Composition for colorectal cancer MRD detection and recurrence monitoring and application thereof
By detecting the methylation status of GFRA1 and DOK6 genes, the lack of objectivity in colorectal cancer prognosis prediction and recurrence monitoring has been addressed, achieving sensitive and specific detection of colorectal cancer and improving the accuracy of recurrence monitoring and individualized treatment guidance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-03-27
AI Technical Summary
Current technologies for prognostic prediction and recurrence monitoring in colorectal cancer rely on traditional staging systems and empirical examinations, which lack objectivity and individualization, making it difficult to accurately identify high-risk groups for recurrence, leading to undertreatment or overtreatment. Furthermore, existing ctDNA gene mutation analysis is insufficient and cannot effectively monitor early recurrence.
The methylation status of GFRA1 and DOK6 genes was detected by converting unmethylated cytosine to uracil through bisulfite treatment. The methylation status of ctDNA in plasma was then detected by combining DNA polymerase and specific primers and probes, enabling MRD detection and recurrence monitoring of colorectal cancer.
It achieves sensitive and specific detection of colorectal cancer, enabling early warning of recurrence and improving the accuracy of colorectal cancer prognosis and recurrence monitoring, as well as individualized treatment guidance.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of molecular biology and relates to gene detection, specifically to a nucleic acid composition for methylation of genes related to MRD detection and recurrence monitoring in colorectal cancer, as well as the corresponding kit and its uses. Background Technology
[0002] Colorectal cancer is one of the most common malignant tumors of the digestive system. Data from the National Cancer Center in 2024 shows that it ranks second in incidence among malignant tumors, with nearly 240,000 deaths annually. Treatment for colorectal cancer includes endoscopic and surgical resection, radiotherapy and chemotherapy, extensive surgery for local and metastatic disease, targeted therapy, and immunotherapy. However, the risk of postoperative recurrence remains a key challenge: for patients with stage III or high-risk stage II disease, adjuvant chemotherapy is routinely administered after surgical resection. There is ample evidence that patients with stage III colorectal cancer can benefit from adjuvant chemotherapy, but the advantage of adjuvant chemotherapy for stage II patients remains controversial. Therefore, accurately identifying and stratifying high-risk populations for recurrence is crucial for optimizing treatment decisions and monitoring strategies.
[0003] Currently, clinical prognostic prediction for colorectal cancer mainly relies on the TNM staging system developed by the American Journal of Cancer (AJCC), traditionally believed that higher stages indicate a worse prognosis. However, studies have found that some stage IIIa patients may have better prognoses than stage II patients. Intra-staging variability due to tumor heterogeneity (such as depth of invasion, pathological type, number of lymph node metastases, etc.), i.e., inconsistent clinical outcomes among patients at the same stage, may lead to undertreatment or overtreatment. Furthermore, recurrence monitoring primarily relies on physicians' empirical judgment of clinical examinations, blood tests (such as carcinoembryonic antigen CEA), and imaging results, which still has limitations in terms of objectivity, accuracy, and individualized prediction. There is an urgent need to explore novel biomarkers to improve the accuracy of colorectal cancer prognosis and recurrence monitoring.
[0004] Studies have shown that circulating tumor DNA (ctDNA) plays a crucial role in the occurrence, progression, and recurrence of colorectal cancer. However, most current research focuses on gene mutation analysis of ctDNA, while exploration at the epigenetic level (such as methylation) remains insufficient. DNA methylation, as an early tumor event, exhibits tissue specificity and stability, making it suitable for non-invasive detection. Multigene methylation detection offers advantages in recurrence risk stratification, adjuvant therapy guidance, and recurrence early warning, and can provide early warning of recurrence. Summary of the Invention
[0005] This application provides a composition, a kit, and uses thereof for MRD detection and recurrence monitoring of colorectal cancer, a method for performing detection based on the kit, and uses thereof for MRD detection and recurrence monitoring of colorectal cancer.
[0006] Specifically, this application relates to the following: 1. A composition for in vitro MRD detection and recurrence monitoring of colorectal cancer, the composition comprising: nucleic acid for detecting the methylation status of a target gene; wherein the methylation status of the target gene is characterized by methylation of the target sequence of the target gene; wherein the target gene is the GFRA1 gene and / or the DOK6 gene.
[0007] 2. The composition according to claim 1, wherein the target sequence of the GFRA1 gene includes any sequence in SEQ ID NO: 1-4, or as shown in any sequence in SEQ ID NO: 1-4.
[0008] 3. The composition according to claim 1, wherein the target sequence of the DOK6 gene includes any of the sequences in SEQ ID NO: 5-8, or as shown in any of the sequences in SEQ ID NO: 5-8.
[0009] 4. The composition according to any one of claims 1 to 3, wherein the nucleic acid for detecting the methylation status of the target gene comprises: a primer, the primer being a fragment of at least 9 nucleotides of the target sequence of the target gene, the fragment containing at least one CpG dinucleotide sequence.
[0010] 5. The composition according to any one of claims 1 to 4, wherein the nucleic acid for detecting the methylation status of the target gene comprises: a probe, said probe being a fragment of at least 15 nucleotides hybridized to the target sequence of said target gene under moderately or strictly controlled conditions, said fragment containing at least one CpG dinucleotide sequence.
[0011] 6. The composition according to any one of items 1 to 5, further comprising: a reagent for converting the 5-position unmethylated cytosine base of the target gene target sequence into uracil.
