Application of Fam210b gene and recombinant vector thereof in treatment of liver injury diseases
By constructing a recombinant vector of the Fam210b gene and a mouse model, the problem of the lack of effective treatment for acute liver injury was solved, achieving the effects of hepatocyte protection and liver regeneration, and providing new targets and methods for the diagnosis and treatment of liver injury.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-03-31
AI Technical Summary
Currently, there is a lack of effective targets and treatments for acute liver injury, and existing technologies cannot effectively protect hepatocytes and promote liver regeneration.
A recombinant vector of the Fam210b gene was constructed and mouse models of overexpression or specific knockout of the Fam210b gene in the liver were established. The mouse models were constructed using CRISPR complex and homologous targeted repair template. The Fam210b gene and 3×FLAG tag were inserted into the AAV8-TBG vector to screen for drugs to treat or prevent liver injury.
It provides diagnostic and prognostic methods for liver injury, significantly protects hepatocytes, promotes liver regeneration, screens effective drugs for treating liver injury, and simulates liver injury models in clinical diseases to provide target support for clinical treatment.
Smart Images

Figure CN121754640A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of the Fam210b gene and its recombinant vector in the treatment of liver injury. Background Technology
[0002] The liver is the largest metabolic organ in the human body, playing a vital role in nutrient metabolism, protein synthesis, detoxification, and bile acid regulation. Liver injury manifests as abnormal changes in the structure of liver tissue cells or blood vessels, followed by abnormal liver function. Common causes of liver injury include viral infection, alcohol poisoning, drug or toxin effects, autoimmune disorders, metabolic disorders, congestion, cholestasis, and trauma. Clinically, liver injury may present with symptoms such as fatigue, loss of appetite, jaundice of the skin and sclera, and bleeding. Biochemical tests commonly show elevated transaminases, elevated bilirubin, decreased albumin, and coagulation disorders. Acute liver injury (ALI), a common type of liver injury and a common liver disease, refers to acute inflammation of liver tissue, hepatocyte damage, and even necrosis occurring within a short period of time. It is usually caused by trauma, hepatitis, drug-induced injury, and autoimmune diseases (Maiwall R et al., 2024). Drug-induced liver injury (DILI) is one of the most common types of liver injury in clinical practice. Excessive acetaminophen (APAP) metabolites, such as nacetylbenzoquinone imine (NAPQI), continuously deplete glutathione (GSH) in hepatocytes, leading to a rapid depletion of GSH levels. The remaining large amount of NAPQI is then used for protein binding, triggering oxidative stress, activation of c-Jun N-terminal kinase (JNK), mitochondrial damage, and ultimately, hepatocyte necrosis (Jaeschke H and Ramachandran A, 2024). Currently, there is almost no research on treatments related to acute liver injury, and a lack of targets that can regulate and improve acute liver injury is needed. Further research is required to discover therapeutic targets, laying the foundation for drug target development and clinical treatment. Summary of the Invention
[0003] The applicant discovered that the Fam210b protein can inhibit hepatocyte damage and has a significant protective effect against liver injury. The applicant also used multiple methods to verify the protective effect of the Fam210b gene and recombinant vectors containing the Fam210b gene in liver injury diseases, providing target support for the clinical treatment of liver injury.
[0004] This invention is the first to construct a mouse model that overexpresses the Fam210b gene in the liver and a mouse model that specifically knocks out the Fam210b gene in the liver.
[0005] This invention provides the following technical solutions:
[0006] This invention provides the application of a recombinant vector containing the Fam210b gene in the preparation of drugs for treating or preventing liver damage or promoting liver regeneration.
[0007] In some embodiments, the recombinant vector inserts the Fam210b gene and a 3×FLAG tag between the restriction endonucleases BamHI-HF and HindIII-HF cleavage sites of the AAV8-TBG vector.
[0008] The present invention also provides the application of reagents for detecting Fam210b protein levels in the preparation of reagents for the diagnosis or prognosis of liver injury.
[0009] In some implementations, the reagent for detecting Fam210b protein levels is an antibody against Fam210b protein.
[0010] This invention also provides a method for constructing liver-specific knockout mice of the Fam210b gene, comprising: constructing mice containing a loxP sequence using a CRISPR complex and a homology-directed repair template, mating them with Cre tool mice to obtain liver-specific knockout mice of the Fam210b gene, wherein the CRISPR complex comprises Cas9 protein and sgRNA, and the sequence of the homology-directed repair template from the 5' end to the 3' end is as follows: left homology arm sequence, loxP sequence, exon 1 to exon 2 sequence of the Fam210b gene, loxP sequence, and right homology arm sequence, wherein the nucleotide sequence of the loxP sequence is shown in SEQ ID NO. 9, and the sequences of exon 1 to exon 2 of the Fam210b gene are shown in SEQ ID NO. 10.
[0011] In some embodiments, the sgRNA is sgRNA 1 and sgRNA 2, the nucleotide sequence of sgRNA 1 is shown in SEQ ID NO. 7, and the nucleotide sequence of sgRNA 2 is shown in SEQ ID NO. 8.
[0012] In some embodiments, the method further includes: injecting the CRISPR complex and the homologous targeted repair template into mouse zygotes, and then transplanting the zygotes into pseudopregnant female mice, the offspring of which are mice containing the loxP sequence.
