this equation can be effectively used to optimize the concentration levels of the three components in Aspergillus tabineus HNZY02 during fermentation, providing a scientific basis for subsequent research.

[0217] Table 10 Analysis of Variance of Regression Model

[0218]

[0219] Based on the experimental results of response surface methodology, computational analysis software was used to optimize the optimal fermentation medium for cellulase production from *Aspergillus tabineum* HNZY02. Analysis and calculations revealed that the optimal fermentation medium for *Aspergillus tabineum* HNZY02 consisted of 23.1 g / L corn husk, 12.1 g / L peptone, and 10.4 g / L Tween 40. Under these conditions, the predicted cellulase activity was 119.1 U / mL. To verify the effectiveness of these optimized conditions, corresponding experiments were conducted. The results showed that the measured value for *Aspergillus tabineum* HNZY02 was 119.7 U / mL, with a relative error of only 2%, and no significant difference between the two values. This result demonstrates that the model established in this invention not only has good applicability and practicality but also provides reliable theoretical support for future practical applications in cellulase production.

[0220] Furthermore, according to the experimental results, the cellulase activity of *Aspergillus tabingensis* HNZY02 in the unoptimized medium was 74.5 U / mL, while after optimization, its enzyme activity increased to 119.7 U / mL, which is 1.6 times that before optimization. This result not only demonstrates the positive impact of optimization on cellulase production, but also further emphasizes the importance of optimizing the composition of the culture medium to achieve higher enzyme yields.

[0221] Example 4: Optimization of culture conditions for cellulase production by Aspergillus tabineus HNZY02

[0222] 4.1 Single-factor culture

[0223] A single-factor experimental design was used to investigate the effects of initial pH, inoculum size, liquid volume, rotation speed, temperature, and culture time on extracellular cellulase in Aspergillus tabingensis HNZY02. Specific factor level designs are shown in Table 11 below. Three parallel experiments were set up for each level to improve the reliability and accuracy of the results.

[0224] Table 11 Single-factor optimization design of cultivation conditions

[0225]

[0226] In the experiments, the culture medium volume was 50 mL / 250 mL, and spore suspension was added at an inoculum rate of 5%. All experiments were conducted in a shaker at 30 °C and 180 r / min for 72 h. After incubation, the activities of carboxymethyl cellulase (CMCase), β-glucosidase (βGase), and filter paper enzyme (FPA) in the culture medium were measured to evaluate the effect of different culture conditions on the cellulase production capacity of the two strains.

[0227] 4.1.1 Effect of initial pH on cellulase activity of Aspergillus tabingensis HNZY02

[0228] The pH value of the culture environment is a key parameter affecting microbial growth and enzyme production. A suitable pH environment optimizes the dissolution and absorption efficiency of nutrients, promoting cell proliferation and enzyme reaction rates; conversely, an unsuitable pH will inhibit cell growth and reduce enzyme production capacity. Furthermore, pH directly affects the spatial conformation and active site stability of enzyme molecules by altering the charge state of cells and enzyme proteins, and may also change the substrate ionization state, thereby affecting enzyme substrate binding and catalytic efficiency. Therefore, controlling a suitable pH, especially the initial pH, is a necessary condition for ensuring efficient enzyme production.

[0229] In this experiment, seven different pH levels (4, 5, 6, 7, 8, 9, and 10) were set up in the liquid enzyme-producing medium. Spore suspensions of *Aspergillus tabingensis* HNZY02 were inoculated into these liquid enzyme-producing media while keeping other conditions constant. Finally, the enzyme production of the strain at different pH values ​​was measured, and the results are as follows: Figure 15 As shown.

[0230] Figure 15 The figure shows the effect of the initial pH of the culture medium on the cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0231] Depend on Figure 15It was found that the initial pH value had a significant impact on the enzyme activity of *Aspergillus tabineum* HNZY02. As the pH value gradually increased, the enzyme activity initially increased and then decreased. Specifically, the enzyme activity of *Aspergillus tabineum* HNZY02 reached its maximum at pH 5, and then gradually decreased. In a strongly acidic environment (pH 4.5), the enzyme activity of this strain was relatively high: at pH 4, the cellulase activity was 95.3 U / mL, and at pH 5, it reached a maximum of 121.5 U / mL. When the pH value exceeded 5, the enzyme activity also showed a gradual decreasing trend, reaching a minimum of 54.7 U / mL at pH 9.

[0232] 4.1.2 Effect of inoculum size on cellulase activity of Aspergillus tabineus HNZY02

[0233] Inoculum size is a key parameter affecting the efficiency and economics of microbial fermentation. Too low an inoculum size prolongs the cell retardation phase, leading to a longer fermentation cycle, reduced yield, and increased risk of contamination; while too high an inoculum size increases production costs and may cause metabolic abnormalities due to rapid depletion of nutrients and oxygen, thus reducing enzyme production efficiency. Therefore, optimizing the inoculum size is crucial for controlling the fermentation cycle and ensuring production stability and economic efficiency.

[0234] This experiment was designed with five inoculum levels (1%, 3%, 5%, 7%, and 10%). Spore suspensions of *Aspergillus tabingensis* HNZY02 were inoculated into liquid enzyme-producing medium at different inoculum levels, while keeping other culture conditions constant. The effect of different inoculum levels on enzyme production was determined, and the results are as follows: Figure 16 As shown.

[0235] Figure 16 The figure shows the effect of inoculum amount on cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0236] Depend on Figure 16 It was found that the cellulase activity of *Aspergillus tabingensis* HNZY02 initially increased and then gradually decreased with increasing inoculum size. At an inoculum size of 5%, the cellulase activity of this strain reached its maximum value of 124.0 U / mL. When the inoculum size was low, the enzyme activity was lower; for example, at an inoculum size of 1%, the cellulase activity was as low as 80.9 U / mL. The enzyme activity also showed a decreasing trend after the inoculum size exceeded 5%.

[0237] 4.1.3 Effect of liquid volume on cellulase activity of Aspergillus tabineus HNZY02

[0238] In shake-flask culture, the liquid volume is a key factor determining dissolved oxygen levels. An appropriate liquid volume optimizes gas-liquid exchange efficiency, ensuring a sufficient oxygen supply, thereby effectively promoting rapid cell growth and increasing cellulase synthesis efficiency. Therefore, optimizing the liquid volume is an important means of increasing enzyme production.