[0012] 7. The composition according to item 6, wherein the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 9 and SEQ ID NO: 10, or a sequence of SEQ ID NO: 12 and SEQ ID NO: 13; The fragment of at least 15 nucleotides is either the sequence of SEQ ID NO: 11 or the sequence of SEQ ID NO: 14.
[0013] 8. An oligonucleotide for in vitro MRD detection and recurrence monitoring of colorectal cancer, comprising: A fragment comprising at least 9 nucleotides of any of the sequences in SEQ ID NO: 1-4 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or A fragment comprising at least nine nucleotides of any of the sequences in SEQ ID NO: 5-8 or their complementary sequences and containing at least one CpG dinucleotide sequence.
[0014] 9. The oligonucleotide according to item 8, further comprising: Fragments that hybridize to at least 15 nucleotides of any of the sequences in SEQ ID NO: 1-4 or their complementary sequences under moderately or strictly controlled conditions and contain at least one CpG dinucleotide sequence; and / or A fragment that hybridizes to at least 15 nucleotides of any of the sequences in SEQ ID NO: 5-8 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0015] 10. An oligonucleotide for in vitro MRD detection and recurrence monitoring of colorectal cancer, comprising: sequences of SEQ ID NO:9 and SEQ ID NO:10, and / or sequences of SEQ ID NO:12 and SEQ ID NO:13; or sequences as shown in SEQ ID NO:9 and SEQ ID NO:10, and / or sequences of SEQ ID NO:12 and SEQ ID NO:13.
[0016] 11. The oligonucleotide according to claim 10, further comprising: the sequence of SEQ ID NO: 11, and / or the sequence of SEQ ID NO: 14; or as shown in the sequence of SEQ ID NO: 11, and / or the sequence of SEQ ID NO: 14.
[0017] 12. Use of GFRA1 and / or DOK6 genes in the preparation of kits for in vitro MRD detection and recurrence monitoring of colorectal cancer.
[0018] 13. A kit comprising the composition of any one of items 1 to 7 or the oligonucleotide of any one of items 8 to 11.
[0019] 14. The kit according to claim 13, further comprising at least one other component selected from: Nucleoside triphosphate, DNA polymerase, and buffer solution required for the function of the DNA polymerase.
[0020] 15. The kit according to item 13 or 14 further comprises: instructions for use.
[0021] 16. Use of the composition according to any one of items 1 to 7 or the oligonucleotide according to any one of items 8 to 11 in the preparation of a kit for in vitro MRD detection and recurrence monitoring of colorectal cancer.
[0022] 17. The use according to item 12 or 16, wherein the kit for in vitro colorectal cancer MRD detection and recurrence monitoring is performed by a method comprising the steps of: 1) Isolate DNA samples containing the target gene sequence or fragments from the biological sample to be tested; 2) Determine the methylation status of the target sequence of the target gene; 3) The state of the biological sample is determined by the detection results of the methylation status of the target gene sequence, thereby realizing the in vitro detection of colorectal cancer.
[0023] 18. The use according to item 17, wherein the method comprises the following steps: Extract genomic DNA from the biological sample to be tested; The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases. The reagent-treated DNA sample is contacted with DNA polymerase and primers for the target sequence of the target gene, and a DNA polymerization reaction is carried out. Detection of amplification products using probes; and Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target gene target sequence is determined.
[0024] 19. The use according to item 18, wherein the reagent is a bisulfite reagent.
[0025] 20. A method for MRD detection and recurrence monitoring of colorectal cancer, comprising the following steps: Isolate DNA samples containing target gene sequences or fragments from biological samples to be tested; Determine the methylation status of the target sequence of the target gene; and The state of a biological sample is determined by detecting the methylation status of the target gene sequence, thereby enabling in vitro detection of colorectal cancer. The target gene is the GFRA1 gene and / or the DOK6 gene.
[0026] 21. A method for MRD detection and recurrence monitoring of colorectal cancer, comprising the following steps: Extract genomic DNA from the biological sample to be tested; The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases. The reagent-treated DNA sample is contacted with DNA polymerase and primers for the target sequence of the target gene, and a DNA polymerization reaction is carried out. Detection of amplification products using probes; and Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target gene target sequence is determined. The target gene is the GFRA1 gene and / or the DOK6 gene.
[0027] 22. The method according to item 20 or 21, wherein the target sequence of the GFRA1 gene is shown in any one of SEQ ID NO: 1-4.
[0028] 23. The method according to item 20 or 21, wherein the target sequence of the DOK6 gene is shown in any of SEQ ID NO: 5-8.
[0029] 24. The method according to item 21, wherein the reagent is a bisulfite reagent.
[0030] 25. The method according to item 21, wherein the primer is: A fragment comprising at least 9 nucleotides of any one of SEQ ID NO: 1-4 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or The fragment comprising at least 9 nucleotides of any one of SEQ ID NO: 5-8 or its complementary sequence and containing at least one CpG dinucleotide sequence.
[0031] 26. The method according to item 21, wherein the probe is: Fragments hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of any one of SEQ ID NO: 1-4 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or A fragment that hybridizes to at least 15 nucleotides of any one of SEQ ID NO: 5-8 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0032] 27. The method according to item 25, wherein the primers are sequences of SEQ ID NO: 9 and SEQ ID NO: 10, and / or sequences of SEQ ID NO: 12 and SEQ ID NO: 13.
[0033] 28. The method according to item 26, wherein the probe is the sequence of SEQ ID NO: 11 and / or the sequence of SEQ ID NO: 14.