[0013] The present invention also provides the use of mice obtained by the above method in screening drugs for treating or preventing liver damage or promoting liver regeneration.
[0014] In some implementations, the liver injury is acute liver injury.
[0015] In some implementations, the liver injury is a traumatic liver injury.
[0016] In some implementations, the liver injury is drug-induced liver injury.
[0017] In some implementations, the liver injury is acute drug-induced liver injury.
[0018] Acute liver injury (ALI) is a common liver injury disease, which refers to acute inflammation of liver tissue, hepatocyte damage, or even necrosis that occurs within a short period of time. Types of acute liver injury include: post-traumatic liver injury, acute drug-induced liver injury, and acute viral liver injury.
[0019] Acute drug-induced liver injury refers to acute liver injury caused by drugs or their metabolites. Most drug-induced liver injuries are acute drug-induced liver injuries.
[0020] Drug-induced liver injury includes acute drug-induced liver injury and chronic drug-induced liver injury.
[0021] Traumatic liver injury refers to damage to the structure and function of the liver caused by abdominal injury, surgery or other external forces.
[0022] Liver regeneration refers to the process by which liver cells repair their structure and function after the liver has been removed or damaged, through proliferation.
[0023] Technical effects of the present invention:
[0024] This invention constructs a model of liver injury in clinical diseases by constructing different expression levels of the Fam210b gene in the liver of experimental mice. Multiple methods are used to observe the protective effect of the Fam210b gene and its expression vector in liver injury and its role in promoting liver regeneration, providing target support for the clinical treatment of liver injury.
[0025] The Fam210b gene knockout mouse model obtained by the construction method of the present invention can be used to screen drugs for the treatment of liver diseases, such as evaluating whether candidate drugs are effective or safe for human liver cells. It can more realistically reflect the metabolism of candidate drugs in the human body and screen out more reliable drugs. Attached Figure Description
[0026] Figure 1 The image shows an agarose gel electrophoresis image of the products of PCR amplification of the Fam210b gene and 3×FLAG tag, where lane a1 is PCR product a1 and lane a2 is PCR product a2. The marker (M) used is DL2000 DNA marker.
[0027] Figure 2 A map of the enzyme digestion vector carrying the target gene.
[0028] Figure 3 The image shows an agarose gel electrophoresis pattern for PCR identification of colonies, with lanes 1-3 representing positive clones and lane 4 representing negative clone transposons. The marker (M) used is a DL2000 DNA marker.
[0029] Figure 4 Figure A shows the bands of Fam210b protein expression detected by Western blot; Figure B shows the fold change of Fam210b gene at the mRNA level detected by RT-qPCR, where AAV-NC is the control using an empty vector, AAV-OE Fam210b is the mouse overexpressing the Fam210b gene, β-actin is used as an internal control antibody, and **** indicates p < 0.0001.
[0030] Figure 5 Electrophoresis images for identifying the LoxP site (upper part) and Alb-cre genotype (lower part) of the Fam210b gene in offspring mice. Lanes 1-6 represent different mice, with + indicating a positive control and - indicating a negative control. The marker (M) used is the DL2000 DNA marker.
[0031] Figure 6 This demonstrates the Fam210b gene knockout efficiency in Fam210b knockout mice. + / + The mice were mice that normally expressed the Fam210b gene. - / - The mice were mice in which the Fam210b gene was knocked out; Figure 6 A shows the bands of Fam210b protein expression detected by Western blot. Figure 6 B represents the abundance of loxP detected by RT-qPCR, and **** indicates p < 0.0001.
[0032] Figure 7 Fam210b at different time points after acute liver injury + / + and Fam210b - / - Statistical graph of ALT and AST levels in mouse serum, Fam210b + / + The mice were mice that normally expressed the Fam210b gene. - / - The mice were mice with the Fam210b gene knocked out. ns indicates P>0.05, *** indicates p<0.001, and **** indicates p<0.0001.
[0033] Figure 8A shows the hematoxylin-eosin staining image of a tissue section with acute liver injury and a statistical chart of the area of the injured region. Figure 8 B shows the TUNEL staining image and positive apoptotic cell count of paraffin sections of acute liver injury. AAV-NC is the control using an empty vector, and AAV-OE Fam210b is a mouse overexpressing the Fam210b gene. **** indicates p < 0.0001.
[0034] Figure 9 A represents different time points following acute liver injury (Fam210b) + / + and Fam210b - / - Hematoxylin-eosin staining image and statistical diagram of damaged area of mouse liver tissue; Figure 9 B is Fam210b, indicating acute liver injury 24 hours prior. + / + and Fam210b - / - Mouse TUNEL staining image and statistical diagram of positive apoptotic cells; Figure 9 C is a statistical graph showing the detection of ALT and AST levels in mouse serum at different time points after acute liver injury. ns indicates P>0.05, * indicates p<0.005, *** indicates p<0.001, and **** indicates p<0.0001.
[0035] Figure 10 For different substrates, Fam210b fl / fl Mice and Fam210b - / - The level of hydrogen peroxide production in mouse liver mitochondria, where G is glutamate, M is malic acid, S is succinic acid, Rote is rotenone, Anti is antimycin A, *** indicates p < 0.001, **** indicates p < 0.0001.
