KRAS mutant colorectal cancer treatment target and application thereof

By targeting and blocking the phosphorylation of the TRIP6 S147 site peptide and the CD44 K158 lactated CAR-T cells, the immunotherapy resistance problem of KRAS-mutant colorectal cancer was solved, the anti-tumor effect of PD-1 blockade therapy was improved, and the anti-tumor function of CD8+ T cells was enhanced.

CN121731447BActive Publication Date: 2026-05-19SUZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SUZHOU UNIV
Filing Date
2026-02-13
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current technologies lack effective therapeutic targets for KRAS-mutant colorectal cancer, especially the problem of immunotherapy resistance caused by KRAS mutations.

Method used

A peptide was discovered and targeted to block the phosphorylation of TRIP6 at S147. Combined with an immune checkpoint inhibitor, CAR-T cells were prepared that target and block CD44 K158 lactation, reversing abnormal glycolysis driven by KRAS mutation and enhancing the anti-tumor immune function of CD8+ T cells.

Benefits of technology

It significantly improved the anti-tumor efficacy of PD-1 blockade therapy, enhanced the anti-tumor immune function of CD8+ T cells, and provided an effective treatment option for KRAS-mutant colorectal cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121731447B_ABST
    Figure CN121731447B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of KRAS Mutant colorectal cancer treatment target and its application belong to the field of biological medicine technology.The polypeptide for targeting blocking TRIP6 S147 site phosphorylation is designed in the present application, it is found that the polypeptide can reverse KRAS Abnormal glycolysis driven by mutation, it is proved that blocking TRIP6 S147 site phosphorylation is feasible in KRAS Mutant colorectal cancer treatment.The polypeptide is combined with immune checkpoint inhibitor, can significantly improve the antitumor efficacy of PD-1 blocking therapy.The present application also finds, KRAS Mutant colorectal cancer promotes lactic acid production by inducing TRIP6 phosphorylation and then enhances CD44 lactation, ultimately inhibits CD8 + T cell antitumor immune function, based on this, the CAR-T cell for targeting blocking CD44 K158 lactation is prepared, also has good antitumor effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a kind of KRAS Therapeutic targets and applications of mutant colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is a highly prevalent and deadliest malignant tumor worldwide. Its development involves multiple complex factors, including genetic variations, epigenetic dysregulation, and dynamic remodeling of the tumor microenvironment (TME). Despite continuous advancements in traditional therapies such as surgery, radiotherapy, chemotherapy, and targeted therapy, the five-year survival rate remains unsatisfactory for patients with advanced disease, especially those with metastasis. Therefore, there is an urgent need for more effective treatment strategies in clinical practice.

[0003] Tumor-infiltrating lymphocytes (TILs), especially CD8 + The number and functional status of T cells have been confirmed by multiple studies to be significantly associated with improved prognosis in CRC patients. However, in the majority of microsatellite stable (MSS) patients, tumors can still progress even with some degree of T cell infiltration, indicating that endogenous immune responses are often insufficient to effectively control the tumor. Immune checkpoint blockade therapy (ICB) targeting the programmed death protein-1 and its ligand-1 (PD-1 / PD-L1) pathway has achieved breakthroughs in some tumors, but its application in CRC is limited: except for a few patients with high microsatellite instability (MSI-H) or mismatch repair deficiency (dMMR), the vast majority of microsatellite stable (MSS) or pMMR patients do not respond well to ICB. Notably, this subtype is often accompanied by KRAS gene mutations ( KRAS Currently, there is still a lack of effective immunotherapy strategies for patients with MT (metastatic leukemia).

[0004] In recent years, Kersten rat sarcoma ( KRAS Gene mutations have been proven to be a key driver of colorectal cancer progression and immunotherapy resistance, and are associated with CD8+ in the tumor microenvironment. + Decreased T-cell infiltration is significantly associated with resistance to PD-1 / PD-L1 inhibitor therapy. However, KRAS The specific molecular mechanisms by which mutations suppress T cell function and drive immune escape through downstream signaling pathways are not yet fully understood. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the lack of an effective solution in the prior art. KRAS The question of therapeutic targets for mutant colorectal cancer.

[0006] To solve the above-mentioned technical problems, the present invention provides a KRASTherapeutic targets for mutant colorectal cancer and their applications. This invention first discovered... KRAS In mutant colorectal cancer, the expression of thyroid hormone receptor-interacting protein 6 (TRIP6) is upregulated, and further findings reveal... KRAS Mutations lead to significantly enhanced phosphorylation at the S147 site of TRIP6. To verify this finding, this invention designed a peptide that targets and blocks phosphorylation at the S147 site of TRIP6. It was found that this peptide can reverse TRIP6 phosphorylation by targeting and inhibiting it. KRAS Mutation-driven aberrant glycolysis demonstrates that blocking TRIP6 S147 phosphorylation... KRAS Feasibility of this treatment for mutant colorectal cancer. Further, combining a peptide that targets and blocks the phosphorylation of TRIP6 at site S147 with an immune checkpoint inhibitor significantly improves the antitumor efficacy of PD-1 blockade therapy. In addition, this invention further discovered in the research that… KRAS Mutant colorectal cancer promotes lactate production by inducing TRIP6 phosphorylation, thereby enhancing CD44 lactation and ultimately inhibiting CD8. + Based on the anti-tumor immune function of T cells, this invention prepared CAR-T cells that target and block CD44 K158 lactation, which also have good anti-tumor effects.

[0007] The first objective of this invention is to provide a substance that reduces the phosphorylation level at position 147 of thyroid hormone receptor interacting protein 6 in the preparation of... KRAS Application in products for the treatment or diagnosis of gene-mutant colorectal cancer, wherein the substance targets and reduces the phosphorylation level of serine at position 147 of thyroid hormone receptor interacting protein 6.

[0008] Furthermore, the NCBI number of the thyroid hormone receptor interacting protein 6 is NP_003293.2.

[0009] Furthermore, the substance that reduces the phosphorylation level of TRIP6 S147 includes a polypeptide with an amino acid sequence as shown in SEQ ID NO. 1.

[0010] Furthermore, SEQ ID NO.1: YGRKKRRQRRRAPMLPASHYGGP.

[0011] Furthermore, the aforementioned KRAS Mutant colorectal cancer includes KRAS G12D type colorectal cancer, KRAS G12V type colorectal cancer or KRAS G12C type colorectal cancer. Among them, KRAS G12D type colorectal cancer is KRASColorectal cancer caused by a mutation in the glycine (G) to aspartic acid (D) codon 12 of the gene. KRAS G12V type colorectal cancer is KRAS Colorectal cancer caused by a mutation in the glycine (G) to valine (V) codon 12 of the gene. KRAS G12C type colorectal cancer is KRAS Colorectal cancer caused by a mutation in the 12th codon of the gene, where glycine (G) is changed to cysteine ​​(C).