[0239] This experiment set up six liquid volume levels (12.5 mL / 250 mL, 25 mL / 250 mL, 37.5 mL / 250 mL, 50 mL / 250 mL, 62.5 mL / 250 mL, and 75 mL / 250 mL). Under these conditions, Aspergillus tabingii HNZY02 spore suspensions were inoculated into liquid enzyme-producing medium at different inoculum amounts. Subsequently, the enzyme production of the two strains was measured at each liquid volume, and the results are as follows: Figure 17 As shown.

[0240] Figure 17 The figure shows the effect of liquid volume on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0241] Depend on Figure 17 It was observed that the cellulase activity of *Aspergillus tabineum* HNZY02 initially showed an increasing trend with increasing liquid volume. However, when the liquid volume continued to increase to a certain extent, the enzyme activity began to decrease. The cellulase activity of this strain reached its maximum value of 131.8 U / mL at a liquid volume of 37.5 mL / 250 mL. This indicates that a higher oxygen content is beneficial to the fermentation and enzyme yield of *Aspergillus tabineum* HNZY02.

[0242] 4.1.4 Effect of rotational speed on cellulase activity of Aspergillus tabineus HNZY02

[0243] The shaking speed in shake flask culture is a key parameter for controlling dissolved oxygen levels. An appropriate shaking speed enhances gas-liquid mixing, improves dissolved oxygen efficiency, and ensures optimal conditions for microbial growth and enzyme production. Too low a speed will lead to insufficient dissolved oxygen; too high a speed can easily generate excessive foam or cause shear damage to the bacterial cells. Therefore, optimizing the shaking speed parameter is crucial for maintaining healthy bacterial growth and achieving efficient enzyme production.

[0244] This experiment set up five different rotation speed levels (120 r / min, 140 r / min, 160 r / min, 180 r / min, and 200 r / min). Under these conditions, Aspergillus tabineus HNZY02 spore suspensions were inoculated into liquid enzyme-producing medium at different inoculation amounts. Subsequently, the effects of each rotation speed on enzyme production of the two strains were measured, and the results are as follows: Figure 18 As shown.

[0245] Figure 18 The figure shows the effect of rotation speed on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0246] Depend on Figure 18 It was found that the cellulase activity of *Aspergillus tabineum* HNZY02 initially increased and then decreased with increasing fermentation speed. Specifically, the cellulase activity of this strain reached its maximum value of 117.3 U / mL at a fermentation speed of 200 r / min. The dissolved oxygen supply in the culture medium was sufficient to meet the growth requirements of *Aspergillus tabineum* HNZY02 and the enzyme production requirements during fermentation. Therefore, comprehensive analysis shows that the optimal fermentation speed for *Aspergillus tabineum* HNZY02 is 200 r / min.

[0247] 4.1.5 Effect of temperature on cellulase activity of Aspergillus tabineus HNZY02

[0248] Temperature is a key environmental factor regulating microbial growth and metabolism. It directly determines enzyme activity and metabolic rate by influencing the conformation, stability, and substrate binding ability of enzyme proteins. Inappropriate low or high temperatures can lead to enzyme inactivation and impair cell function. Therefore, optimizing the culture temperature to the strain's optimal range is a prerequisite for ensuring rapid growth and efficient enzyme synthesis.

[0249] This experiment established five different culture temperature conditions (25℃, 30℃, 35℃, 40℃, and 45℃), and inoculated a spore suspension of *Aspergillus tabingensis* HNZY02 into liquid enzyme-producing medium at an inoculum size of 5%. Cellulase production was determined under each temperature condition, and the results are as follows: Figure 19 As shown.

[0250] Figure 19 The figure shows the effect of temperature on the cellulase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0251] Depend on Figure 19 It is evident that culture temperature significantly affects the enzyme activity of *Aspergillus tabineum* HNZY02. With increasing culture temperature, enzyme activity initially increases and then decreases. Specifically, the enzyme activity of *Aspergillus tabineum* HNZY02 reaches its maximum value of 117.3 U / mL at 30℃. At lower temperatures (25℃) and higher temperature ranges (35-45℃), some enzymes in the strain exhibit inactivation or denaturation, or show low activity, leading to an overall decrease in enzyme activity. Particularly at 45℃, the enzyme activity of *Aspergillus tabineum* HNZY02 drops to its lowest point, at 70.6 U / mL. In conclusion, the optimal culture temperature for *Aspergillus tabineum* HNZY02 is 30℃, at which point its enzyme production capacity is optimal. Therefore, in subsequent fermentation experiments, this invention will set the culture temperature to 30℃ to optimize cellulase production.

[0252] 4.1.6 Effect of culture time on cellulase activity of Aspergillus tabineus HNZY02

[0253] Microbial enzyme activity is influenced by various factors at different culture times, including the strain's adaptability to the culture environment, the accumulation of metabolites, the production of different enzyme types, and their respective enzyme production rates. Therefore, enzyme activity varies significantly at different time points. To investigate these influencing factors, spore suspensions of *Aspergillus tabingensis* HNZY02 were inoculated into liquid enzyme-producing media at a 5% inoculum size. These media were then incubated at 30°C on a shaker at 180 rpm. This condition aimed to provide a stable environment for enzyme production, allowing for observation of enzyme activity changes at different times and thus optimizing the enzyme production process. After inoculation, samples were taken every 24 hours to measure the activities of carboxymethyl cellulase (CMCase), filter paper enzyme (FPA), and β-glucosidase (βGase) in the culture medium for 7 days. The results are shown below. Figure 20 .

[0254] Figure 20 The figure shows the effect of culture time on cellulase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention.

[0255] Depend on Figure 20 It was observed that the enzyme activity of *Aspergillus tabineum* HNZY02 showed a trend of first increasing and then decreasing with prolonged culture time. Specifically, on day 1 of culture, the enzyme activity was relatively low, at 48.4 U / mL, as the strain had not yet adapted to the culture environment. Subsequently, as time progressed, *Aspergillus tabineum* HNZY02 gradually adapted to the culture environment, multiple enzyme systems began to work synergistically, and the enzyme production rate continuously increased. On day 3 of culture, the enzyme activity reached its peak, at 116.6 U / mL. However, after 3 days of culture, due to the continuous accumulation of metabolites and the consumption of nutrients, the enzyme activity gradually decreased, and the effect of culture time on enzyme activity became weaker. In conclusion, the optimal culture time for *Aspergillus tabineum* HNZY02 is 3 days, at which point the enzyme activity reaches its maximum value.