[0036] Figure 11 The images are spatial transcriptome images from a spatial transcriptome database of patients with acute liver injury. Figure A shows the spatial transcriptome image of normal liver tissue (HEA10), while Figures B, C, and D show the spatial transcriptome images of liver tissue from three different patients with acute liver injury induced by APAP: APAP1_3, APAP1_S1, and APAP1_S2.
[0037] Figure 12 A is an immunohistochemical staining image of a paraffin section of liver tissue from a patient with acute liver injury. High, medium, and low represent the expression levels of FAM210B protein. Figure 12 B is Figure 12 A scatter plot of the immunohistochemical results score of sample A and the corresponding liver function test indicators of the patients.
[0038] Figure 13A shows the hepatocyte proliferation staining images and EdU-positive cell counts of AAV-NC and AAV-OE mice at different time points after hepatectomy, as well as the statistical diagram of EdU-488 cell proliferation detection. Figure 13 B is a statistical graph showing the expression of cell proliferation-related factors at the mRNA level in AAV-NC and AAV-OE mice at different time points after hepatectomy, detected by RT-qPCR. Figure 13 C is a statistical graph showing the ratio of liver weight to body weight in AAC-NC and AAV-OE Fam210b mice at different time points after hepatectomy; where AAV-NC is the control using an empty vector, and AAV-OE Fam210b is a mouse overexpressing the Fam210b gene. Detailed Implementation
[0039] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.
[0040] Example
[0041] 1. Materials
[0042] 1.1 Laboratory Animals
[0043] The mice used to construct the mouse model were C57BL / 6 strain mice. Fam210b + / + The mice were mice that normally expressed the Fam210b gene. - / - The mice were mice with the Fam210b gene knocked out. fl / fl Mice were normally expressing the Fam210b gene and carrying the flux site; AAV-OE Fam210b mice were mice overexpressing the Fam210b gene. Alb-Cre mice were transgenic mice with Cre recombinase expression driven by the albumin (Alb) gene promoter, purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. Female ICR mice were purchased from Vital River Laboratory Animal Technology Co., Ltd. All mice were housed in a specific pathogen-free (SPF) animal facility at the School of Basic Medical Sciences, Anhui Medical University. Animal experiments were approved by the Animal Ethics Committee of Anhui Medical University. The SPF-grade animal facility maintained a 12-12 hour light-dark cycle with suitable temperature and humidity, and mice had free access to food. The mice were of both sexes, aged 8-10 weeks, and weighed 20g ± 2g.
[0044] 1.2 Main Instruments
[0045] Paraffin microtome (LEICA, RM2235), full slide scanning system (Olympus, VS200), vortex mixer (VORTEX-3K, OLEBO Technology Co., Ltd.), fully automatic sample grinder (Shanghai Jingxin, JXFSTPRP-24L), flow cytometer (Beckman Coulter, CytoFLEX).
[0046] 1.3 Main reagents and consumables
[0047] PBS powder (Solarbio, D1043), ALT kit (Solarbio, BC1555), AST kit (Solarbio, BC1565), acetaminophen (APAP) powder (Sinopharm Reagent, TH019025G), 0.4% paraformaldehyde general-purpose tissue fixative (Biosharp, BL539A), hematoxylin-eosin staining kit (Zhongshan Jinqiao, BSBA-4024), xylene (Sinopharm Chemical Reagent, 10023418), TRIzon Reagent (Kangwei Century Medical, CW0580S), RIPA lysis buffer (strong) (Beyotime, P0013B), SDS (sodium dodecyl sulfate) powder (BioFroxx, 3250), APS (ammonium persulfate) powder (Beyotime, ST005), TEMED solution (Aladdin, T105496), acrylamide powder (Sinopharm Chemical Reagent, 30117826), Tween-80 (BioFroxx, 1716), ECL luminescent imaging solution (Abixin, abs920-A), β-actin mouse monoclonal antibody (CST, 4967S), TUNEL apoptosis detection kit (chromogenic method) (Beyotime, C1098), DAB chromogenic solution (Zhongshan Jinqiao, ZLI- 9017), Reactive Oxygen Spectroscopy Kit (Beyotime, S0033S), Mouse Tail Lysis Kit (Foregene), PrimeSTAR High-Fidelity PCR Polymerase (Takara, DR010A), Taq polymerase (Takara, DR001B), dNTPs (Takara, DR001B), Seamless Cloning Kit (Sangon Biotech (Shanghai) Co., Ltd.), Restriction Endonuclease BamHI-HF (NEB, R3136V), Restriction Endonuclease HindIII-HF (NEB, R3104V), DH5α Competent Cells (Takara, D9057), Agarose Gel DNA Recovery Kit (Takara, DV805A), DL2000 DNA Marker (Takara, D501A), 1kb DNA ladder Marker (Fermentas, SM0311), AAV8-TBG tool vector (Sangon Biotech (Shanghai) Co., Ltd.), seamless cloning reaction solution (Sangon Biotech (Shanghai) Co., Ltd., B632218), M2 medium (Sigma-Aldrich, M7167).
[0048] 2. Methods
[0049] 2.1 Data Processing and Analysis
[0050] All data in this study were statistically analyzed using SPSS software. Independent samples t-tests were used to compare data from two groups, with mean ± SD. The criteria for statistically significant differences were: * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001; the criteria for non-statistically significant differences were: ns represents p > 0.05.