[0012] Furthermore, the aforementioned KRAS Treatment products for mutant colorectal cancer also include immune checkpoint inhibitors.

[0013] Furthermore, the immune checkpoint inhibitor includes an anti-PD-1 antibody.

[0014] The second object of the present invention is to provide KRAS Drugs for the treatment of mutant colorectal cancer, the aforementioned KRAS Drugs used to treat mutant colorectal cancer reduce the phosphorylation level of serine at position 147 of thyroid hormone receptor interacting protein 6.

[0015] Furthermore, the aforementioned KRAS Mutant colorectal cancer treatment drugs mutate the serine residue at position 147 of thyroid hormone receptor interactor protein 6 to a non-phosphorylated amino acid, wherein the non-phosphorylated amino acid includes alanine or phenylalanine.

[0016] Furthermore, the aforementioned KRAS Drugs for treating mutant colorectal cancer also include immune checkpoint inhibitors.

[0017] A third objective of this invention is to provide a reagent for inhibiting lactation at position 158 of cell adhesion factor 44 in the preparation of... KRAS Application in the treatment of mutant colorectal cancer, wherein the reagent that inhibits lactation at position 158 of cell adhesion factor 44 targets and inhibits lactation of lysine at position 158 of cell adhesion factor 44.

[0018] Furthermore, the NCBI number of the cell adhesion factor 44 is NP_000601.3.

[0019] Furthermore, the reagent that inhibits lactation at position 158 of cell adhesion factor 44 mutates lysine at position 158 of cell adhesion factor 44 to arginine.

[0020] A fourth objective of this invention is to provide a chimeric antigen receptor T cell in which the lysine residue at position 158 of the endogenous cell adhesion factor 44 is mutated to arginine.

[0021] Furthermore, the chimeric antigen receptor T cells are prepared by the following method:

[0022] S1, providing donor T cells;

[0023] S2. Using gene editing tools, the 158th lysine codon of the cell adhesion factor 44 gene of the donor T cells was mutated to an arginine codon to obtain mutant T cells.

[0024] S3. The nucleic acid sequence encoding the chimeric antigen receptor is introduced into the mutant T cell to obtain the chimeric antigen receptor T cell.

[0025] Furthermore, the nucleic acid sequence encoding the chimeric antigen receptor is located on the commercially available pHi-HV01-EF1α-CD19 CAR lentiviral plasmid.

[0026] The fifth objective of this invention is to provide a method for preparing the above-mentioned chimeric antigen receptor T cells. KRAS Application in the treatment of mutant colorectal cancer.

[0027] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0028] This invention has discovered a new KRAS Therapeutic targets for mutant colorectal cancer have been identified, and products designed targeting these targets have shown efficacy. KRAS This invention demonstrates good therapeutic efficacy in the treatment of mutant colorectal cancer. Specifically, the present invention designs a polypeptide that targets and blocks phosphorylation at the S147 site of TRIP6. It has been found that this polypeptide can reverse TRIP6 phosphorylation by targeting and inhibiting it. KRAS Mutation-driven aberrant glycolysis demonstrates that blocking TRIP6 S147 phosphorylation... KRAS Feasibility of this treatment for mutant colorectal cancer. Further, combining a peptide that targets and blocks the phosphorylation of TRIP6 at S147 with an immune checkpoint inhibitor significantly improves the antitumor efficacy of PD-1 blockade therapy. In addition, this invention prepared CAR-T cells that target and block CD44 K158 lactation, which also exhibited good antitumor effects. Attached Figure Description

[0029] Figure 1 TRIP6 was analyzed based on proteomics and single-cell sequencing. KRAS Differential expression in wild-type and mutant colorectal cancer and its relationship with CD8 + The validation results of T cell infiltration correlation are shown in the figure, where n represents the sample size, and the same applies below;

[0030] Figure 2 yes KRASThe figure shows the validation results of how the / G12D mutation promotes phosphorylation of TRIP6 protein at S147 in RKO cells. Figure 2 In B, Ph represents phosphorylation;

[0031] Figure 3 This is based on the results of validating the conserved phosphorylation sites of TRIP6 and their clinical prognostic relevance in multiple models using specific phosphorylation antibodies.

[0032] Figure 4 yes Trip6 S151A In knock-in mouse models, loss of TRIP6 phosphorylation inhibits tumor growth and enhances CD8. + The results of T cell anti-tumor immune function;

[0033] Figure 5 yes KRAS A diagram showing the results of mutations promoting tumor lactate production and the regulation of this process by TRIP6 phosphorylation.

[0034] Figure 6 Is it for identifying CD8? + Multi-model validation results of CD44 protein lactation modification on T cell surface and its conserved sites;

[0035] Figure 7 yes Cd44 K163R Knock-in mouse model to verify the effect of CD44 lactation on CD8 + The result of T cell function suppression;

[0036] Figure 8 The in vitro inhibition of TRIP6 phosphorylation inhibitory peptide PT6 is achieved by... KRAS Validation results of mutation-induced TRIP6 phosphorylation and metabolic reprogramming;

[0037] Figure 9 It is mPT6 peptide in Apc Min / + ; Kras G12D ; Tp53 + / - In a mouse model, it inhibited tumor growth and enhanced CD8. + Validation results of T cell function and reduction of CD44 lactation;

[0038] Figure 10 It is the combination of mPT6 peptide and anti-PD-1 antibody in Apc Min / + ; Kras G12D ; Tp53 + / - Validation results of synergistic enhancement of tumor suppression and T cell immune response in mouse models;

[0039] Figure 11 yes Cd44 K163R The results showed that mouse-derived CAR-T cells enhanced antitumor activity and improved function in the MC38-hCD19 solid tumor model. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0041] The clinical samples involved in the following examples are shown in Table 1. This study included clinicopathological information from 27 patients with colorectal cancer (CRC). The collection of human tissue samples in this study strictly adhered to the ethical principles outlined in the Declaration of Helsinki. Primary tumor tissue samples from the 27 colorectal cancer patients were obtained from the Second Affiliated Hospital of Soochow University. All study participants signed written informed consent forms, and this study protocol has been approved by the Biomedical Research Ethics Committee of Soochow University, thus possessing a legitimate ethical basis.