[0256] 4.2 Optimization of cellulase production conditions by Aspergillus tabingensis HNZY02 (PB experiment)

[0257] Based on the optimization results of the single-factor experiments, four culture conditions were selected for PB experiment optimization: initial pH, liquid volume, temperature and culture time. Other factors were also set to the optimal levels obtained from the single-factor experiments.

[0258] After determining the high (+1) and low (1) levels of each factor in the experimental design, 15 experimental combinations were designed using the PB experimental design method. This process aimed to examine the significance of the effects of each factor on the cellulase activity of Aspergillus tabingensis HNZY02.

[0259] Based on the results of the single-factor experiment of Aspergillus tabbini HNZY02, and according to the PB experimental design method, the significance of fermentation conditions: initial pH (X1), liquid volume (X2), temperature (X3) and culture time (X4) on the cellulase activity of Aspergillus tabbini HNZY02 was analyzed. The experimental results are shown in Table 12.

[0260] Table 12 PB Experimental Design and Results

[0261]

[0262] The above experimental results were fitted using computational analysis software, and the regression equation is as follows:

[0263] Enzyme activity = -58.4 + 10.47X1 + 0.052X2 + 0.753X3 + 17.22X4 + 71.73.

[0264] Analysis of variance and significance analysis in Table 13 revealed that the regression model had an F-value of 183.21 and a corresponding P-value of 0.000, indicating that the regression model was statistically significant and could accurately reflect the influence of culture conditions on the cellulase activity of Aspergillus tabineum strain HNZY02. Further analysis of variance revealed that different culture conditions showed significant differences in the cellulase activity of Aspergillus tabineum strain HNZY02. Specifically, the culture volume had a negative effect on the cellulase activity of Aspergillus tabineum strain HNZY02, meaning that excessively high culture volume may lead to insufficient oxygen supply, thereby inhibiting enzyme production. In contrast, other conditions generally had a positive effect on enzyme synthesis and activity, indicating that adjusting these conditions appropriately can promote enzyme production. These results provide a valid theoretical basis for subsequent culture medium optimization.

[0265] Table 13 Factor Levels and Effects Analysis of PB Experimental Design

[0266]

[0267] Further analysis revealed that among the four culture conditions studied, initial pH, temperature, and culture time significantly affected the cellulase activity of *Aspergillus tabingensis* HNZY02, while the volume of culture medium had no significant effect. Therefore, subsequent experiments will primarily focus on optimizing the levels of these three key culture conditions—initial pH, temperature, and culture time—to maximize cellulase activity. Furthermore, the volume of culture medium will be set based on the optimal levels obtained from single-factor experiments, followed by a scaling-up experiment to further explore the potential impact of these factors on enzyme activity. This research direction aims to provide a scientific basis for improving the production efficiency of microbial enzymes.

[0268] 4.3 Steepest Climb Test

[0269] Based on the results of the PB experiment, the steepest climbing experiment was conducted on the culture conditions that significantly affected the cellulase activity of Aspergillus tabingensis HNZY02, while the optimal concentration determined in the single-factor optimization was used for those culture conditions that did not have a significant impact.

[0270] Based on the PB experiment analysis results of Aspergillus tabingensis HNZY02, the effects of initial pH, temperature, and culture time on the cellulase activity of Aspergillus tabingensis HNZY02 were determined, and the adjustment direction of these three factors in the steepest ramp design was clarified. By combining the results of single-factor experiments, experimental experience, and the methodological principles of the steepest ramp design, the movement step size of each of the three factors was determined. The specific experimental design and results are shown in Table 14 below.

[0271] Table 14. Experimental Design and Results for the Steepest Climb

[0272]

[0273] According to the data in Table 14, the cellulase activity of *Aspergillus tabineum* HNZY02 showed a clear parabolic trend as the number of experimental groups increased in the steepest climbing experimental design. This change generally indicates that, within a certain range of conditions, enzyme activity gradually increases with the increase of experimental groups. Especially in experimental group 4, the cellulase activity of *Aspergillus tabineum* HNZY02 reached a peak of 142.7 U / mL, indicating that the culture conditions in this group perfectly met the optimal concentration requirements for cellulase production by *Aspergillus tabineum* HNZY02. This result not only illustrates the importance of optimizing culture conditions but also helps to provide a reference for future microbial enzyme production. Therefore, the concentrations of each nutrient in experimental group 4 were selected as the central points of factors involved in subsequent response surface methodology designs.

[0274] 4.4 Response Surface Experiment

[0275] Three culture conditions that had the most significant impact on cellulase activity of Aspergillus tabingensis HNZY02 were selected from the PB experiment for response surface methodology. The optimal experimental combination in the steepest climbing experiment was taken as the center value of the response surface experiment. Seventeen response surface experiments were designed using the response surface methodology, of which five were center value experimental groups.

[0276] Based on the results of the Aspergillus tabineus HNZY02 PB test and the steepest ascent test, a three-factor, three-level response surface experiment was designed using three factors: initial pH (X1), temperature (X2), and incubation time (X3). The specific design is shown in Table 15 below.

[0277] Table 15 Response Surface Design

[0278]

[0279] The response surface methodology and results of Aspergillus tabineum HNZY02 are shown in Table 16. The experimental results were analyzed using computational analysis software, yielding a multiple quadratic regression equation relating cellulase activity of Aspergillus tabineum HNZY02 to three factors: initial pH (X1), temperature (X2), and culture time (X3).

[0280] Y=﹣3228+496.0X1+92.4X2+14.03X3-40.96X1 2 -1.366X2 2 -0.0827X3 2 -1.20X1X2-0.146X1X3+0.00250X2X3.

[0281] Table 16 Response Surface Design and Results

[0282]

[0283] Based on the analysis of variance results of the response surface experimental design in Table 17, the analysis of these data revealed that the F-value of the multiple quadratic regression equation was 29.0, and its corresponding P-value was less than 0.001. This result indicates that the regression equation is statistically highly significant and can effectively describe the relationship between variables. Meanwhile, the analysis of variance results showed that the P-value for the lack-of-fit term was 0.530, significantly higher than 0.05, indicating that this term was not significant. This implies a good correlation between the actual measured values ​​and the model's predicted values, further validating the accuracy and reliability of the regression equation and providing a solid statistical foundation for the research.