[0051] 2.2 Western Blot Experiment
[0052] In determining the Fam210b protein level, the primary antibody used in the Western blotting experiment was Fam210b primary antibody (catalog number NBP2-14523) from Novus Biologicals, and the secondary antibody was HRP Goat anti-Rabbit IgG (H+L) Secondary Antibody (catalog number 31460) from Thermo Fisher.
[0053] ① Sample processing: After thawing the protein sample on ice, centrifuge it at 12,000 rpm for 5 minutes at 4 ℃ for later use;
[0054] ② Preparation of separating gel and stacking gel (polyacrylamide gel): The concentration of the separating gel is selected according to the molecular weight. In this study, the concentration of the separating gel is 12% and the concentration of the stacking gel is 5%. After preparing the equipment for gel preparation, the separating gel is prepared.
[0055] 12% separating gel: Prepare 15 ml of 12% separating gel according to the following ratios: ddH2O:30% acrylamide:1.5M Tris-HCl pH8.8:10% SDS:10% APS:TEMED = 4.8 ml:6.0 ml:3.9 ml:150 μl:150 μl:15 μl;
[0056] Once the separating gel is prepared, quickly add it to two-thirds of the bottom of the gel plate, seal with isopropanol or ddH2O, and allow it to solidify at room temperature.
[0057] Prepare 5% stacking gel: ddH2O: 30% acrylamide: 1.0M Tris-HCl pH 6.8: 10% SDS: 10% APS: TEMED = 3.4 ml: 0.83 ml: 0.63 ml: 50 μl: 50 μl: 5 μl.
[0058] Pour the sealant liquid into the concentrated adhesive and quickly insert the comb to wait for it to solidify;
[0059] ③ Remove the completely solidified gel, rinse the gel plate with ddH2O, place it in the electrophoresis tank and clamp it tightly. Pour the electrophoresis solution into the electrophoresis tank to one-third full. After removing the air bubbles at the bottom of the electrophoresis tank, pour the electrophoresis solution again to cover the short gel plate. Remove the comb to complete the protein loading.
[0060] ④ After loading the sample, slowly pour the electrophoresis buffer to fill the electrophoresis tank. Initially, adjust the voltage of the electrophoresis apparatus to a constant 80V. Once the stacking gel has formed a narrow band of protein sample, adjust the voltage to 100V~120V. The specific electrophoresis time will vary depending on the situation.
[0061] ⑤ Transfer. Activate the pre-cut solid medium (e.g., PVDF membrane) in methanol until it becomes translucent. Then, soak it in transfer buffer for 10 minutes along with the transfer sponge and filter paper. The order of material placement is as follows: with the black side of the transfer clamp facing down, place the following in sequence: 1 sponge, 2 sheets of filter paper, gel (the stacking gel needs to be removed), PVDF membrane, and then cover with 2 sheets of filter paper and 1 sponge. The number of filter papers can be adjusted depending on the tightness of the transfer clamp. Place the clamped transfer "sandwich" into the tank containing some transfer buffer, ensuring the transfer clamp is correctly oriented to prevent reverse transfer errors. The transfer conditions used in this study were a constant current of 200 mA. The specific transfer time will vary depending on the specific circumstances.
[0062] ⑥ Blocking: Rinse the PVDF membrane briefly in ddH2O, then place it in the blocking solution (the blocking solution is prepared by adding 5% skim milk powder and TBST solution), and incubate on a shaker at room temperature for about 1-2 hours;
[0063] ⑦ Primary antibody incubation: Prepare the primary antibody according to the preliminary experimental results and the recommended antibody concentration. After rinsing the PVDF membrane in TBST solution to remove the surface blocking solution, place it in the primary antibody. Incubate overnight at 4 ℃ on a shaker.
[0064] ⑧ Secondary antibody incubation: The next day, remove the PVDF membrane and wash it three times with TBST solution, 5 minutes each time. Place it in the pre-prepared secondary antibody solution. The secondary antibody and primary antibody should be of the same species. The commonly used dilution ratio for the secondary antibody is 1:5000. Incubate on a shaker at room temperature.
[0065] ⑨ Development: After the secondary antibody incubation is complete, wash the membrane three times with TBST solution, 5 minutes each time. Prepare ECL luminescent developer solution A:B solution in a 1:1 ratio, mix thoroughly in the dark, and then drop it onto the membrane. Use a Biorad developer to expose and observe the band depth.
[0066] 2.3 Extraction of tissue RNA
[0067] All RNA extractions involved in this study used the Trizol extraction method.
[0068] ① Take an appropriate amount of mouse liver tissue into a 1.5 ml centrifuge tube, add 1 ml of Trizol, add steel balls to the centrifuge tube in advance and use a tissue homogenizer to fully break and lyse it, and let it stand at room temperature for 5 minutes.
[0069] ② Add an appropriate amount of chloroform to the centrifuge tube, invert to mix, let stand at room temperature for 5 minutes, then centrifuge at 12000 rpm / min, 4℃ for 5 minutes. Slowly aspirate the supernatant into a new 1.5 ml centrifuge tube;
[0070] ③ Add an equal volume of isopropanol to the supernatant, mix thoroughly by pipetting, and let stand at room temperature for 10 minutes.