[0034] The composition of this application can sensitively and specifically detect MRD ctDNA in plasma of colorectal cancer patients after treatment. The kit provided by this application has good sensitivity and specificity for colorectal cancer detection, and can be used conveniently, quickly, and effectively for MRD detection and recurrence monitoring of colorectal cancer.
[0035] This application has the following beneficial effects: By detecting the target sequences of one or both of the methylation genes in the GFRA1 and DOK6 genes (colorectal cancer methylation genes), the methylation status of these two genes can be sensitively and specifically detected, thus enabling in vitro detection of cell-free DNA in plasma and colorectal cancer MRD. Testing of plasma samples from colorectal cancer patients and healthy controls shows that the composition and detection method described in this application can sensitively and specifically detect colorectal cancer MRD and monitor recurrence, ensuring the accuracy and reliability of the results. Therefore, this application provides a composition and detection method for in vitro colorectal cancer MRD detection and recurrence monitoring, which has significant clinical application value.
[0036] Other features and advantages of this application will be described in detail in the following specific description and claims. Invention Details The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.
[0038] Unless otherwise specified, all reagents and materials used in this application are commercially available.
[0039] Unless otherwise stated, the implementation of this application will employ conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, all of which fall within the scope of conventional techniques in the art. Such techniques are described in detail in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (MJ Gait, 1984); *Animal Cell Culture* (RI Freshney, 1987); *Methods in Enzymology* (American Academic Publishing Co., Ltd.); *Current Protocols in Molecular Biology* (FMAusubel et al., 1987, and regularly updated); and *PCR: The Polymerase Chain Reaction* (Mullis et al., 1994). The primers, probes, and kits used in this application can be prepared using standard techniques known in the art.
[0040] Unless otherwise defined, the technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0041] definition MRD: Minimal residual disease refers to tumor cells or small lesions that remain in the body of cancer patients after treatment aimed at curative outcomes (such as surgery, radiotherapy, chemotherapy, or combined therapy). A positive MRD status is closely related to the risk of recurrence and poor prognosis, and has become an important biomarker for guiding postoperative adjuvant therapy, evaluating efficacy, and developing individualized follow-up plans.
[0042] BisDNA refers to genomic DNA that has undergone sulfite treatment (usually bisulfite). This treatment converts unmethylated cytosine (C) to uracil (U), while methylated 5-methylcytosine (5-mC) remains unchanged. Subsequently, during PCR or sequencing, U is replicated to thymine (T), resulting in a distinguishable C→T sequence difference, enabling quantitative or qualitative detection of DNA methylation status.
[0043] In this application, "stringent hybridization conditions" and "highly stringent" refer to the conditions under which the probe hybridizes with its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary under different environments. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Biochemistry and Molecular Biology Techniques – Nucleic Acid Probe Hybridization, “A Review of Hybridization Principles and Nucleic Acid Assay Strategies.” Typically, stringent conditions are approximately 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength and pH. At Tm (at the defined ionic strength, pH, and nucleic acid concentration), 50% of the probe complementary to the target sequence hybridizes uniformly with the target sequence. Stringent conditions can also be achieved by adding a destabilizing agent. For selective or specific hybridization, the positive signal is twice, preferably ten times, the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization at 42°C in a solution of 50% formamide, 5x SSC and 1% SDS, or hybridization at 65°C in a solution of 5x SSC and 1% SDS, followed by washing at 65°C in a solution of 0.2x SSC and 0.1% SDS.
[0044] Furthermore, if the peptides encoded by the nucleic acids are substantially similar, the nucleic acids that cannot hybridize under stringent conditions are still substantially similar. In this case, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, “moderately stringent hybridization conditions” include hybridization at 37°C in a solution of 40% formamide, 1M sodium chloride, and 1% SDS, followed by washing at 45°C in a solution of 1xSSC. Those skilled in the art will readily obtain guidance in the prior art for achieving conditions with the same stringency. For PCR, temperatures around 36°C are typically suitable for low-stringency amplification, while annealing temperatures range from 32°C to 48°C depending on primer length. For highly stringent PCR amplification, it is generally at 62°C, while annealing temperatures for highly stringent hybridization range from 50°C to 65°C depending on primer length and specificity. Typical cycling conditions for both high-strict and low-strict amplification include: a sustained denaturation phase of 30 seconds to 2 minutes at 90–95°C, a sustained annealing phase of 30 seconds to 2 minutes, and a sustained expansion phase of 1 to 2 minutes at approximately 72°C. Tools and instructions for low- and high-strict amplification reactions are available in the prior art.
[0045] In this application, "oligonucleotide" refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides. Its precise size can depend on many factors, which in turn are determined by the final function and use of the oligonucleotide. In some embodiments, the oligonucleotide may comprise a length of 10 to 100 nucleotides. In some embodiments, the oligonucleotide may comprise a length of 10 to 30 nucleotides, or may have a length of 20 or 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.
[0046] In this application, "primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of a primer extension complementary to a nucleic acid strand—namely, in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at suitable temperature and pH—can serve as a starting point for synthesis, whether it is naturally occurring in purified restriction digests or synthetically produced. Primers can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, 15, 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but they may contain fewer or more nucleotides. Factors involved in determining the appropriate primer length are well known to those skilled in the art.
[0047] In this application, "primer pair" refers to a primer pair that hybridizes with the opposite strand of the target DNA molecule or with a target DNA region flanking the nucleotide sequence to be amplified.