[0284] In addition, the coefficient of determination R of the quadratic regression equation 2 It reached 98.4%, while the correction factor R 2 AdjThe figure was 96.3%. These figures indicate that the regression model has an excellent fit, high reliability and feasibility, and can effectively and accurately reflect the relationship between cellulase activity and independent variables. This result shows that the model can explain most of the variability and has certain applicability in practical situations. Therefore, based on this regression equation, we can further optimize three key culture conditions in the fermentation process of Aspergillus tabingensis HNZY02 to find the optimal levels. This will provide an important theoretical basis for subsequent experimental design and practical applications, and help improve enzyme production efficiency.

[0285] Table 17 Analysis of Variance for Regression Models

[0286]

[0287] Based on the results of response surface methodology experiments, the optimal culture conditions for *Aspergillus tabineum* HNZY02 were systematically optimized using computational analysis software. In the optimization of *Aspergillus tabineum* HNZY02, the optimal culture conditions were set as follows: initial pH 5.45, temperature 31.5℃, and culture time 80.5 h, under which the predicted cellulase activity was 146.9 U / mL. These optimization results provide important evidence for improving the production efficiency of microbial enzymes and lay the foundation for subsequent research.

[0288] In the validation experiments conducted under all optimized conditions, the cellulase activity of *Aspergillus tabingensis* HNZY02 was actually measured to be 148.6 U / mL. The relative error between the predicted and measured values ​​was only 2%, indicating a very high degree of agreement and no significant difference was found. This result fully demonstrates the effectiveness and practicality of the model established in this invention, providing a reliable basis for its future application in microbial enzyme production.

[0289] Further analysis revealed that the cellulase activity of *Aspergillus tabingensis* HNZY02 was 119.7 U / mL under unoptimized conditions, while it reached 148.6 U / mL under optimized conditions, indicating a 1.2-fold increase in enzyme activity after optimization. This also signifies a significant improvement in enzyme activity. These results further support the necessity of optimizing culture conditions and emphasize the importance of scientifically adjusting culture conditions during microbial enzyme production.

[0290] Example 5: Optimization of conditions for xylanase production by Aspergillus tabineus HNZY02

[0291] Aspergillus tabineum HNZY02 was streaked onto a PDA plate. After colonies grew, 10 mL of sterile saline was added to the plate to wash off the spores, which were then transferred to sterile centrifuge tubes to prepare a spore suspension. The spore suspension was counted using a hemocytometer, and the number of spores per milliliter of the suspension was calculated using a formula based on 1 × 10⁻⁶. 7 A total of 100 spores were inoculated onto the basal fermentation xylanase-producing medium and cultured at 30°C and 180 rpm for 4 days. The xylanase activity was then determined using the DNS method.

[0292] 5.1 Single-factor experiment

[0293] 5.1.1 Carbon source optimization

[0294] Brewer's grains, sugarcane bagasse, corn cob powder, corn husk, rice husk, wheat bran, and tobacco were selected as the sole carbon source for the basic fermentation medium, with an addition amount of 30 g / L for each. Yeast extract was added at 10.0 g / L, CaCl2 at 0.3 g / L, KH2PO4 at 0.6 g / L, MgSO4•7H2O at 0.3 g / L, and FeSO4 at 0.3 g / L. The medium was sterilized at 121℃ for 20 min and dispensed into 30 mL bottles. Each bottle contained 1 × 10⁻⁶ ppm. 7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The test results are as follows: Figure 21 .

[0295] Figure 21 The figure shows the effect of carbon source type on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0296] Depend on Figure 21 It can be seen that different carbon sources have different effects on xylanase production by Aspergillus tabingensis. This is mainly because the xylan content and structure of these carbon sources are different, thus having different effects on the xylanase activity induced by this strain. The results show that xylanase activity is the highest when corn husk is used as the only carbon source.

[0297] 5.2.2 Optimization of Carbon Source Mesh Size

[0298] The carbon source mesh sizes were adjusted to 10 mesh, 20 mesh, 20 mesh, 40 mesh, 40 mesh, 60 mesh, 60 mesh, 80 mesh, and 100 mesh, with an addition amount of 30 g / L for each. Yeast extract powder was added at 10.0 g / L, CaCl2 at 0.3 g / L, KH2PO4 at 0.6 g / L, MgSO4·7H2O at 0.3 g / L, and FeSO4 at 0.3 g / L. The mixture was sterilized at 121℃ for 20 min and dispensed into 30 mL bottles. Each bottle contained 1 × 10⁻⁶ particles. 7Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 22 .

[0299] Figure 22 The figure shows the effect of corn husk particle size on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0300] Depend on Figure 22 It was found that the xylanase activity produced by *Aspergillus tabingensis* HNZY02 changed with the particle size of maize husks. At lower mesh sizes (1020 mesh), the enzyme activity was low due to the larger particle size and smaller contact area between the strain and the carbon source. The xylanase activity was highest at 2040 mesh. Further decreasing the particle size increased the contact area between the strain and the carbon source, but the enzyme activity decreased again, possibly due to the influence of dissolved oxygen and heat dissipation. Further decreasing the particle size to 80-100 mesh resulted in a rebound in enzyme activity, likely because the increased contact area facilitated better nutrient absorption and enzyme production. Based on these results, and considering cost and efficiency, a maize husk particle size of 2040 mesh was selected as the optimal particle size for subsequent experiments.

[0301] 5.2.3 Optimization of Nitrogen Source Types

[0302] Yeast extract, peptone, beef extract, tryptone, ammonium sulfate, yeast extract, and sodium nitrate were selected as the sole nitrogen sources for the basic fermentation medium, with an effective nitrogen concentration of 0.9 g / L for each. Corn husk (2040 mesh) was 30.0 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, and FeSO4 0.3 g / L. The medium was sterilized at 121℃ for 20 min and dispensed into 30 mL bottles. Each bottle contained 1×10⁻⁶ ppm of the fermentation medium. 7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 23 .