[0042] Table 1 shows the clinicopathological characteristics of 27 patients with colorectal cancer.

[0043]

[0044] The mutants involved in the following examples are shown in Table 2.

[0045] Table 2. Description of Mutants

[0046]

[0047] The meanings of the English terms used in the following embodiments are shown in Table 3.

[0048] Table 3 English Meanings

[0049]

[0050] Example 1: Differential expression of TRIP6 based on proteomics and single-cell sequencing

[0051] To clarify KRAS Wild type and KRAS The mechanisms of different immunophenotypes in mutant colorectal cancer were investigated in 14 cases. KRAS Wild-type colorectal cancer (abbreviated as "wild-type colorectal cancer") KRAS Wild type) and 13 cases KRAS Mutant colorectal cancer (referred to as "mutant colorectal cancer") KRAS Quantitative proteomics analysis was performed on the mutant samples (Table 1). Figure 1A). A total of 11,594 proteins were quantified in all samples, among which thyroid hormone receptor interacting protein 6 (TRIP6) was found in A). KRAS The expression was most significantly upregulated in mutant colorectal cancer. Figure 1 (B in the middle).

[0052] To further elucidate the functional relevance of TRIP6 in the tumor immune microenvironment, this embodiment analyzed single-cell RNA sequencing data from the tumor core and invasive margin of colorectal cancer patients (data source: GSE132465, GSE144735). The results showed that... KRAS In tumors of wild-type colorectal cancer patients, the expression level of TRIP6 in epithelial cells is correlated with intratumoral cytotoxic CD8. + The number of infiltrating T cells was positively correlated with ( Figure 1 (C in the text). However, this association is in... KRAS No such mutations were observed in the tumors of patients with colorectal cancer. Figure 1 (D in the text). The above results indicate that TRIP6 plays a role in regulating the immune microenvironment of colorectal cancer. KRAS Mutation state dependence.

[0053] Example 2: TRIP6 in KRAS Phosphorylation modification and its clinical relevance in mutant colorectal cancer

[0054] (1) KRAS Verification of the regulatory effect of mutations on TRIP6 protein in human colorectal cancer cell lines

[0055] KRAS Construction of the G12D mutant colon cancer cell model: The pCMV-Myc empty vector (pCMV plasmid containing only the Myc tag, product catalog number 631604) was used as a control to construct the Myc-... KRAS / G12D plasmid (containing Myc tag and KRAS The plasmid of the / G12D mutant, i.e., overexpression KRAS The / G12D gene was transfected and cultured into human colon cancer cells (RKO cells).

[0056] Immunoprecipitation (IP) was performed using an anti-TRIP6 antibody (catalog number: BETHYL A300865A), and Western blotting (WB) was used to detect TRIP6 phosphorylation levels using an anti-phosphorylated serine or threonine antibody (anti-phosphorylated Ser / Thr antibody, catalog number: BD 612548). Results showed that overexpression... KRAS In / G12D RKO cells, the phosphorylation level of TRIP6 is upregulated, but the protein expression of TRIP6 is not affected. Figure 2 (A in the middle).

[0057] Mass spectrometry was used to analyze Myc- transfected cells. KRAS Analysis of RKO cells containing the / G12D plasmid, through identification and quantification of TRIP6 phosphorylation levels, further identified that serine (S) at position 147 of TRIP6 is... KRAS The major phosphorylation site promoted by the mutation ( Figure 2 In B), the peak intensity was used to quantify the S147 phosphorylation level of TRIP6. KRAS Phosphorylation at this site is significantly enhanced when / G12D is overexpressed. Figure 2 (C in the middle).

[0058] For human and rodent sources TRIP6 The amino acid sequence was compared, and it was found to be effective in mice. Trip6 The homologous site in it is S151 ( Figure 2 (D in the middle).

[0059] (2) Kras Verification of the regulatory effect of mutations on TRIP6 protein in murine colorectal cancer cell lines

[0060] Experimental materials: Kras / G12D plasmid (containing Myc tag and Kras / G12D mutant plasmid), Flag-m Trip6 / WT plasmid (containing Flag tag and wild-type mouse source) Trip6 plasmids), Flag-m Trip6 / S151A plasmid (containing Flag tag and mouse source) Trip6 The mutant plasmid, of which the mouse source Trip6 Mutants are mouse-derived... Trip6 The serine residue at position 151 was mutated to alanine. MC38 cells (mouse colorectal cancer cells) were divided into four groups: the first group was transfected with Flag-m Trip6 / WT plasmid, second transfection group Kras / G12D plasmid and Flag-m Trip6 / WT plasmid, third group transfected with Flag-m Trip6 / S151A plasmid, fourth transfection group Kras / G12D plasmid and Flag-m Trip6 / S151A plasmid.

[0061] Four groups of MC38 cells were immunoprecipitated with anti-Flag tag antibody, and then Western blot analysis was performed using anti-phosphorylated Ser / Thr antibody to determine the phosphorylation status of TRIP6. Results are as follows: Figure 2 As shown in E, the S151 site mutation significantly inhibited exogenous... Kras / G12D-induced TRIP6 phosphorylation, demonstrating that in Kras In the context of mutation (i.e. containing Myc- Kras / G12D plasmid), mouse Trip6 Serine 151 (S151) was identified as a key phosphorylation site.

[0062] (3) The phosphorylation site of TRIP6 S147 is different in different KRAS The prevalence of mutant colorectal cancer

[0063] To verify the phosphorylation of TRIP6 in KRAS Given the prevalence of mutant colorectal cancer, this example also prepared specific phosphorylated antibodies against human TRIP6 p-S147 and mouse TRIP6 p-S151. The specificity of the human p-TRIP6 (S147) antibody and the mouse p-TRIP6 (S151) antibody was verified by dot hybridization. The p-TRIP6 (S147) and p-TRIP6 (S151) antibodies were obtained using a peptide immunization method: rabbits were immunized with the human TRIP6 phosphorylated S147 site peptide (Ac-Cys-SPLPA(pS)PYGGPT-NH2) and the mouse TRIP6 phosphorylated S151 site peptide (Ac-Cys-TPMLPA(pS)HYGGPT-NH2), respectively (peptides synthesized by Beijing Yiqiao Shenzhou Technology Co., Ltd.). The antiserum was collected and purified by affinity to obtain the specific antibodies p-TRIP6 (S147) and p-TRIP6 (S151). The verification results are as follows... Figure 3 As shown in A in the diagram.