[0071] ④ Centrifuge again at 12000 rpm / min, 4 ℃ for 15 minutes, remove the supernatant, and leave the white precipitate at the bottom, which is the RNA precipitate. Wash the RNA precipitate with pre-prepared 75% DEPC ethanol and gently pipette to mix the precipitate.
[0072] ⑤ Centrifuge at 12000 rpm / min and 4 ℃ for 15-20 minutes, then remove the supernatant again and wash the precipitate again with 75% DEPC ethanol;
[0073] ⑥ Centrifuge at 12000 rpm / min, 4 ℃ for 10 minutes, then aspirate the supernatant, removing as much as possible to retain the precipitate. Add an appropriate volume of DEPC water according to the amount of RNA precipitate, and mix well by pipetting with DEPC water to dissolve the RNA precipitate. Note that the RNA precipitate should be kept on ice for operation.
[0074] ⑦ Detect RNA concentration: Take 2 μl of RNA solution and perform detection:
[0075] (a) Based on the measured concentration value, calculate and complete the reverse transcription step according to the volume of 2000 ng of RNA solution;
[0076] (b) Thaw the components of the reverse transcription reagent on ice in advance, shake well to mix thoroughly, and then carry out the reaction in an RNase-free centrifuge tube according to the volume ratio of 5X All-in-one RT buffer: All-in-one Enzyme Mix: RNA mass: RNase-free ddH2O = 4 μl: 1 μl: x μl: up to 20 μl and the program (50 ℃ for 15 minutes, 85 ℃ for 5 seconds);
[0077] ⑧ After the reaction is complete, the harvested cDNA product can be aliquoted and immediately frozen at -80 ℃ for storage. Aliquot according to the amount needed each time, and repeated freeze-thaw cycles should be avoided as much as possible.
[0078] 2.4 RT-qPCR test
[0079] ① The cDNA obtained by reverse transcription is subjected to RT-qPCR in order to detect the expression level of the target gene at the mRNA level;
[0080] ② Dilute the cDNA product; in this study, it was diluted 5-fold. Prepare the primers to the working concentration in advance (the stock solution can be used directly or needs to be diluted).
[0081] The total reaction volume was 20 μl, prepared according to the following ratio: Mix: ddH2O: V template: forward primer: reverse primer = 10 μl: 3 μl: 5 μl: 1 μl: 1 μl. The mixture should be slowly mixed and added sequentially to the eight-tube bundle.
[0082] The RT-qPCR reaction program was as follows: pre-denaturation (95 °C, 2 min), denaturation (95 °C, 5 sec), annealing (60 °C, 30 sec), extension (65 °C–95 °C, 5 sec), melting curve (72 °C, 5 min), and storage (4 °C, 2 h). The denaturation and annealing processes required 40 cycles.
[0083] ③ After the reaction is complete, the difference is calculated based on the Ct value of the target gene.
[0084] 2.5 Alanine aminotransferase (ALT) detection
[0085] ① According to the instructions for the ALT kit, for mouse serum samples, blood should first be collected from the mouse's eyeball. After collecting peripheral blood, let it stand at room temperature for 20 minutes, then centrifuge at 5000 rpm for 30 minutes. The supernatant obtained is the mouse serum sample;
[0086] ② Turn on the microplate reader and preheat for at least 30 minutes;
[0087] ③ Establish a standard curve: First, dilute all standards to 2 μmol / mL using ddH2O, then set up the standard curve according to the following concentrations:
[0088] The standard tube concentrations of alanine aminotransferase were 0, 0.05, 0.1, 0.2, 0.4, 0.8, and 1 μmol / mL, respectively.
[0089] ④ Add reagents and test samples to the 96-well plate in sequence:
[0090] Add 5 μl of the test sample and 25 μl of Reagent 1 (ALT matrix solution) from the ALT kit to the test tube; add 25 μl of Reagent 1 to the control tube; and add 30 μl of the prepared standard solutions of each concentration to the standard tube. After mixing, incubate in a 37 ℃ oven for 30 minutes.
[0091] Add 25 μl of Reagent II (2,4-dinitrophenylhydrazine solution) from the ALT kit to the test tube; add 25 μl of Reagent II and 5 μl of the test sample to the control tube; add 25 μl of Reagent II to all standard tubes. After gently mixing by pipetting, incubate accurately in a 37 ℃ oven for 20 minutes.
[0092] Add 240 μl of reagent three (sodium hydroxide solution) from the alanine aminotransferase (ALT) kit to all test tubes, control tubes, and standard tubes in the 96-well plate. After gently mixing by pipetting, let stand at room temperature for 10 minutes, and then measure the absorbance of each well at a wavelength of 505 nm.
[0093] ⑤ Convert the test results into alanine aminotransferase activity according to the calculation method in the instructions of the alanine aminotransferase kit.
[0094] 2.6 Aspartate aminotransferase (AST) detection
[0095] ① According to the instructions for the AST (aspartate aminotransferase) kit, for mouse serum samples, blood should first be collected from the mouse's eyeballs. After collecting peripheral blood, let it stand at room temperature for 20 minutes, then centrifuge at 5000 rpm for 30 minutes. The supernatant is the mouse serum sample.
[0096] ② Turn on the microplate reader and preheat for at least 30 minutes;
[0097] ③ Establish a standard curve: First, dilute all standards to 2 μmol / mL using ddH2O, then set up the standard curve according to the following concentrations:
[0098] The standard tube concentrations of aspartate aminotransferase were 0, 0.05, 0.1, 0.2, 0.4, 0.8, 1, and 1.5 μmol / mL, respectively.