[0303] Figure 23 This is a graph showing the effect of nitrogen source type on xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0304] Depend on Figure 23 It can be seen that the xylanase activity was higher after adding different types of nitrogen sources than when no nitrogen source was added. Furthermore, the enzyme activity was relatively high when yeast extract, peptone, and tryptone were used as the only nitrogen source, while the xylanase activity was the highest when tryptone was used as the only nitrogen source, with an enzyme activity of 73.6 U / mL.

[0305] 5.2.4 Optimization of carbon source concentration

[0306] Adjust the carbon source (2040 mesh corn husk) concentration to 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, and 70 g / L; add 7.09 g / L tryptone, 0.3 g / L CaCl2, 0.6 g / L KH2PO4, 0.3 g / L MgSO4•7H2O, and 0.3 g / L FeSO4. Sterilize at 121℃ for 20 min and dispense into 30 mL bottles. Dispense according to 1×10⁻⁶ per bottle. 7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 24 .

[0307] Figure 24 The figure shows the effect of corn husk concentration on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0308] Depend on Figure 24 It was found that xylanase activity first increased and then decreased with increasing corn husk concentration, reaching its highest level of 71.9 U / mL at a corn husk concentration of 40 g / L. Low corn husk concentrations resulted in insufficient nutrients, which was detrimental to strain growth and enzyme production. Conversely, excessively high concentrations led to a viscous fermentation system, affecting dissolved oxygen and heat dissipation, thus hindering strain growth and enzyme production.

[0309] 5.2.5 Nitrogen source concentration optimization

[0310] Adjust the tryptone concentration to 5 g / L, 10 g / L, 15 g / L, 20 g / L, and 25 g / L; add 30 g / L corn husk (2040 mesh), 0.3 g / L CaCl2, 0.6 g / L KH2PO4, 0.3 g / L MgSO4•7H2O, and 0.3 g / L FeSO4; sterilize at 121℃ for 20 min; and dispense into 30 mL bottles. Follow the formula: 1 × 10⁻⁶ ppm per bottle. 7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 25 .

[0311] Figure 25 The figure shows the effect of tryptone concentration on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0312] Depend on Figure 25It was found that with increasing tryptone concentration, the xylanase activity of *Aspergillus tabingensis* HNZY02 exhibited a trend of first increasing and then decreasing. The highest xylanase activity (62.7 U / mL) was observed at a tryptone concentration of 10 g / L, although this was slightly lower than the highest activity achieved with other optimized factors. Low tryptone concentrations resulted in insufficient nutrients, which was detrimental to microbial growth and consequently affected enzyme production. Conversely, high tryptone concentrations led to excessively rapid microbial growth, causing nutrient deficiency in the later stages, resulting in rapid microbial death and reduced enzyme synthesis capacity.

[0313] 5.2.6 Optimization of vaccination volume

[0314] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L, sterilized at 121℃ for 20 min, dispensed into 30 mL bottles. According to 1×10 [units / items] per bottle... 4 1×10 5 1×10 6 1×10 7 1×10 8 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 26 .

[0315] Figure 26 The figure shows the effect of inoculum size on the xylanase activity of Aspergillus tabingensis HNZY02 in this embodiment of the invention.

[0316] Depend on Figure 26 It can be seen that with the increase of inoculum size, the activity of xylanase showed a trend of first increasing and then decreasing, and the activity was highest at an inoculum size of 1×10⁻⁶. 7 At that time, the xylanase produced by Aspergillus tabingensis HNZY02 reached its highest activity, with a maximum enzyme activity of 72.4 U / mL.

[0317] 5.2.7 Optimization of liquid volume

[0318] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L. Sterilized at 121℃ for 20 min. Dispensed into 15 mL, 30 mL, 45 mL, 60 mL, and 75 mL vials. 1×10⁻⁶ units per vial. 7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 27 .

[0319] Figure 27 The figure shows the effect of liquid volume on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0320] Depend on Figure 27 It can be seen that as the liquid volume increases, the xylanase activity does not follow a trend of first increasing and then decreasing, but rather decreases first, reaching its lowest value at 45 mL, and then gradually increases again. The xylanase activity is highest at a liquid volume of 15 mL, which may be due to the optimal oxygen dissolution effect at this time, reaching 114.3 U / mL.

[0321] 5.2.8 Initial pH Optimization

[0322] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L. The pH of the culture medium was adjusted to 4.0, 5.0, 6.0, 7.0, and 8.0 respectively. The medium was sterilized at 121℃ for 20 min and dispensed into 30 mL bottles. Each bottle contained 1 × 10⁻⁶ ppm. 7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 28 .

[0323] Figure 28 The figure shows the effect of the initial pH of the culture medium on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0324] Depend on Figure 28 It is known that xylanase activity first increases and then decreases with increasing initial pH, and the highest enzyme activity of xylanase is 70.5 U / mL at pH 6.0.

[0325] 5.2.9 Optimization of Surfactant Types

[0326] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L, and different surfactants (blank, Tween-20, Tween-40, Tween-60, Tween-80, Triton-100, Triton-114, glycerol) were added at a concentration of 1 g / L. The mixture was sterilized at 121℃ for 20 min and dispensed into 30 mL bottles. Each bottle contained 1 × 10⁻⁶ surfactants. 7Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The test results are as follows: Figure 29 .

[0327] Figure 29 The figure shows the effect of surfactant type on xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0328] Depend on Figure 29 It can be seen that after adding different types of surfactants, the enzyme activity of xylanase did not change significantly compared with the blank control, while the enzyme activity of xylanase was the highest when Tween 20 was added, which was 70.8 U / mL.

[0329] 5.2.10 Fermentation Time Optimization

[0330] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L, sterilized at 121℃ for 20 min, dispensed into 30 mL bottles. According to 1×10 [units / items] per bottle... 7 A total of [number] spores were inoculated into the fermentation medium and cultured at 30℃ and 180 rpm for different times: 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, and 7 days. The xylanase activity was measured at each culture time, and the results are as follows: Figure 30 .

[0331] Figure 30 The figure shows the effect of fermentation time on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0332] from Figure 30 It is known that the xylanase activity was highest when the fermentation time was 2 days, with a maximum activity of 70.9 U / mL. As the culture time increased, the xylanase activity showed a decreasing trend, which may be due to the strain producing proteases in the later stages of fermentation, which degraded the xylanase produced during fermentation.