[0064] Construct empty vector plasmids (pCMV-Myc, pCMV plasmids containing only the Myc tag), Myc- KRAS / G12D plasmid (containing Myc tag and KRAS / G12D mutant plasmid), Myc- KRAS / G12V plasmid (containing Myc tag and KRAS / G12V mutant plasmid) and Myc- KRAS / G12C plasmid (containing Myc tag and KRAS The plasmids of the / G12C mutant were transfected into RKO cells and cultured.

[0065] Immunoblot analysis was performed using p-TRIP6 (S147) antibody. Immunoblot analysis showed that p-TRIP6 (S147) was detectable in RKO cells, and in cells containing... KRAS / G12D、 KRAS / G12V and KRASThis modification is present in RKO cells of the / G12C mutant. Figure 3 (B) indicates that it contains different... KRAS Increased phosphorylation levels at the TRIP6 S147 site were detected in all mutant (G12D, G12V, G12C) RKO cells. Figure 3 (B in the text) indicates that the modification is KRAS Common downstream events of carcinogenic signals.

[0066] To verify the detection efficacy of p-TRIP6 S151 antibody at the level of mouse colon organoids, a method was constructed. Apc Min / + ; Kras WT ; Tp53 + / - Mice served as the control group (a gift from Professor Qin Jun of the Chinese Academy of Sciences (Shanghai)). Apc Min / + ; Kras G12D ; Tp53 + / - Mice (a gift from Professor Qin Jun of the Chinese Academy of Sciences (Shanghai)) were used to isolate colon tumor tissue for organoid culture.

[0067] Immunofluorescence detection was performed on the obtained organoids. Specifically, mature cultured organoids were collected, fixed with 4% paraformaldehyde, permeabilized with 0.2% polyethylene glycol octylphenyl ether (Triton X-100), and blocked. They were then incubated overnight at 4°C with p-TRIP6 (S151) specific primary antibody (1:100 dilution), followed by labeling with Cy3 (anthocyanin 3)-labeled secondary antibody, and counterstained with DAPI in the nuclei. Imaging was performed using laser confocal fluorescence microscopy, and the fluorescence signal intensity was further quantitatively analyzed using ImageJ software.

[0068] The results are as follows Figure 3 As shown in C. From Apc Min / + ; Kras G12D ; Tp53 + / - The phosphorylation level of TRIP6S151 site in the colonic organoids of mice was significantly higher than that in the control group.

[0069] (4) KRAS Regulation of TRIP6 phosphorylation sites by signaling

[0070] use Kras Treatment with the G12D inhibitor MRTX1133 (0.5 μM, CAS number 2621928-55-8) Apc Min / + ; Kras G12D ; Tp53 + / - Tumor-derived epithelial cells from mice were used as the experimental group and treated with PBS. Apc Min / + ; Kras G12D ; Tp53 + / - Tumor-derived epithelial cells from mice were used as a control group, and immunoblotting analysis was performed using p-TRIP6 (S151) antibody. Results are as follows... Figure 3 As shown in D, using Kras Treatment with the G12D-specific inhibitor MRTX1133 can reduce Apc Min / + ; Kras G12D ; Tp53 + / - p-TRIP6 (S151) level in mouse small intestinal tumor epithelial cells Figure 3 (D in the text) further proves Kras The signal directly regulates the S151 phosphorylation of TRIP6.

[0071] Using p-TRIP6 (S147) antibody, respectively, samples from the First Affiliated Hospital of Soochow University were analyzed. KRAS wild type ( KRAS / WT) and KRAS mutant ( KRAS Immunohistochemical staining was performed on intestinal tissue from 89 patients with colorectal cancer (MT), and expression levels were compared using box plots. Results are as follows: Figure 3 As shown in E, KRAS The expression of p-TRIP6 (S147) in mutant colorectal cancer tissues was significantly higher than that in the control group.

[0072] To assess the clinical prognostic significance of p-TRIP6 (S147) expression, this embodiment utilized a colorectal cancer tissue microarray. Immunohistochemistry was used to detect the phosphorylation level of the TRIP6 S147 site in patient tumor tissue (tissue microarray purchased from Shanghai Chipchao Biotechnology Co., Ltd.). Based on the detection results, a median was calculated. Patients with values ​​greater than the median were classified as the p-TRIP6 (S147) high-expression group, and those with values ​​less than the median were classified as the p-TRIP6 (S147) low-expression group. Survival analysis was further performed using the Kaplan-Meier method to compare the survival differences between the p-TRIP6 (S147) high-expression group and the p-TRIP6 (S147) low-expression group. Results are as follows: Figure 3 As shown in F, the survival rate of the p-TRIP6 (S147) low expression group was significantly improved ( Figure 3The F in the figure indicates that phosphorylation of TRIP6 S147 is detrimental to patient survival.

[0073] The above results indicate that TRIP6 S147 phosphorylation is KRAS Mutation-driven specific molecular events, and are expected to become KRAS Novel prognostic biomarkers for mutant colorectal cancer ( Figure 3 (G in the middle).

[0074] Example 3: In vivo functional verification of TRIP6 S151 phosphorylation driving tumorigenesis and inhibiting antitumor immunity.

[0075] To elucidate the crucial role of TRIP6 phosphorylation in tumorigenesis and the tumor immune microenvironment, this embodiment first constructs... Trip6 The S mutation at position 151 is replaced by a phosphorylation defective gene of A. Trip6 S151A Knock-in mice and compare them with Apc Min / + ; Kras G12D ; Tp53 + / - Mice mate ( Figure 4 (A and B in the sample), thereby specifically blocking phosphorylation modification at this site in vivo.

[0076] Trip6 S151A Knock-in mice were created by Cyagen Biosciences using the CRISPR-Cas9 gene-editing tool, which uses clustered regularly spaced short palindromic repeats (CRISPR-Cas9) for gene editing. The mice were co-injected with targeted molecules. Trip6 gRNA of genes, carriers Trip6 S151A The donor DNA and Cas9 protein of the (TCC→GCC) mutant were incorporated into fertilized eggs of C57BL / 6J mice (gRNA (SEQ ID NO.4) and donor DNA sequence (SEQ ID NO.5) are shown in Table 4). The F0 generation was identified by PCR and sequencing (the forward primer used for identification was CTTGGGTCTGGCTTTACTGTTTC (SEQ ID NO.6), and the reverse primer was AGTTACTTCCGGTGACCACAAAC (SEQ ID NO.7)). The identification results are as follows: Figure 4 As shown in A. F0 generation heterozygotes are mated to obtain F1 generation. Trip6 S151A Knock-in mice.