[0099] ④ Add reagents and test samples to the 96-well plate in sequence:
[0100] Add 5 μl of the test sample and 25 μl of Reagent 1 (AST matrix solution) from the AST kit to the test tube; add 25 μl of Reagent 1 to the control tube; and add 30 μl of the prepared standard solutions of each concentration to the standard tube. Mix well and incubate in a 37 ℃ oven for 30 minutes.
[0101] Add 25 μl of Reagent II (2,4-dinitrophenylhydrazine solution) from the AST kit to the test tube; add 25 μl of Reagent II and 5 μl of the test sample to the control tube; and add 25 μl of Reagent II to all standard tubes. After gently mixing by pipetting, incubate accurately in a 37 ℃ oven for 20 minutes.
[0102] Add 240 μl of reagent three (sodium hydroxide solution) from the AST kit to all test tubes, control tubes, and standard tubes in the 96-well plate. After gently mixing by pipetting, let stand at room temperature for 10 minutes, and then measure the absorbance of each well at a wavelength of 505 nm.
[0103] ⑤ Convert the test results into aspartate aminotransferase activity according to the calculation method in the instructions of the aspartate aminotransferase kit.
[0104] 2.7 Liver tissue dehydration and paraffin embedding procedure
[0105] ① After the fresh mouse liver tissue was removed and trimmed into suitable small pieces, it was fixed in 4% paraformaldehyde at 4°C for 72 hours;
[0106] ② Dehydration was carried out for different times using different reagents: 75% ethanol for 1 hour, 85% ethanol for 1 hour, 95% ethanol I for 1 hour, 95% ethanol II for 1 hour, anhydrous ethanol for 40 minutes, anhydrous ethanol for 40 minutes, xylene I for 30 minutes, xylene II for 30 minutes, xylene III for 30 minutes, paraffin I at 62℃ for 1 hour, paraffin II at 62℃ for 1 hour, and paraffin III at 62℃ for 1 hour (where I, II, and III are used to distinguish another sample of the same reagent);
[0107] ③ After embedding in paraffin, allow it to solidify at room temperature.
[0108] 2.8 Hematoxylin-eosin staining of paraffin tissue sections
[0109] ① After drying the paraffin slices at 70℃ for 15 minutes, remove them and quickly place them in xylene I solution and shake gently for 15 minutes;
[0110] ② Then, dehydration was carried out for different time periods using different reagents: xylene II solution for 15 minutes, anhydrous ethanol I for 10 minutes, anhydrous ethanol II for 10 minutes, 90% ethanol for 10 minutes, 80% ethanol for 10 minutes, 70% ethanol for 10 minutes, and phosphate buffer solution for 5 minutes.
[0111] ③ After slightly shaking off the water from the paraffin sections, place them in hematoxylin staining solution for about 20 seconds. Rinse them under running tap water for several minutes to remove excess staining (avoid tissue as much as possible to avoid washing it away). Place the sections in an eosin staining tank for 2 seconds and then quickly remove them. Rinse them under running tap water for several minutes to remove excess staining solution. Once the color has stabilized, remove the section rack and let it air dry at room temperature.
[0112] ④ Mount the slide with neutral resin diluted in xylene solution, let it air dry at room temperature, and then observe it under a microscope.
[0113] 2.9 TUNEL cell apoptosis detection
[0114] ① First, place the paraffin sections in a 60 ℃ oven to melt the wax for 15 minutes, then place them in xylene to dewax for 5-10 minutes, and then continue to dewax with fresh xylene for 5-10 minutes. Then, dehydrate them for different times using different reagents: 5 minutes with anhydrous ethanol, 2 minutes with 90% ethanol, 2 minutes with 70% ethanol, and 2 minutes with distilled water.
[0115] ② Add 20 μg / ml of DNase-free proteinase K to each tissue sample and incubate at 20-37 ℃ for 15-30 minutes;
[0116] ③ Wash three times with PBS, making sure to wash away the proteinase K completely;
[0117] ④ Incubate the endogenous peroxidase blocking solution (Beyotime, catalog number P0100B) at room temperature for 20 minutes, then wash three times with PBS.
[0118] ⑤ Prepare biotin labeling solution (Beyotime, catalog number A0277), add 50 μl of biotin labeling solution to the tissue, and incubate at 37 ℃ for 60 minutes;
[0119] ⑥ Prepare Streptavidin-HRP working solution (Beyotime, catalog number A0305) according to the specified ratio, incubate at room temperature for 30 minutes, and then wash three times with PBS;
[0120] ⑦ Add DAB chromogenic solution. The chromogenic time varies for different samples. The incubation time should be appropriate according to the chromogenic situation. After the chromogenic process is complete, wash with PBS 3 times.
[0121] ⑧ Stain with hematoxylin, wash thoroughly, allow the slide to dry, and then mount with neutral resin for observation.