[0333] 5.2.11 Optimization of Surfactant Concentration

[0334] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L, sterilized at 121℃ for 20 min, dispensed into 30 mL bottles. Tween 20 was added to the culture medium as a surfactant, adjusted to concentrations of 0.25, 0.5, 0.75, 1.0, 1.5, and 2.0 g / L. Administer 1×10⁻⁶ g / L per bottle.7 Inoculate 100 spores into the fermentation medium and incubate at 30°C and 180 rpm for 4 days. Then, measure the xylanase activity. The results are as follows: Figure 31 .

[0335] Figure 31 The figure shows the effect of Tween-20 concentration on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0336] Depend on Figure 31 It can be seen that when the addition amount is 0.75 g / L, the xylanase produced by Aspergillus tabingensis HNZY02 has the highest enzyme activity. At lower concentrations, the improvement on the cell membrane of the strain is limited, while at higher concentrations, it may cause cell membrane damage. At both of these concentrations, the xylanase produced by this strain has low activity.

[0337] 5.2.12 Optimization of culture temperature

[0338] Corn husks (2040 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L, sterilized at 121℃ for 20 min, and dispensed into 30 mL bottles. The culture temperatures were adjusted to 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃, with a rotation speed of 180 rpm for 4 days. Xylanase activity was then measured, and the results are as follows: Figure 32 .

[0339] Figure 32 The figure shows the effect of temperature on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0340] Depend on Figure 32 It was observed that the xylanase activity fluctuated within the temperature range of 30-50℃ as the fermentation temperature increased. The xylanase activity reached its highest value at 40℃, followed by a decrease at 25℃. To verify these results, the experiment was repeated, and the trend remained consistent: enzyme activity gradually decreased within the 25-30℃ range, while it gradually increased within the 30-40℃ range, reaching its maximum value at 40℃. This may be due to differences in the optimal growth temperature of the strain and the temperature required for enzyme expression.

[0341] 5.2.13 Speed ​​Optimization

[0342] Corn husks (20-40 mesh) 30.0 g / L, tryptone 7.09 g / L, CaCl2 0.3 g / L, KH2PO4 0.6 g / L, MgSO4•7H2O 0.3 g / L, FeSO4 0.3 g / L, sterilized at 121℃ for 20 min, dispensed into 30 mL bottles. Shaking speeds were adjusted to 120 rpm, 140 rpm, 160 rpm, 180 rpm, and 200 rpm, with an incubation temperature of 30℃ for 4 days. Xylanase activity was then measured, and the results are as follows: Figure 33 .

[0343] Figure 33 The figure shows the effect of rotation speed on the xylanase activity of Aspergillus tabingensis HNZY02 in an embodiment of the present invention.

[0344] Depend on Figure 33 It can be seen that when the rotation speed is between 140 and 160 rpm, the xylanase activity can reach a relatively high level.

[0345] 5.3 PB Test

[0346] Based on the results of the single-factor optimization experiment, eight factors were selected to design the PB experiment: temperature (A), nitrogen source concentration (B), surfactant concentration (C), initial pH (D), rotation speed (E), carbon source concentration (F), inoculum size (G), and fermentation days (H). The factors that significantly affect xylanase activity were determined through the PB experiment.

[0347] Based on the single-factor experimental design, the PB experiment was conducted, and the results are shown in Tables 18 and 19. As can be seen from the tables, the xylanase activity produced by Aspergillus tabbinensis HNZY02 showed significant differences under different combinations of factor levels. Among them, the xylanase activity was the highest at the 13th level, reaching 88.4 U / mL.

[0348] Table 18 Factor Levels and Statistical Analysis of Experimental Design

[0349]

[0350] Table 19 Partial Regression Coefficients and Significance Test Analysis of the PB Experimental Model

[0351]

[0352] Figure 34 This is a Pareto chart of the standardized effects of the PB experiment in an embodiment of the present invention.

[0353] Depend on Figure 34It can be seen that there are four significant factors: temperature (A), nitrogen source concentration (B), surfactant concentration (C), and pH (D). The regression equation is: C13 = 25.1-0.0019×E-0.0592×F-0.000000×G+0.449×A-0.346×H+0.432×B+2.046×D-8.52×C.

[0354] 5.4 Climbing Test

[0355] Based on the PB experiment results, four significant factors—temperature, nitrogen source concentration, surfactant concentration, and pH—were selected for the scaling experiment. For less significant culture conditions, the optimal concentrations determined in the single-factor optimization were used. The direction of movement for each factor was determined based on the PB experiment results. The step size for each factor was determined based on the single-factor experiment results, the PB experiment results, and practical operational experience.

[0356] Based on the four significant factors and regression equations mentioned above, a ramp-up experiment was designed, and the results are shown in Table 20. As can be seen from the table, enzyme activity increases with the increase of the experimental combination sequence number. Under the conditions of the third experimental combination, xylanase activity was the highest, at 91.5 U / mL. Therefore, this combination was selected as the central combination for subsequent response surface methodology optimization.

[0357] Table 20. Experimental Design and Results for the Steepest Climb

[0358]

[0359] 5.5 Response Surface Experiment

[0360] Based on the central value determined from the climbing experiment, three factors—temperature, nitrogen source concentration, and surfactant concentration—were selected to design a response surface methodology. The experimental design and enzyme activity assay results are shown in Table 21.

[0361] Table 21 Response Surface Experimental Design and Results

[0362]

[0363] The difference analysis of the response surface methodology results (Table 22) shows that temperature and nitrogen source concentration have a significant linear effect on the xylanase activity of *Aspergillus tabineum* HNZY02, while surfactant concentration does not have a significant linear effect. Furthermore, there is no significant interaction among these three factors. Temperature exhibits a significant surface effect on the xylanase activity of *Aspergillus tabineum* HNZY02. The simulated regression equation and three-dimensional plot (…) Figures 35A to 35C )as follows:

[0364] Enzyme activity = -7011 + 323.6 × A + 53.0 × B - 180 × C - 3.797 × A2 -1.614×B 2 +79.1×C 2 -0.317×AB + 0.66×AC - 6.02×BC.

[0365] Figures 35A to 35C This is a three-dimensional response surface plot showing the effect of interactions between different factors on the xylanase activity of Aspergillus tabineus HNZY02 in an embodiment of the present invention. Figure 35A This is a surface plot showing the effect of temperature and nitrogen source concentration on enzyme activity. Figure 35B This is a surface plot showing the effect of temperature and surfactant concentration on enzyme activity. Figure 35C This is a surface plot showing the effects of nitrogen source concentration and surfactant concentration on enzyme activity.