[0077] Table 4 Trip6 S151A CRISPR-Cas9 editing sequence knocked into mice

[0078]

[0079] F1 generation Trip6 S151A Knock-in mice and Apc Min / + ; Kras G12D ; Tp53 + / - Mice mate to obtain Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A Mice were used as the experimental group. Trip6 WT mice and Apc Min / + ; Kras G12D ; Tp53 + / - Mice mate to obtain Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 WT Mice served as the control group.

[0080] Will Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A mice and Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 WT Intestinal tumors in mice were stained, and the phosphorylation signal of TRIP6 in the tumor tissue was detected using a p-TRIP6 (S151) antibody. The results are as follows: Figure 4 As shown in C and D. In Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A The intestinal tumor burden in mice was significantly reduced compared to the control group. Figure 4In the C), and the phosphorylation signal of TRIP6 in the tumor tissue completely disappeared ( Figure 4 (D in the middle).

[0081] Flow cytometry was used to analyze the functional status of tumor-infiltrating cytotoxic T cells (CD8⁺ T cells), including CD8⁺ T cells. + T cell percentage, Ki67 positivity rate (a nuclear proliferation marker), and depleted PD-1 + TIM-3 + CD8 + The proportion of T cells and the expression levels of tumor necrosis factor-α (TNFα) and granzyme B (GzmB) in tumor tissue. Further analysis of the tumor immune microenvironment revealed that... Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A CD8 in mouse tumors + The level of T cell infiltration was significantly increased ( Figure 4 E in the middle). For infiltrating CD8 + Functional analysis of T cells showed an increased proportion of Ki67 positivity ( Figure 4 (F in the middle); depletion type PD-1 + TIM-3 + CD8 + The proportion of T cells decreased ( Figure 4 In addition, the expression levels of effector molecules TNFα and GzmB were significantly upregulated (G); Figure 4 (H in the text). These results indicate that phosphorylation at the TRIP6 S151 site promotes tumor growth in vivo and inhibits anti-tumor CD8. + T cell function. Furthermore, this example also investigated the effect of TRIP6 S142 site phosphorylation on… KRAS The impact of mutant colorectal cancer was investigated, and it was found that the S142 phosphorylation site of mutant TRIP6 did not reduce TRIP6 phosphorylation. KRAS The mutation can still promote the phosphorylation of TRIP6 at the S142 site.

[0082] Example 4: KRAS Analysis of the Regulation of Tumor Lactic Acid Metabolism by Mutation and TRIP6 Phosphorylation

[0083] Metabolic reprogramming is KRAS A key characteristic driving tumors, typically manifested as the "Warburg effect," leads to a significant accumulation of lactic acid in the tumor microenvironment. To clarify... KRASThis embodiment systematically analyzes the effects of mutations on lactate metabolism and their association with TRIP6 phosphorylation, presenting relevant models.

[0084] Construct the pCMV-Myc plasmid (a pCMV plasmid containing only the Myc tag). Kras / G12D plasmid, Kras / G12V plasmid and Kras The / G12C plasmid was used to divide MC38 tumor cells into four groups: Group 1: transfected with pCMV-Myc plasmid; Group 2: transfected with G12C plasmid; Group 3: transfected with pCMV-Myc plasmid; Group 4: transfected with pCMV-Myc plasmid; Group 5: transfected with pCMV-Myc plasmid; Group 6: transfected with pCMV-Myc plas Kras / G12D plasmid; Group 3: Transfection Kras / G12V plasmid, group 4: transfection Kras / G12C plasmid. Then, four groups of MC38 tumor cells were injected subcutaneously into C57BL / 6J mice (each group injected 2×10⁻⁶ cells). 6 (1 cell), to obtain a subcutaneous tumor model, until the tumor volume is close to but less than 1500 mm. 3 An autopsy was performed to obtain tumor tissue.

[0085] Tumor stromal fluid (TIF) separation: Freshly excised tumor tissue was washed with phosphate-buffered saline (PBS) and the surface liquid was aspirated before being placed on a 20 μm nylon filter attached to a 5 mL centrifuge tube. The tube was centrifuged at 600 × g for 10 minutes at 4°C. The liquid collected at the bottom of the centrifuge tube was the tumor stromal fluid (TIF). The obtained TIF was flash-frozen in liquid nitrogen and stored at -80°C for subsequent analysis.

[0086] L-lactic acid levels in the tumor stroma fluid (TIF) of C57BL / 6 mice were detected by an enzyme colorimetric assay using an L-lactic acid assay kit (Abcam, catalog number: ab65331). The results are as follows: Figure 5 In contrast, A in MC38 cells transfected with an empty vector showed increased expression of... Kras Lactate levels in the tumor stroma fluid (TIF) of MC38 tumors from mutants (G12D, G12V, or G12C) were significantly elevated. Figure 5 A in the middle) confirms Kras Mutations can promote lactate production in tumors.

[0087] Comparison using enzyme colorimetric method Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A mice and Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 WT Lactate levels in mouse colon tumor tissue. Experimental results are as follows: Figure 5 As shown in B, Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A Lactate levels in colon tumor tissue of mice were higher than those in mice. Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 WT Mice significantly reduced ( Figure 5 (B in the middle).

[0088] The above results indicate that Kras Mutations can promote lactate production in colon tumors, and this process may depend on phosphorylation modification at the TRIP6S151 site.

[0089] Example 5: Lactic acid on CD8 + Regulatory analysis of CD44 protein lactation modification on T cell surface

[0090] based on Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A The decreased lactate production in mouse models suggests that lactate in the tumor microenvironment may affect CD8 through lactation modification. + T cell function. To verify this hypothesis, this example studies human CD8 cells co-cultured with human colorectal cancer cells (RKO cells). + T cells were subjected to lactic acidification proteomics analysis, with CD8 cells co-cultured with RKO cells as an example. + T cells were used as the experimental group, with untreated CD8 cells. + Using T cells as a control group, several membrane proteins that underwent significant lactation modification after co-culture were identified, with CD44 showing the most significant lactation modification (Table 5).

[0091] Table 5 Results of lactic acidified proteomics analysis

[0092]

[0093] Note: Modified sequence and lysine (K) lactation modification probability: refers to the statistical confidence of the lactated peptide sequence and its corresponding lysine site. "1" is short for lactation, and "(l)" indicates that lactation modification has occurred at this site. Upregulated fold change: the logarithmic transformation of the ratio of modified peptide expression levels between the experimental and control groups; an increase indicates a significant upregulation of the modification level. Posterior error probability: the estimated error probability of peptide-spectrum matching; the lower the value, the more reliable the identification result. Score: the confidence score of the identification result; a higher score usually indicates a better matching quality.