[0048] In this application, "primer site" refers to the region of the target DNA or other nucleic acid to which the primer hybridizes.
[0049] In this application, the term "probe," when referring to a nucleic acid sequence, is used in its usual sense to mean a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. Those skilled in the art will understand that, in certain circumstances, a probe can also be used as a primer, and a primer can be used as a probe.
[0050] In this application, "DNA methylation" refers to the addition of a methyl group to the 5th position of cytosine (C), which is typically (but not necessarily) in the case of a CpG (cytosine followed by guanine) dinucleotide. As used herein, "increased degree of methylation" or "significant degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancer cell or tissue sample, or a DNA sample treated for methylation of DNA residues) is unmethylated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.
[0051] In the implementation scheme, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using Southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), and methylation-specific microarrays (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or Southern blot analysis.
[0052] In this application, "methylation assay" refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.
[0053] In this application, "detection" refers to any process of observing a biomarker or a change in a biomarker (e.g., a change in the methylation state of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or the change in the biomarker is actually detected. In other words, the act of detecting a biomarker or a change in a biomarker in a sample is "detection," even if the biomarker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation and can be based on comparison with one or more control samples.
[0054] In this application, "homology," "identity," and "similarity" refer to the sequence similarity between two nucleic acid molecules. Homology, identity, or similarity can be determined by comparing positions in each sequence, and the sequences can be aligned for comparison purposes. When equivalent positions in the compared sequences are occupied by the same bases, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid residues (e.g., similar in spatial or electrical properties), the molecules can be considered homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the number of identical or similar amino acids at shared positions in the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity with the sequences of this application, preferably less than 25%. The absence or presence of extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In specific implementations, for two or more sequences or subsequences, determined by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection provided online, for example, by the National Center for Biotechnology Information (NCBI), if their sequences exhibit approximately 60% identity in the specified region, or approximately 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, when compared and aligned for maximum correspondence within a comparison window or specified region, they can be considered substantially or significantly homologous, similar, or identical. This definition also relates to or can be used to test sequence complements. Therefore, to the extent permitted by the context of this paper, for example, if a nucleotide sequence can be predicted to be naturally present in a DNA duplex, or can be naturally present as one or both of the complementary strands, then a nucleotide sequence complementary to the specified target sequence or a variant thereof is itself considered "similar" to the target sequence, and when "similar" nucleic acid sequences are involved, this includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Similarity must be limited to analyses of single nucleic acid strand sequences, which may include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In the implementation scheme, identity or similarity may be in regions of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides, or in regions of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more nucleotides.
[0055] In this application, "amplification" refers to the process of obtaining multiple copies of a nucleic acid from a specific locus, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known methods, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).
[0056] In this application, the "Ct value" refers to the cycle number at which the fluorescence signal first exceeds a preset threshold in real-time fluorescence PCR. It represents a critical Ct value for determining the positive or negative status of a sample for a specific biomarker. A smaller Ct value indicates a higher initial template (virus, gene) copy number; a larger Ct value indicates a lower template amount. The critical Ct value is a key value used in real-time quantitative PCR to distinguish between positive, negative, or weakly positive results. Its specific value depends on the detection platform, reagent kit, sample type, and laboratory quality control standards.
[0057] In this application, "sensitivity" refers to the proportion of cancer detected from a certain cancer sample, and its calculation formula is: Sensitivity = (Detected cancers / All cancers). The calculation formula for "specificity" is: Specificity = True negatives / (True negatives + False positives); where "true negatives" refers to "the number of samples that are actually negative and also have a negative test result"; and "false positives" refers to "the number of samples that are actually negative but are mistakenly judged as positive."
[0058] The “label” or “detectable part” in this application refers to a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin, or haptens, and proteins that can be prepared as detectable proteins, for example, by incorporating radiolabels into peptides or antibodies for detecting peptide-specific reactions.
[0059] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides capable of amplifying target nucleic acids (e.g., oligonucleotide primers) can be used in PCR reactions. PCR methods typically include the following steps: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize with the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. The conditions for nucleic acid amplification and detection of the amplification product are known to those skilled in the art. Various improvements to basic PCR techniques have been developed, including but not limited to anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). In the amplification reaction, the primer pair must anneal to the opposite strands of the template nucleic acid and should be kept at an appropriate distance from each other so that the polymerase can efficiently polymerize across regions and so that the amplification product can be easily detected, for example, by electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to facilitate the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9–30, 40, or 50 nucleotides in length (e.g., lengths of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides), but oligonucleotide primers can be longer or shorter, provided appropriate amplification conditions are used.
[0060] Detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label," when referring to nucleic acids, is intended to include both direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent that has directly labeled the detectable substance. Detectable substances include a variety of enzymes, cofactors, fluorescent materials, cryoluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable cofactor complexes include avidin / streptin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, luciferin, luciferin isothiocyanate, rhodamine, dichlorotriazineamine luciferin, dansyl chloride, or phycoerythrin; examples of cryoluminescent materials include luminol; and examples of bioluminescent materials include luciferase, insect luciferin, and jellyfish protein. Examples of indirect labeling include end-labeling of nucleic acids with biotin, making the nucleic acid detectable using fluorescently labeled avidin streptavidin. Detailed Implementation
[0061] On one hand, this application provides a composition for in vitro colorectal cancer MRD detection and recurrence monitoring, the composition comprising nucleic acid for detecting the methylation status of a target sequence of a target gene; wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is the GFRA1 gene and / or the DOK6 gene.