[0366] Depend on Figure 35A It is evident that there is a significant interaction between temperature and nitrogen source concentration. The ridge-like morphology of the response surface indicates that the two factors need to be synergistically regulated to achieve optimal enzyme activity: when the level of one factor changes, the optimal level of the other factor also needs to be adjusted accordingly. The significant change in surface slope indicates that enzyme activity is quite sensitive to changes in these two factors.

[0367] As shown in Figure 35B, there is a very strong interaction between temperature and surfactant concentration. The addition of surfactant significantly affects cell membrane permeability, thereby amplifying the regulatory effect of temperature on cell metabolism and enzyme production efficiency. The steep slope of the response surface indicates that enzyme activity is extremely sensitive to changes in this combination; even slight deviations in conditions can lead to a significant decrease in enzyme activity.

[0368] Depend on Figure 35C It is known that there is a moderate interaction between nitrogen source concentration and surfactant concentration. Surfactants may indirectly regulate enzyme production by affecting nitrogen source uptake efficiency, but the synergistic effect between the two is weaker than that of the first two factors.

[0369] Table 22. Analysis of Significant Differences in Response Surface Methodology Experiment Results

[0370]

[0371] After response optimization, the results showed that the xylanase activity produced by Aspergillus tabingensis was highest when the fermentation temperature was 42.1℃, the nitrogen source concentration was 13.7g / L, and the surfactant concentration was 0.75g / L. Under these conditions, the xylanase activity could reach 115.56U / mL. Therefore, the experiment was conducted under these conditions, and the measured xylanase activity was 115.23U / mL, which was not much different from the predicted value.

[0372] Example 6 Study on the enzymatic properties of xylanase

[0373] 6.1 Optimal pH of xylanase

[0374] The xylanase activity of the crude enzyme solution produced by *Aspergillus tabingensis* HNZY02 was determined under pH conditions of 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, and 10.0. The highest enzyme activity was defined as 100%, and the relative enzyme activities under different conditions were calculated. The results are shown in […]. Figure 36 .

[0375] Figure 36 This is a graph showing the optimal pH results for xylanase produced by Aspergillus tabingensis HNZY02 as determined in an embodiment of the present invention.

[0376] Depend on Figure 36 It can be seen that the xylanase activity reaches its maximum at pH 5.0, and the enzyme activity is greatly reduced in excessively acidic (pH=2.0-4.0) and excessively alkaline (pH=8.0-10.0) conditions.

[0377] 6.2 pH stability of xylanase

[0378] Xylanase was incubated at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, and 10.0 at 25°C for 30 min. After incubation, it was transferred to ice and placed for 30 min. Then, its enzyme activity was measured at the optimal pH. Untreated enzyme activity was defined as 100%, and residual enzyme activity was calculated. The results are shown below. Figure 37 .

[0379] Figure 37 The figure shows the pH stability results of xylanase produced by Aspergillus tabingensis HNZY02 as determined in an embodiment of the present invention.

[0380] Depend on Figure 37 It was found that the residual enzyme activity of xylanase was highest in the pH range of 4.5-7.0, with the highest residual enzyme activity at pH 5.0, indicating that the enzyme is stable within this pH range. At pH values ​​below 4.5 or above 7.0, the enzyme activity of xylanase showed a decreasing trend, and at pH values ​​below 2.5, the relative enzyme activity of xylanase decreased to below 20%. This indicates that these pH conditions are unfavorable for maintaining xylanase activity.

[0381] 6.3 Optimal Temperature

[0382] The changes in xylanase activity at different temperatures (20, 25, 30, 35, 40, 45, 50, 55, 60, 65, and 70 °C) were measured to determine the optimal temperature for xylanase activity. The results are as follows: Figure 38 .

[0383] Figure 38 The figure shows the optimal temperature results for xylanase produced by Aspergillus tabingensis HNZY02 as determined in an embodiment of the present invention.

[0384] Depend on Figure 38 It is known that the xylanase produced by Aspergillus tabingensis HNZY02 has the highest enzyme activity at 55℃, and relatively high enzyme activity at 45-60℃. At lower temperatures, molecular motion is slow, the probability of enzyme contact with substrate is low, and enzyme activity decreases. At excessively high temperatures, the high temperature destroys the spatial structure of the enzyme, causing irreversible changes in the active site of the enzyme, and enzyme activity decreases.

[0385] 6.4 Temperature stability

[0386] Xylanase solutions were incubated at 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, and 70 °C for 30 min each, then placed on ice for 30 min. Enzyme activity was then measured at the optimum temperature. Untreated enzyme activity was defined as 100%, and residual enzyme activity was calculated. The results are shown below. Figure 39 .

[0387] Figure 39 The graph shows the temperature stability results of xylanase produced by Aspergillus tabineum HNZY02 as determined in an embodiment of the present invention.

[0388] Depend on Figure 39 It can be seen that the enzyme activity is above 80% when the temperature is below 50℃, indicating that the enzyme is relatively stable at this temperature. However, at higher temperatures, the residual enzyme activity decreases significantly, and high temperatures lead to enzyme denaturation and inactivation.

[0389] Application Example 1: Evaluation of the degradation effect of Aspergillus tabine on tobacco stems

[0390] 1.1 Pretreatment of tobacco stems

[0391] Accurately weigh 10g of tobacco stem sample and place it in a 2L stoppered conical flask. Pretreatment is performed using a stepwise extraction method: add 1L of preheated distilled water (80±0.5℃) and extract at a constant temperature with shaking (120 rpm) for 1 hour. Add an equal volume of preheated distilled water and transfer to a constant temperature water bath shaker (80±0.5℃) for further extraction for 30 minutes. Separate the solid and liquid phases using a vacuum filtration device. Discard the extract and transfer the solid residue to an electrically heated forced-air drying oven at 105℃ to constant weight to obtain the pretreated tobacco stem matrix, which is then stored in a desiccator for later use.