[0094] Based on single-cell RNA sequencing data from 29 colorectal cancer tissues (data sources: GSE132465, GSE144735), bubble diagrams were used to illustrate the results. Figure 6 (A) and histogram ( Figure 6 B) shows tumor infiltration CD8 + Cell adhesion molecule 44 (CD44), also known as cell adhesion molecule 44, transmembrane glycoprotein Basigin (BSG), and ATPase Na+ are found in T cells. + / K + Expression characteristics of transport subunit A1 (ATP1A1), integrin subunit B1 (ITGB1), and cyclin and CBS domain divalent metal cation transporter mediator 3 (CNNM3) were analyzed. Bubble size indicates the proportion of cells expressing the protein, and color represents the average expression level. Experimental results are shown below. Figure 6 As shown in A and B, in tumor-infiltrating CD8 + In T cells, the expression level of CD44 is significantly higher than that of other identified lactic acidified membrane proteins.

[0095] To clarify the molecular basis of CD44 lactation, mass spectrometry analysis identified a conserved lactation site, lysine 158 (K158), in the extracellular domain of CD44. Figure 6 (C and D in the text). Building the Flag- CD44 / WT plasmid (containing Flag tag and wild type) CD44 plasmids encoding genes), constructing Flag- CD44 / K158R plasmid (containing Flag tag and CD44 The mutant plasmid, in which CD44 Mutants refer to CD44 The lysine (K) at position 158 was mutated to arginine (R), and then transfected into RKO cells. Immunoblotting analysis of whole-cell lysates of the RKO cells was performed using pan-lactation antibody (Pan-Kla, from PTM BIO, catalog number: PTM-1401RM) and anti-Flag antibody. This confirmed a significant decrease in lactation levels at position K158. Figure 6 The E in the sample was identified as the primary modification site.

[0096] Based on this, this embodiment prepared specific lactated antibodies against human CD44 K158la and mouse homologous sites CD44 K163la. The specificity of the human CD44 (K158la) antibody and the mouse CD44 (K163la) antibody was verified by dot hybridization experiments. The CD44 (K158la) antibody and the CD44 (K163la) antibody were prepared using a synthetic peptide immunoassay: rabbits were immunized with the human CD44 lactated K158 site modified peptide DGTRYVQ(Klac)GEYRT-Cys and the mouse CD44 lactated K163 site modified peptide TRYSK(Klac)GEYRTHQ-Cys (peptides synthesized by Hangzhou Jingjie Biotechnology Co., Ltd.), respectively. Antiserum was collected and purified by affinity to obtain the specific antibodies CD44 (K158la) and CD44 (K163la). Dot hybridization experiments confirmed their good specificity. Figure 6 (F in the middle).

[0097] Construct empty vector plasmids (containing only Myc tags), Myc- Kras / G12D plasmid (containing Myc tag and Kras / G12D mutant plasmid), Myc- Kras / G12V plasmid (containing Myc tag and Kras / G12V mutant plasmid) and Myc- Kras / G12C plasmid (containing Myc tag and Kras The plasmids for the / G12C mutant were transfected into MC38 tumor cells and cultured. Then, the four groups of MC38 tumor cells were injected subcutaneously into C57BL / 6J mice (each group receiving 2 × 10⁻⁶ cells). 6 (1 cell), to obtain a subcutaneous tumor model, until the tumor volume is close to but less than 1500 mm. 3 Dissection was performed, tumor tissue was collected, and tumor interstitial fluid (TIF) was obtained. CD8+ cells from the spleen of C57BL / 6 mice were then analyzed. + T cells were co-cultured with the isolated tumor stroma fluid, and mouse CD8 were detected by Western blotting. + Expression level of CD44 (K163la) in T cells.

[0098] The results are as follows Figure 6 As shown in G, it expresses Kras Tumor stromal fluid (TIF) secreted by mutant MC38 tumor cells can significantly promote CD8 in vitro. + Lactation modification of CD44 in T cells.

[0099] The above results show that KRAS Lactate derived from mutated tumors can directly induce CD8. + Lactic acidification modification of CD44 protein on the surface of T cells.

[0100] Example 6: CD44 lactation on CD8 + Validation analysis of T cell function suppression

[0101] To clarify the role of CD44 lactation modification in CD8 + The direct function of T cells, as described in this embodiment, is constructed... Cd44 K163R Lactation site knock-in mouse model ( Figure 7 (A) Based on CRISPR-Cas9 gene editing construction. Cd44 K163R knock-in mice ( Cd44 K163R Mice). Cd44 K163R The mice were obtained by Cyagen Biosciences through co-injection of targeted drugs into the fertilized eggs of C57BL / 6J mice. Cd44 The gRNA of the gene (SEQ ID NO.8), carrying Cd44 K163R The gene was constructed using donor DNA (SEQ ID NO. 9) with an (AAG→AGA) mutation and Cas9 protein (gRNA and donor DNA sequences are shown in Table 6). The F0 generation was identified by PCR and sequencing (forward primer: CCTCATTTCTAGAGTATGTGGGTG (SEQ ID NO. 10); reverse primer: TCTGTCAAAGAACTGCTAGAGGAAA (SEQ ID NO. 11)). The F0 generation was then mated with wild-type mice to complete germline transfer, resulting in the F1 generation knock-in mice. Cd44 K163R Mice. Cd44 Unmutated wild-type mice ( Cd44 WT ( ) as a comparison.

[0102] Table 6 Cd44 K163R CRISPR-Cas9 editing sequence knocked into mice

[0103]

[0104] From respectively Cd44 WT and Cd44 K163R CD8 isolated from mouse spleen +T cells were then activated in vitro by adding differentiation cluster 3 (CD3), co-stimulatory molecules expressed on the surface of T lymphocytes (CD28), and interleukin-2 (IL-2). After activation, they were co-cultured with lactated or untreated MC38 cells. Figure 7 (B in the middle).

[0105] Immunoblot analysis was performed using CD44 (K163la) antibody, and the results are as follows: Figure 7 As shown in C, the K163R mutation effectively blocked lactate-induced CD44 lactation modification, confirming the reliability of this genetic model.