[0062] This application provides a set of target gene sequences that emit abnormal methylation in colorectal cancer, including target sequences of the GFRA1 gene and / or the DOK6 gene. The target sequence of the GFRA1 gene contains any one of the sequences in SEQ ID NO: 1-4, or as shown in any one of SEQ ID NO: 1-4; the target sequence of the DOK6 gene contains any one of the sequences in SEQ ID NO: 5-8, or as shown in any one of SEQ ID NO: 5-8.
[0063] Those skilled in the art will also understand that the target sequences of the GFRA1 gene and / or DOK6 gene are not limited to the specific sequences listed above. The target sequence of the GFRA1 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO: 1-4, but still substantially functionally identical, and also includes sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO: 1-4. The target sequence of the DOK6 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO: 5-8, but still substantially functionally identical, and also includes sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO: 5-8.
[0064] The target sequence (5'-3') of the GFRA1 gene is as follows: SEQ ID NO:1: CAGCTGCACACGCCCGCTTGCGGTGGGACCCGCGGCCGGACCCGTACTCGCGCACAGGACACGCAGTGTTCTGCAGCCGGC; The target sequence of the GFRA1 gene after bisulfite treatment (5'-3') is as follows: SEQ ID NO:2 TAGTTGTATACGTTCGTTTCGGTGGGATTCGCGGTCGGATTCGTATTCGCGTATAGGATACGTAGTGTTTTGTAGTCGGT; The complementary sequence (5'-3') of the target sequence of the GFRA1 gene is as follows: SEQ ID NO:3 GCCGGCTGCAGAACACTGCGTGTCCTGTGCGCGAGTACGGGTCCGGCCGCGGGTCCCACCGCAAGCGGGCGTGTGCAGCTG; The complementary sequence of the target sequence of the GFRA1 gene after bisulfite treatment (5'-3') is as follows: SEQ ID NO:4 GTCGGTTGTAGAATATTGCGTGTTTTGTGCGCGAGTACGGGTTCGGTCGCGGGTTTTATCGTAAGCGGGCGTGTGTAGTTG; The target sequence (5'-3') of the DOK6 gene is as follows: SEQ ID NO:5 AGCTTGGGGTGAGTGGCTCGCTCGGCTTGCTCCTTCCCCGGCGCTCGTTCGGCCCGGCTGGCTG; The target sequence of the DOK6 gene after bisulfite treatment (5'-3') is as follows: SEQ ID NO:6 AGTTTGGGGTGAGTGGTTCGTTCGGTTTGTTTTTTTCGGCGTTCGTTCGGTTCGGTTGGTTG; The complementary sequence (5'-3') of the target sequence of the DOK6 gene is as follows: SEQ ID NO:7 CAGCCAGCCGGGCCGAACGAGCGCCGGGGAAGGAGCAAGCCGAGCGAGCCACTCACCCCAAGCT; The complementary sequence of the target sequence of the DOK6 gene after bisulfite treatment (5'-3') is as follows: SEQ ID NO:8 TAGTTAGTCGGGTCGAACGAGCGTCGGGGAAGGAGTAAGTCGAGCGAGTTATTTATTTTAAGTT.
[0065] The target sequences and related sequences of the GFRA1 and DOK6 genes are shown in Table 1: Table 1: Target sequences and related sequences of GFRA1 and DOK6 genes
[0066] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the bisulfite-converted sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.
[0067] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene under moderately or strictly controlled conditions, wherein the fragment of said nucleotides contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the bisulfite-transformed sequence of the target gene under moderately or strictly controlled conditions, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein said nucleotide fragment contains at least one CpG dinucleotide sequence.
[0068] Preferably, the composition further includes a reagent for converting the 5-position unmethylated cytosine base of the target gene sequence into uracil. More preferably, the reagent is a bisulfite.
[0069] Preferably, the composition comprises one or more of the preferred primers and / or probes shown in SEQ ID NO: 9-14.
[0070] On the other hand, this application provides oligonucleotides for in vitro MRD detection and recurrence monitoring of colorectal cancer, comprising: fragments of at least 9 nucleotides in any one of SEQ ID NO: 1-4 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or fragments of at least 9 nucleotides in any one of SEQ ID NO: 5-8 or their complementary sequences and containing at least one CpG dinucleotide sequence.
[0071] Preferably, the oligonucleotide for in vitro colorectal cancer MRD detection and recurrence monitoring comprises: a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of any one of SEQ ID NO: 1-4 or its complementary sequence; and / or a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of any one of SEQ ID NO: 5-8 or its complementary sequence and containing at least one CpG dinucleotide sequence.
[0072] The oligonucleotide of this application for in vitro MRD detection and recurrence monitoring of colorectal cancer further includes: a fragment hybridized to at least 15 nucleotides of any one of SEQ ID NO: 1-4 or their complementary sequences under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of any one of SEQ ID NO: 5-8 or their complementary sequences under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence.
[0073] Preferably, the oligonucleotide for in vitro colorectal cancer MRD detection and recurrence monitoring comprises: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides in a sequence resulting from bisulfite conversion of any one of SEQ ID NO: 1-4 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides in a sequence resulting from bisulfite conversion of any one of SEQ ID NO: 5-8 or its complementary sequence, and containing at least one CpG dinucleotide sequence.
[0074] In one specific embodiment, the oligonucleotide for in vitro MRD detection and recurrence monitoring of colorectal cancer includes the sequences of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 13. It also includes the sequences of SEQ ID NO: 11 and SEQ ID NO: 14.