[0392] 1.2 In vitro enzymatic hydrolysis of tobacco stems

[0393] Accurately weigh the appropriate mass of pretreated tobacco stem samples into 50 mL Erlenmeyer flasks. Calculate the amount of enzyme solution to add based on enzyme activity, and add 50 mmol / L pH 5.0 citrate-sodium citrate buffer to a material-to-liquid ratio of 1:30. The following experimental groups were set up: blank control (buffer solution replaced enzyme solution); xylanase-based (44 U / mL cellulase, 50 U / mL xylanase); cellulase-based (50 U / mL cellulase, 31 U / mL xylanase); and dual-enzyme synergistic (50 U / mL cellulase, 50 U / mL xylanase). All samples were enzymatically hydrolyzed for 5 h in a constant temperature water bath shaker at 50℃ and 120 rpm. After hydrolysis, the Erlenmeyer flasks were removed and filtered. 1 mL of the hydrolysate was boiled in water for 15 min to inactivate the enzyme, and the reducing sugar content in the hydrolysate was determined. The filter residue was dried in an oven to constant weight for subsequent determination of cellulose, hemicellulose, and lignin content. The results are shown in Table 23 below.

[0394] Table 23. Effects of in vitro enzymatic hydrolysis of tobacco stems

[0395]

[0396] Table 23 shows that the contents of cellulose, hemicellulose, and lignin in tobacco stems decreased to varying degrees after enzymatic hydrolysis with different proportions of xylanase and cellulase. When xylanase was the primary enzyme, the degradation rates of cellulose, hemicellulose, and lignin in tobacco stems were 21.8%, 28.3%, and 22.2%, respectively. After cellulase was the primary enzyme, the degradation rates were 54.5%, 17.0%, and 36.5%, respectively. When cellulase and xylanase were used in equal proportions, the degradation rates reached 57.7%, 51.9%, and 50.8%, respectively. This indicates that *Aspergillus tabineus* has a good effect on degrading tobacco stems, especially with the synergistic effect of the two enzymes in equal proportions. Furthermore, since no purification treatment was performed, a small amount of other enzymes may have also been involved in the hydrolysis process.

[0397] 1.3 In-situ fermentation degradation experiment

[0398] The sole carbon source in the optimized culture medium formula was replaced with tobacco stem filtrate. Then, Aspergillus tabingensis strain was inoculated into the culture medium at the optimal inoculation amount and fermented under optimal conditions to produce enzymes and degrade enzymes. The culture was carried out at 40℃ and 140rpm in a constant temperature shaker for 10 days. After the culture was completed, the culture medium was filtered, and the pH value and reducing sugar content of the fermentation broth before and after fermentation were measured. The filter residue was dried in an oven to constant weight and used for subsequent determination of cellulose, hemicellulose and lignin content. The results are shown in Table 24 below.

[0399] Table 24 Changes in composition of culture medium after Aspergillus tabingensis fermentation of tobacco stems

[0400]

[0401] Table 24 shows that using tobacco stems to replace the sole carbon source in the culture medium inhibits enzyme production by the strain. After fermentation under these conditions, the activities of xylanase and cellulase produced by the strain were reduced (37.8 U / mL and 81.7 U / mL, respectively), especially xylanase. Furthermore, the reduction sugar content in the fermented medium decreased after fermentation (from 14.7% to 8.0%), indicating that the strain requires reducing sugars as nutrients. Subsequent measurements of cellulose, hemicellulose, and lignin showed significant degradation, with reductions of 78.6%, 68.8%, and 54.1%, respectively, demonstrating a clear degradation effect.

[0402] This invention successfully screened and obtained a strain of *Aspergillus tabingensis* HNZY02, which can efficiently produce cellulase and xylanase. After optimization of the fermentation process, its enzyme production capacity was significantly improved. In the application of tobacco stem degradation, the degradation rates of cellulose, hemicellulose, and lignin reached 57.7%, 51.9%, and 50.8%, respectively, when the two enzymes were treated in equal proportions. Even under the inhibitory conditions where tobacco stem was the sole carbon source, the degradation rates of the three components were still as high as 78.6%, 68.8%, and 54.1%, respectively. The results of this invention provide an innovative solution for the efficient biodegradation and resource utilization of tobacco stems. It not only achieves the deep conversion of tobacco stem components and the efficient enrichment of reducing sugars, but also effectively reduces the release of harmful substances during cigarette combustion, improving the safety of cigarette smoking. This technology provides strong support for the environmental upgrading of the tobacco processing industry and shows broad industrial application prospects in the field of biomass resource utilization.

[0403] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of Aspergillus tubingensis HNZY02, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 42148.

2. An application of Aspergillus tabineum as described in claim 1, characterized in that, Includes at least one of the following: (1) Production of carboxymethyl cellulase; (2) Production of β-glucosidase; (3) Production of xylanase; (4) Production of filter paper enzyme system.

3. An application of Aspergillus tabineum as described in claim 1, characterized in that, Includes at least one of the following: (1) Degradation of cellulose; (2) Degradation of lignin; (3) Degradation of hemicellulose; (4) Increase the reducing sugar content in tobacco stems; (5) Reduce the content of nicotine, tar and carbon monoxide during the combustion process of cigarettes; (6) Improve the safety of cigarette smoking.

4. A method for producing enzymes, characterized in that, The steps include inoculating the Aspergillus tubingensis HNZY02 of claim 1 into a culture medium, culturing it, and then collecting the enzyme products; The enzyme product includes at least one of carboxymethyl cellulase, β-glucosidase, or xylanase.

5. The method according to claim 4, characterized in that, The culture medium meets at least one of the following conditions: (1) The initial pH of the culture medium is 4 to 6; (2) The culture medium contains 4~11 g / L of surfactant; (3) The culture medium includes a surfactant, which includes at least one of glycerol or Tween-40; (4) The culture medium contains 1~15 g / L of peptone.

6. The method according to claim 4, characterized in that, At least one of the following conditions must be met: (1) The incubation period is 3 to 5 days; (2) The culture temperature is 30℃~35℃.

7. A method for degrading cellulose in tobacco stems, characterized in that, The step includes inoculating the Aspergillus tubingensis HNZY02 of claim 1 into tobacco stems for culture.

8. A composition, characterized in that, The composition contains Aspergillus tubingensis HNZY02 as described in claim 1.

9. The composition according to claim 8, characterized in that, The composition is a microbial agent.

10. A culture, characterized in that, Includes Aspergillus tubingensis HNZY02 as described in claim 1 and a culture medium, said culture medium comprising K2HPO4, peptone, Tween-40, KNO3, MgSO4, CaCl2 and NaCl.