[0106] CD8+ in the co-culture system was detected using flow cytometry. + Ki67 positivity, a marker of nuclear proliferation in T cells (Ki67) + CD8 + T cell ratio, granzyme B positivity (GzmB) + CD8 + T cell ratio, interferon-γ positive (IFNγ) + CD8 + The proportion of T cells. Results are as follows: Figure 7 As shown in D and E, lactic acid treatment significantly inhibited Cd44 WT CD8 source + The proliferative capacity of T cells was manifested by a decrease in the proportion of Ki67 positive cells. Figure 7 (D in the text); at the same time, its effector function is also inhibited, as evidenced by decreased expression of GzmB and IFNγ (in the text). Figure 7 In contrast, E). Cd44 K163R CD8 source + T cells did not respond significantly to lactate treatment, demonstrating that lactation at the K163 site of CD44 mediates the inhibitory effect of lactate on T cell function.

[0107] In addition, separate testing Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 WT mice and Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A CD8 in mice + CD44 lactation level in T cells, in CD8 +In T cell subsets, the expression level of CD44 (K163la) was detected using an anti-CD44 antibody against the K163la clone, and quantified by geometric mean fluorescence intensity (gMFI). Results are as follows: Figure 7 As shown in F, Apc Min / + ; Kras G12D ; Tp53 + / - ; Trip6 S151A In mice, tumor-infiltrating CD8 + The level of CD44 lactation on T cells was also significantly reduced, further demonstrating... KRAS Mutant colorectal cancer promotes lactate production by inducing TRIP6 phosphorylation, thereby enhancing CD44 lactation and ultimately inhibiting CD8. + Regulatory mechanisms of T cell anti-tumor immune function.

[0108] Example 7: Design and functional validation analysis of peptides targeting TRIP6 phosphorylation sites

[0109] This embodiment infers that blocking TRIP6 phosphorylation modification may help restore... KRAS T-cell immune function in mutant colorectal cancer. To verify this hypothesis, two peptides targeting conserved phosphorylation sites of TRIP6 were designed and synthesized: a murine TRIP6 peptide (mPT6) and a human TRIP6 peptide (hPT6), and a negative control peptide (PC) was also included. The sequences are shown in Table 7. All peptides with a purity ≥98% were synthesized and provided by Shanghai Jier Biochemical Co., Ltd., and the peptides used in in vivo experiments were all composed of D-amino acids. For in vitro studies, the peptides were dissolved in PBS to prepare a 5 mg / mL stock solution; before in vivo administration, the peptides were dissolved in PBS and stored on ice, and then brought to room temperature before injection.

[0110] Table 7. Sequences of peptides targeting conserved phosphorylation sites of TRIP6 and negative control peptides.

[0111]

[0112] hPT6 and mPT6 were added to RKO cells and MC38 cells, respectively, and stained with fluorescein isothiocyanate (FITC) and 4',6-diamidinyl-2-phenylindole (DAPI). Confocal microscopy showed that both hPT6 and mPT6 could efficiently enter RKO cells and MC38 cells. Figure 8 (B in the middle).

[0113] Build Myc- KRAS / G12D plasmid (containing Myc tag and KRASThe plasmid containing the / G12D mutant was transfected into human RKO cells and cultured. The transfected RKO cells were divided into four groups: Group 1: human RKO cells; Group 2: transfected RKO cells without treatment; Group 3: transfected RKO cells treated with PC peptide; Group 4: transfected RKO cells treated with hPT6 peptide. After culturing the four groups of cells for 12 hours, Western blotting was performed using the p-TRIP6 (S147) antibody prepared in Example 2. The results are as follows... Figure 8 As shown in C, hPT6 peptide treatment significantly inhibited TRIP6 phosphorylation, while PC peptide did not show this effect. After culturing the four groups of cells for 36 hours, the cell culture supernatant was collected for enzyme colorimetric analysis. Then, the cell supernatant was extracted, and the relative lactate level in the supernatant was detected. The results are shown in Figure C. Figure 8 As shown in E, hPT6 can effectively inhibit KRAS / G12D-induced metabolic reprogramming reduces intracellular lactate production.

[0114] Build Myc- Kras / G12D plasmid (containing Myc tag and Kras The plasmid containing the / G12D mutant was transfected into mouse MC38 cells and cultured. The transfected MC38 cells were divided into four groups: Group 1: mouse MC38 cells; Group 2: transfected MC38 cells without treatment; Group 3: transfected MC38 cells treated with PC peptide (5 μg / mL); Group 4: transfected MC38 cells treated with mPT6 peptide (5 μg / mL). All four groups of cells were cultured for 12 hours. Immunoblotting was performed using the p-TRIP6 (S151) antibody prepared in Example 2, and the results are as follows... Figure 8 As shown in D, mPT6 treatment significantly inhibited TRIP6 phosphorylation, while PC did not show this effect. After culturing the four groups of cells for 36 hours, the cell culture supernatant was collected for enzyme colorimetric analysis. Then, the cell supernatant was extracted, and the relative lactate level in the supernatant was detected. The results are shown in Figure D. Figure 8 As shown in F, mPT6 can effectively inhibit Kras / G12D-induced metabolic reprogramming reduces intracellular lactate production.

[0115] The above results indicate that the hPT6 / mPT6 peptide can reverse TRIP6 phosphorylation by targeting and inhibiting it. KRAS Mutation-driven aberrant glycolysis.

[0116] Example 8: Reversal of immunosuppression in vivo by targeting TRIP6 phosphorylated peptides

[0117] To further evaluate the in vivo therapeutic potential of the PT6 peptide, this embodiment delivers mPT6 via intraperitoneal injection. Apc Min / + ; Kras G12D ; Tp53 + / - In mice, the therapeutic effect of mPT6 was observed. PC was delivered via intraperitoneal injection. Apc Min / + ; Kras G12D ; Tp53 + / - Mice served as the control group.

[0118] right Apc Min / + ; Kras G12D ; Tp53 + / - Frozen sections of mouse colon tissue were stained with fluorescein isothiocyanate (FITC) and 4',6-diamidinyl-2-phenylindole (DAPI). The staining revealed that mPT6 was effectively enriched in tumor tissue. Figure 9 (A in the middle).

[0119] Apc Min / + ; Kras G12D ; Tp53 + / - Mouse colon tissue sections were stained with hematoxylin and eosin (H&E), and the area of ​​colon tumors was quantitatively analyzed. The results showed that mPT6 monotherapy significantly inhibited tumor growth. Figure 9 (B and C in the text).

[0120] Mouse colon tissue was dissociated and digested to prepare a single-cell suspension, which was then analyzed by flow cytometry. CD45-positive leukocytes were further screened to obtain a mature T-cell population for analysis. Results are as follows: Figure 9 As shown in D, mPT6 monotherapy enhanced CD8 in mouse tumor tissue. + T cell function, manifested as CD8 + Increased T cell infiltration ( Figure 9 In D), the expression of the effector molecule GzmB is increased ( Figure 9 (E in the middle), and depleted PD-1 + TIM-3 + CD8 + T cell reduction ( Figure 9 (F in the middle).