[0075] On the other hand, this application provides a kit comprising the aforementioned composition. The kit further comprises at least one other component selected from: nucleoside triphosphate, DNA polymerase, and a buffer required for the function of the DNA polymerase.
[0076] This application also relates to the use of the GFRA1 gene and / or DOK6 gene in the preparation of kits for in vitro MRD detection and recurrence monitoring of colorectal cancer.
[0077] The GFRA1 gene, short for GDNF family receptor alpha-1, is located on human chromosome 10q26. It encodes a member of the glial cell line-derived neurotrophic factor receptor (GDNFR) protein family. The encoded protoprotein undergoes proteolytic processing to produce the mature receptor. Glial cell line-derived neurotrophic factor (GDNF) and neuron (NTN) are two structurally related and potent neurotrophic factors that play crucial roles in controlling neuronal survival and differentiation. This receptor is a cell surface receptor linking GDNF and NTN via glycosylphosphatidylinositol (GPI), mediating the activation of RET tyrosine kinase receptors. This gene is a candidate gene for congenital megacolon. GFRA1 is also considered an important gene in cancer research. Its interaction with RET is activated in certain types of cancer, potentially leading to abnormal cell proliferation and tumor formation.
[0078] The primary function of the DOK6 gene is to regulate intracellular signaling pathways by binding to various signaling molecules through its encoded protein. Specifically, the DOK6 protein contains multiple functional domains, including the Pleckstrin homology (PH) domain and the Src homology 2 (SH2) domain, which enable it to interact with specific signaling molecules. Overexpression of DOK6 is associated with the malignant progression of certain cancer types. DOK6 promotes tumor cell proliferation and survival by activating pro-tumor signaling pathways such as PI3K / AKT and Ras / MAPK.
[0079] Furthermore, this application provides a method for in vitro MRD detection and recurrence monitoring of colorectal cancer, the method comprising the following steps: 1) Isolate the target gene sequence or its fragment from the biological sample to be tested; 2) Determine the methylation status of the target sequence of the target gene; 3) The state of the biological sample is determined by the detection results of the methylation status of the target gene sequence, thereby realizing the in vitro detection of colorectal cancer; The target gene is the GFRA1 gene and / or the DOK6 gene.
[0080] According to certain preferred embodiments, the method includes the following steps: 1) Extract genomic DNA from the biological sample to be tested; 2) Treat the DNA sample obtained in step 1) with reagents to convert the 5-position unmethylated cytosine base into uracil or other bases. That is, the 5-position unmethylated cytosine base in the target sequence of the target gene is converted into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable. 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target gene sequence, so that the treated target gene sequence is amplified to produce an amplification product or is not amplified; if the treated target gene sequence undergoes DNA polymerization, an amplification product will be produced; if the treated target gene sequence does not undergo DNA polymerization, it will not be amplified. 4) Detect the amplification products using probes; and 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene; The target gene is the GFRA1 gene and / or the DOK6 gene.
[0081] Preferably, the primers typically comprise fragments of the target gene sequence, the target gene sequence fragments comprising at least 9 nucleotides that are respectively equivalent to, complementary to, or hybridize under moderate or severe conditions to a fragment selected from any one of SEQ ID NO: 1-4 and any one of SEQ ID NO: 5-8.
[0082] Preferably, a typical probe comprises a fragment of the target gene sequence, the fragment comprising a fragment of at least 15 nucleotides that are respectively equivalent to, complementary to, or hybridized under moderate or severe conditions to any one of SEQ ID NO: 1-4 and any one of SEQ ID NO: 5-8.
[0083] Preferably, one or more of the primers and probes are shown in Table 5.
[0084] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.
[0085] According to certain preferred embodiments, the methylation status of at least one CpG dinucleotide in the target gene sequence is determined by the critical Ct value of the real-time PCR reaction. By utilizing real-time PCR to analyze DNA in biological samples, the methylation status of the target gene sequence can be conveniently detected, and the positivity of the tested sample can be quickly and easily determined based on the critical Ct value of the PCR reaction. Therefore, this provides a non-invasive and rapid in vitro detection method for colorectal cancer.
[0086] The biological sample is selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof. Plasma is the preferred biological sample.
[0087] This application also provides a kit comprising the said composition. Typically, the kit includes a container for containing a patient's biological sample. Furthermore, the kit also includes instructions for using and interpreting the test results.
[0088] This application provides a method for non-invasive in vitro MRD detection and recurrence monitoring of colorectal cancer by detecting the methylation status of target gene sequences. The inventors of this application discovered a significant difference in the methylation status of the GFRA1 and DOK6 gene target sequences in colorectal cancer tissue compared to that in normal colon or rectal tissue: in colorectal cancer tissue, the GFRA1 and DOK6 gene target sequences are methylated, while in normal colon or rectal tissue, they are not methylated. Therefore, this application provides a method for in vitro detection of colorectal cancer by detecting the methylation status of the GFRA1 and / or DOK6 gene target sequences in a sample. The method provided by this application enables non-invasive and rapid MRD detection and recurrence monitoring of colorectal cancer.
[0089] This application also provides a composition capable of sensitively and specifically detecting the methylation status of a target gene sequence; and a method and kit for in vitro non-invasive colorectal cancer MRD detection and recurrence monitoring.
[0090] The following description is an example of the compositions, kits, nucleic acid sequences, and detection methods of this application.