[0122] Example 1. Construction of AAV8 viral plasmid overexpressing the Fam210b gene
[0123] 1. Carrier Construction
[0124] The following primers were designed:
[0125] The forward primer Primer 1 and the reverse primer Primer 2 are used to amplify the target gene Fam210b. The sequence of Primer 1 is: GTTGCTTTCTGAGGATCCGCCACCATGGCCGGGCTGTTGACG (SEQ ID NO. 1), and the sequence of Primer 2 is: AGGCTTGGTGGCTGGAGGT (SEQ ID NO. 2).
[0126] The forward primer Primer 3 and the reverse primer Primer 4 are used to amplify the 3×FLAG tag. The sequence of Primer 3 is: CCTCCAGCCACCAAGCCTGACTACAAGGATGA (SEQ ID NO. 3), and the sequence of Primer 4 is: TTGATTATCGATAAGCTTTTATTTGTCGTCATCATC (SEQ ID NO. 4).
[0127] The forward primer Primer ID (+) and the reverse primer Primer ID (-) are used to identify transformants in colony PCR. The sequence of Primer ID (+) is: TCCCTTGGCCTTGGTTTTG (SEQ ID NO.5), and the sequence of Primer ID (-) is: CATAGCGTAAAAGGAGCAACA (SEQ ID NO.6).
[0128] 1.1 PCR amplification of the Fam210b gene and 3×FLAG tag
[0129] The PCR reaction system for amplifying the Fam210b gene is shown in Table 1, the PCR cycling conditions are shown in Table 3, and the amplified product is a1.
[0130] Table 1
[0131]
[0132] The PCR reaction system for amplifying the 3×FLAG tag is shown in Table 2, the PCR cycling conditions are shown in Table 3, and the amplified product is a2.
[0133] Table 2
[0134]
[0135] Table 3 PCR cycling conditions
[0136]
[0137] After PCR amplification, the target PCR product was extracted and recovered using a gel electrophoresis. The agarose gel electrophoresis image of the PCR product is shown below. Figure 1 As shown, the results indicate that the PCR product a1 is 594 bp in size and the PCR product a2 is 111 bp in size, indicating that the Fam210b gene and the 3×FLAG tag were successfully amplified.
[0138] 1.2 Obtaining the restriction enzyme vector carrying the target gene
[0139] Using the AAV8-TBG tool vector, homologous recombination was performed to obtain the final vector map. Figure 2 ).
[0140] The specific methods and steps for inserting the target gene into the vector are as follows:
[0141] (1) The AAV8-TBG tool vector was digested with restriction endonucleases BamHI-HF and HindIII-HF, and the 4541bp linearized vector fragment was recovered. The digestion sites are shown in Figure 1. Figure 3 As shown.
[0142] (2) Homologous recombination was performed between the target DNA fragment and the linearized vector obtained in step (1) at a molar ratio of 2:1. The homologous recombination system is shown in Table 4 below:
[0143] Table 4
[0144]
[0145] After mixing, incubate at 42°C for 30 minutes, then transfer to ice and let stand for 2-3 minutes.
[0146] (3) Transformation
[0147] Take 100 μl of DH5α competent cells from a -80℃ freezer and place them on ice. After thawing, add 10 µl of the product from step (2) into the tube, gently rotate to mix, and place on ice for 30 minutes.
[0148] ① Place the tube in a constant temperature water bath preheated to 42℃ for 90 seconds for heat shock;
[0149] ② Quickly transfer the tube to an ice bath to cool the cells for 2-3 minutes;
[0150] ③ Add 900 µl LB culture medium to each tube, then transfer the tube to a 37°C shaker and incubate for 1 hour to revive the bacteria and obtain the transformed bacterial solution;
[0151] ④ Spread the transformed bacterial culture onto LB agar plates (containing the antibiotic corresponding to the expression vector);
[0152] ⑤ Invert the petri dish and incubate at 37°C in a constant temperature incubator for 16 hours.
[0153] (4) PCR identification of positive colonies:
[0154] Pick colonies grown on the plate and resuspend them in 10 µl of LB medium. Take 1 µl of this medium as a template for colony PCR identification. The colony PCR system is shown in Table 5, and the PCR cycling conditions are shown in Table 6.
[0155] Table 5
[0156]
[0157] Table 6
[0158]
[0159] PCR results as follows Figure 3 As shown, positive clones yielded an 880bp fragment by colony PCR, while negative clones yielded a 0bp fragment by colony PCR.
[0160] (5) Positive clones were inoculated onto LB agar plates, preserved, and then aliquoted for sequencing and analysis. The results showed that the target gene sequence was consistent with the expected full-length AAV8 virus containing Fam210b.
[0161] (6) Extract the plasmid to obtain the recombinant vector, namely the AAV8 virus liquid / plasmid overexpressing the Fam210b gene.
[0162] Example 2. Construction of Fam210b gene overexpression mice
[0163] 1. Methods for constructing Fam210b gene overexpression mice
[0164] Inoculate each mouse with 1×10 11 The dose of AAV-8 viral fluid overexpressing Fam210b (Fam210b recombinant vector) obtained in Example 1 of vg was injected into mice via tail vein injection, and the mice were fed and observed under suitable conditions for at least 3 weeks. The negative control (NC) was an empty vector control, i.e., injected with an equal volume of AAV8-TBG tool vector, with other treatments the same.