[0121] In addition, flow cytometry analysis was used to analyze CD8 +The expression level of CD44 (K163la) in the T cell population (quantified using geometric mean fluorescence intensity gMFI) results are as follows: Figure 9 As shown in G, mPT6 treatment also reduced CD8. + The level of CD44 lactation on T cells.

[0122] Example 9: Combination therapy of mPT6 and anti-PD-1 antibody

[0123] Eight-week-old Apc Min / + ; Kras G12D ; Tp53 + / - Mice were divided into four groups: PC group, mPT6 group, PC + anti-PD-1 antibody group, and mPT6 + anti-PD-1 antibody group. They were treated according to the treatment methods shown in Table 8. The anti-programmed cell death protein-1 antibody (anti-PD-1 antibody) was obtained from Selleck, catalog number A2122.

[0124] Table 8 Treatment methods

[0125]

[0126] The results are as follows Figure 10 As shown, the combination of mPT6 and anti-PD-1 antibody has a stronger tumor-suppressive effect than single-agent therapy. Figure 10 (AC in the middle), and can further promote CD8 + T cell infiltration and effector function Figure 10 (D and E in the above). The above results collectively indicate that the mPT6 peptide targeting TRIP6 phosphorylation can enhance... Kras CD8 in mutant colorectal cancer + It enhances the function of T cells and significantly improves the anti-tumor efficacy of PD-1 blockade therapy.

[0127] Example 10: Functional validation analysis of CAR-T cells targeting CD44 lactation sites against solid tumors

[0128] Addressing the limitation of CAR-T therapy in solid tumor treatment due to the suppression of T cell function by the tumor microenvironment, this embodiment explores the effect of blocking CD44 lactation on improving CAR-T cell function, based on the regulatory role of CD44 lactation in immunosuppression. While chimeric antigen receptor T-cell therapy has shown significant efficacy in hematologic malignancies, its application in solid tumors remains limited by T-cell dysfunction induced by the tumor microenvironment. To clarify whether blocking CD44 lactation can enhance the efficacy of CAR-T cell therapy, this embodiment investigates the effect of blocking CD44 lactation on improving CAR-T cell function from the perspectives of tumor microenvironment and T-cell function regulation. Cd44 WT and Cd44 K163RCAR-T cells targeting MC38-hCD19 tumors were prepared in mice, and their antitumor activity in this model was systematically evaluated. Figure 11 (A in the middle).

[0129] The process for preparing CAR-T cells targeting MC38-hCD19 tumors is as follows:

[0130] In CAR-T tumor model research, with Cd44 WT and Cd44 K163R Mice (background: C57BL / 6 mice, expressing CD45.2) + Using wild-type C57BL / 6 mice (background C57BL / 6 mice expressing CD45.1) as donor mice, and wild-type C57BL / 6 mice (background C57BL / 6 mice expressing CD45.1) were used as donor mice. + The recipient mice were MC38-hCD19 mouse colorectal cancer cells.

[0131] MC38-hCD19 mouse colorectal cancer cells were cultured and expanded. Subsequently, MC38-hCD19 mouse colorectal cancer cells (2×10⁻⁶) were... 6 (One dose) was subcutaneously injected into the right subcutaneous tissue of 7-8 week old recipient mice. When the tumor was palpable in the recipient mouse, activation was achieved from... Cd44 WT and Cd44 K163R Initial CD8 isolated from donor mice + T cells were transduced using lentiviral particles (Hillgene, Suzhou, China) carrying a pHi-HV01-EF1α-CD19 CAR to generate CAR-T cells, which were then expanded in vitro.

[0132] Eight days after injection of MC38-hCD19 into colorectal cancer cells, the recipient mice were tumor-bearing mice (tumor volume approximately 50-100 mm). 3 CAR-T cells expanded in vitro were collected, washed with PBS, and resuspended in sterile PBS. They were then administered via tail vein injection (1×10⁻⁶ cells / mL). 6 200 μL of PBS (1 cell / 200 μL) was injected into tumor-bearing mice. The control group was injected with the same amount of PBS.

[0133] The results showed that, compared with Cd44 WT Compared to CAR-T cells, Cd44 K163R CAR-T cell therapy significantly inhibited tumor growth and reduced tumor burden in mice. Figure 11 (B and C in CD8). Further functional analysis showed that in all CD8... +Within the T cell population, cells expressing the CD45.2 allele (CD45.2 from donor-derived mice) + The percentage of cells. Cd44 K163R CAR-T cells have enhanced infiltration capacity in tumor tissues. Figure 11 The effector function of CD8 was significantly enhanced, manifested as positive tumor necrosis factor-α (TNF-α) and GzmB-positive CD8. + The proportion of T cells increased ( Figure 11 (E in the middle), while depleted PD-1 + TIM-3 + CD8 + The proportion of T cells decreased ( Figure 11 (F in the middle).

[0134] The above results indicate that blocking CD44 lactation can effectively improve the infiltration and function of chimeric antigen receptor T cells (CAR-T cells) in the solid tumor microenvironment, providing an experimental basis for the development of a new generation of CAR-T therapies for solid tumors.

[0135] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. Substances that reduce the phosphorylation level at position 147 of thyroid hormone receptor interacting protein 6 in the preparation of KRAS Its application in products for the treatment of mutant colorectal cancer is characterized by, The substance that reduces the phosphorylation level of thyroid hormone receptor interacting protein 6 at position 147 includes a polypeptide with the amino acid sequence shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The KRAS Mutant colorectal cancer includes KRAS G12D type colorectal cancer, KRAS G12V type colorectal cancer or KRAS G12C type colorectal cancer.

3. The application according to claim 1, characterized in that, The KRAS Treatment products for mutant colorectal cancer also include immune checkpoint inhibitors.

4. A kind KRAS A drug for treating mutant colorectal cancer, characterized in that, The KRAS Drugs used to treat mutant colorectal cancer reduce the phosphorylation level of serine at position 147 of thyroid hormone receptor-interacting protein 6. KRAS Drugs for treating mutant colorectal cancer include polypeptides with amino acid sequences as shown in SEQ ID NO.

1.

5. The method according to claim 4 KRAS A drug for treating mutant colorectal cancer, characterized in that, The drugs for treating colorectal cancer also include immune checkpoint inhibitors.