[0091] In some embodiments, the composition further includes a reagent for converting the unmethylated cytosine base at position 5 of a gene into uracil. Preferably, this reagent is a bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because it has the same base-pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most common method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted into uracil, which corresponds to thymine in its pairing behavior; however, under these conditions, 5-methylcytosine remains unmodified. The original DNA is thus transformed in this way, making 5-methylcytosine, which was previously indistinguishable from cytosine in its hybridization behavior, now detectable as the only remaining cytosine by conventional known molecular biology techniques, such as amplification and hybridization. All these techniques, based on different base-pairing properties, can now be fully utilized. Therefore, typically, this application provides the combined use of bisulfite techniques with one or more methylation assays to determine the methylation status of a CpG dinucleotide sequence within a target sequence of a target gene. Furthermore, the methods of this application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or feces. Therefore, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or extent) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation position should also be considered as referring to a value reflecting the methylation status of a CpG dinucleotide sequence.
[0092] In some embodiments, the method of this application specifically includes: 1) extracting genomic DNA from a biological sample to be tested; 2) treating the DNA sample obtained in step 1) with a reagent to convert the 5-position unmethylated cytosine base into uracil or other bases, that is, converting the 5-position unmethylated cytosine base of the target gene target sequence into uracil or other bases, wherein the converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable; 3) contacting the DNA sample treated in step 2) with DNA polymerase and primers of the target gene target sequence, such that the treated target gene target sequence is amplified to produce an amplification product or is not amplified; if the treated target gene target sequence undergoes a DNA polymerization reaction, an amplification product is produced; if the treated target gene target sequence does not undergo a DNA polymerization reaction, it is not amplified; 4) detecting the amplification product with a probe; 5) and determining the methylation status of at least one CpG dinucleotide of the target gene target sequence based on the presence or absence of the amplification product.
[0093] Typically, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme; using a polymerase lacking 5'-3' exonuclease activity; using PCR; and generating a nucleic acid molecule of the amplified product with a detectable label. Preferably, PCR is used to determine the methylation status, and methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene. The fluorescence-based real-time PCR assay is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a methylation-dependent sequence-differentiated pool in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers that overlap with known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence-detected amplification level. Fluorescence-based real-time PCR assays can be used as a quantitative assay for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe that overlaps a specific CpG dinucleotide. A bias-free control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The fluorescence-based real-time PCR method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter (RDOK6rter) and a quencher (Quencher) and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than that of the forward or reverse primers. This allows TaqMan probes to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters an annealed TaqMan probe. The 5' to 3' endonuclease activity of the Taq polymerase is then replaced by digestion of the TaqMan probe, releasing a fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that has not yet been quenched. Typical reagents for fluorescence-based real-time PCR analysis may include, but are not limited to: PCR primers for target gene sequences; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.
[0094] Example Example 1: Primer and probe testing Primers and probes were designed based on the target sequences of the GFRA1 and DOK6 genes. The designed primer and probe sequences are shown in Table 2 below: Table 2: Primers and probes for GFRA1 and DOK6 genes
[0095] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0096] Normal human white blood cell (WBC) cell line DNA is usually in a low / unmethylated state, which can be used as a negative control for detecting the methylation status of target gene sequences; the amount of DNA used in this embodiment is 15.75 ng / reaction. Human genomic DNA methyltransferase treatment products are usually in a high / fully methylated state; in this embodiment, human genomic DNA methyltransferase treatment products can be used as a positive control for detecting the methylation status of target gene sequences; the amount of DNA used in this embodiment is 200 pg / reaction. The DNA samples are first converted to bisulfite, and the converted BisDNA is used as a template for real-time PCR amplification using the primers and probes described above. Using the β-actin (ACTB) gene as an internal control, β-actin gene amplicon is created using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon is detected using a specific probe. Each sample undergoes at least one real-time PCR; in some specific embodiments, two or three real-time PCR detections are performed. The PCR system for primer and probe testing is shown in Table 3. Table 3:
[0097] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0098] The PCR amplification program used was: 94℃, 20 min; (93℃, 30 s; 57℃, 35 s — read fluorescence signal) 45 cycles; 40℃, 5 s.
[0099] The results are shown in Table 4. When BisDNA of fully methylated DNA was used as a template (i.e., the positive control in Table 4), both the GFRA1 and DOK6 genes were effectively amplified. However, when BisDNA of WBC was used as a template (i.e., the negative control in Table 4), except for the internal reference gene ACTB, the other target genes were not amplified.
[0100] Table 4: Optimal primer and probe test results for GFRA1 and DOK6 genes
[0101] Furthermore, analysis of the primer and probe test results for the GFRA1 and DOK6 genes revealed that, with a Ct value cutoff of 34, the optimal Ct values for the GFRA1_1 and DOK6_1 primers and probes were all less than 34, while the Ct values for the positive controls obtained with the less effective primers and probes were all greater than 34. Therefore, the less effective GFRA1_2 and DOK6_2 primers and probes were discarded. The optimal primer and probe sequence combinations for these two target genes are shown in Table 5.
[0102] Table 5: Optimal primer and probe sequences for GFRA1 and DOK genes
[0103] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.
[0104] Example 2: Plasma Test for Colorectal Cancer Forty-three pre-treatment colorectal cancer plasma samples (3.5 mL) and 36 post-treatment colorectal cancer plasma samples (3.5 mL) were selected and divided into two groups. Genomic DNA was extracted from each group. After conversion to BisDNA with bisulfite, the PCR reaction system described in Example 1 was used to detect the ctDNA of colorectal cancer before and after treatment using the GFRA1 gene and DOK6 gene alone and in combination. The sensitivity and specificity of these samples are shown in Table 6. The sensitivity data were obtained from pre-treatment colorectal cancer plasma samples, and the specificity data were obtained from post-treatment colorectal cancer plasma samples without recurrence.
[0105] Table 6: BisDNA detection results of GFRA1 and DOK6 genes, alone or in combination, in plasma before and after treatment.
[0106] The above experimental results demonstrate that methylated DNA of the GFRA1 and DOK6 gene target sequences is a marker for MRD detection and recurrence monitoring in colorectal cancer. The target gene target sequence methylated DNA detection method of this invention enables non-invasive and sensitive in vitro detection of MRD ctDNA after colorectal cancer treatment.
[0107] While various aspects and embodiments of the invention have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The aspects and embodiments disclosed herein are for illustrative purposes only and are not intended to be limiting.
Claims
1. A composition for in vitro colorectal cancer MRD detection and relapse monitoring, the composition comprising: a nucleic acid for detecting methylation status of a target gene, wherein the methylation status of the target gene is characterized by methylation of a target sequence of the target gene; wherein the target gene is GFRA1 gene and / or DOK6 gene; Optionally, the target sequence of the GFRA1 gene comprises any one of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4, or as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4; Optionally, the target sequence of the DOK6 gene comprises any one of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8, or as shown in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8; Optionally, the nucleic acid for detecting methylation status of a target gene comprises: a primer, which is a fragment of at least 9 nucleotides in the target sequence of the target gene, and the fragment contains at least one CpG dinucleotide sequence.
2. The composition of claim 1, wherein, The nucleic acid for detecting methylation status of a target gene comprises: a probe, which is a fragment of at least 15 nucleotides in the target sequence of the target gene, and the fragment contains at least one CpG dinucleotide sequence; Optionally, the composition further comprises: a reagent for converting an unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.
3. The composition of claim 2, wherein, The fragment of at least 9 nucleotides is the sequence of SEQ ID NO: 9 and SEQ ID NO: 10, or the sequence of SEQ ID NO: 12 and SEQ ID NO: 13; The fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 11, or the sequence of SEQ ID NO:
14.
4. An oligonucleotide for in vitro detection of MRD of colorectal cancer and monitoring of recurrence, comprising: a fragment of at least 9 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence; Optionally, the oligonucleotide further comprises: a fragment of at least 15 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or its complementary sequence and comprising at least one CpG dinucleotide sequence, under medium stringency or high stringency hybridization conditions; and / or a fragment of at least 15 nucleotides in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or its complementary sequence and comprising at least one CpG dinucleotide sequence, under medium stringency or high stringency hybridization conditions.
5. An oligonucleotide for in vitro colorectal cancer MRD detection and relapse monitoring, comprising: the sequence of SEQ ID NO: 9 and SEQ ID NO: 10, and / or the sequence of SEQ ID NO: 12 and SEQ ID NO: 13; or as shown in the sequence of SEQ ID NO: 9 and SEQ ID NO: 10, and / or the sequence of SEQ ID NO: 12 and SEQ ID NO: 13; Optionally, the oligonucleotide further comprises: the sequence of SEQ ID NO: 11, and / or the sequence of SEQ ID NO: 14; or as shown in the sequence of SEQ ID NO: 11, and / or the sequence of SEQ ID NO:
14.
6. Use of the GFRA1 gene and / or the DOK6 gene in the preparation of a kit for in vitro detection of MRD and monitoring of recurrence of colorectal cancer.
7. A kit comprising the composition of any one of claims 1-3 or comprising the oligonucleotide of any one of claims 4-5. Optionally, the kit further comprises at least one other component selected from the group consisting of: nucleotides, a DNA polymerase and a buffer required for the function of the DNA polymerase; Further optionally, the kit further comprises: an instruction manual.
8. Use of the composition of any one of claims 1-3 or the oligonucleotide of any one of claims 4-5 in the preparation of a kit for in vitro detection of MRD and monitoring of recurrence of colorectal cancer.
9. Use according to claim 6 or 8, wherein, The kit for in vitro detection of MRD and monitoring of recurrence of colorectal cancer detects MRD and monitors recurrence of colorectal cancer by a method comprising the following steps: 1) isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested; 2) determining the methylation state of the target sequence of the target gene; 3) determining the state of the biological sample by the detection result of the methylation state of the target sequence of the target gene, thereby achieving in vitro detection of colorectal cancer; Optionally, the method comprises the following steps: extracting genomic DNA from the biological sample to be tested; treating the extracted genomic DNA with a reagent to convert 5 unmethylated cytosine bases to uracil or other bases; contacting the DNA sample treated with the reagent with a DNA polymerase and primers of the target sequence of the target gene, and performing a DNA polymerization reaction; detecting the amplification product with a probe; and determining the methylation state of at least one CpG dinucleotide of the target sequence of the target gene based on whether the amplification product exists or not; Further optionally, the reagent is a bisulfite reagent.
10. A method for detecting MRD and monitoring recurrence of colorectal cancer, comprising the steps of: isolating a DNA sample comprising a target gene target sequence or a fragment thereof from a biological sample to be tested; determining the methylation state of the target gene target sequence; and judging the state of the biological sample by the detection result of the methylation state of the target gene target sequence, thereby achieving in vitro detection of colorectal cancer; wherein the target gene is GFRA1 gene and / or DOK6 gene.