[0165] 2. Identification of Fam210b gene overexpression mice
[0166] Mice were euthanized, liver tissue was collected, proteins were extracted, and the expression of Fam210b protein was identified using Western blotting. Figure 4 This shows the overexpression efficiency of the Fam210b gene in mice. Figure 4 A shows the expression of Fam210b protein in mouse liver detected by Western blot, indicating that the Fam210b recombinant vector successfully promoted the overexpression of the Fam210b gene in hepatocytes. Figure 4 B shows the detection of the Fam210b gene mRNA level using RT-qPCR, indicating that the Fam210b gene is overexpressed in AAV-OE Fam210b mice (with an efficiency of 13-fold), proving that this method successfully constructed a Fam210b gene overexpressing mouse, namely the AAV-OE Fam210b mouse.
[0167] Example 3. Construction of Fam210b gene deletion mice
[0168] Constructing a mouse model with specific knockout of the Fam210b gene in the liver (i.e., Fam210b) - / - The mouse-based approach included: designing and constructing Fam210b containing the loxP site. fl / fl Mice were mated with Alb-cre mice to obtain offspring mice, thus obtaining the Fam210b gene knockout mouse model. - / - Mice.
[0169] 1. Construction of Fam210b gene deletion mice
[0170] The construction strategy involves inserting a loxP site at each end of exons 1 and 2 of the Fam210b gene, and then using Cre / loxP gene targeting technology to achieve the desired effect. - / - Knockout in mouse liver. The specific construction method is as follows:
[0171] (1) CRISPR / Cas9 system design and fabrication:
[0172] ① gRNA design: Two highly specific sgRNAs were designed targeting the exon1-exon2 boundary region of the Fam210b gene transcript (genomic coordinates: Chr 2: 132,456,789-132,457,123, based on NCBI Mm39): sgRNA1 targeting the 3' end of exon1: 5'-GCTAGCTAGCGGACCTGAAGG-3' (SEQ ID NO. 7); and sgRNA2 targeting the 5' end of exon2: 5'-TCCGATCGAAGCTTCGATCCG-3' (SEQ ID NO. 8).
[0173] ② Off-target effect verification: Using CRISPRscan (https: / / www.crisprscan.org / ) and COSMID (https: / / crispr.bme.gatech.edu / ) tools, we ensured that the sgRNA had no significant off-target sites (mismatch ≥3 bp) across the entire genome.
[0174] ③ Donor vector construction: Synthesize a single-stranded DNA homology-directed repair template (ssODN), the structure of which is as follows:
[0175] 5'- [Left homologous arm] - loxP sequence- [Sequences of exon 1 to exon 2] - loxP sequence- [Right homologous arm] - 3'
[0176] The loxP sequence is 5'-ATAACTTCGTATAATGTACATTATACGAAGTTAT-3' (SEQ ID NO.9), and the two loxP sequences are in the same orientation.
[0177] The sequences of exons 1 to 2 are shown in SEQ ID NO.10, where the underlined part from position 1 to 271 is exon 1 of the Fam210b gene, the underlined part from position 5879 to 6048 is exon 2 of the Fam210b gene, and the middle part is the intron sequence between these two exons.
[0178] The homologous arms were designed as short homologous arms. Based on the two designed sgRNAs, the Cas9 cleavage sites were determined. Using the left Cas9 cleavage site as the boundary, a 40 bp section was truncated upstream at the 5' direction to form the left homologous arm. Using the right Cas9 cleavage site as the boundary, a 40 bp section was truncated downstream at the 3' direction to form the right homologous arm. Both the left and right homologous arms are 40 bp in length, covering the flanking sequences (±20 bp) of the sgRNA cleavage sites.
[0179] The final concentration of ssODN as the donor template was 100 ng / μL.
[0180] ④ CRISPR complex preparation: Mix Cas9 mRNA (100 ng / μL) and sgRNA (50 ng / μL each) and incubate to form RNP complex (25°C, 10 min).
[0181] (2) Microinjection and transfer of fertilized eggs
[0182] ① Fertilized egg acquisition: 6-8 week old female C57BL / 6JGpt mice (strain number: IMSR_JAX:000664) were treated with superovulation technology, and fertilized eggs (pronuclear stage) were collected and placed in M2 medium;
[0183] ② Microinjection:
[0184] The mixture was injected into the fertilized egg: the mixture was the RNP complex and ssODN (volume ratio 1:1), injection volume 2 pL / egg; injection parameters: air pressure 300 hPa, time 0.5 seconds / egg.
[0185] ③ Embryo transfer: After overnight culture, the injected fertilized eggs are transferred to the oviduct of pseudopregnant ICR female mice (15-20 eggs / mouse). Pregnancy is monitored 7 days after the operation to obtain F0 generation mice.
[0186] 2. Genotyping of Fam210b gene deletion mice
[0187] (1) Screening and identification of F0 generation mice
[0188] ① Initial genotype screening:
[0189] Genomic DNA from the tail tips of the above-mentioned F0 generation mice and wild-type mice (as controls) was collected for PCR identification using the outer primer pair:
[0190] Forward primer: 5'-CAGGTGCTGGAGTTCCTGAC-3' (SEQ ID NO.11)
[0191] Reverse primer: 5'-GATCCGAGTCCTGGTTCCTT-3' (SEQ ID NO.12)
[0192] PCR conditions were: 94°C for 3 minutes; 35× (94°C for 30 seconds, 62°C for 30 seconds, 72°C for 45 seconds); 72°C for 5 minutes.
[0193] The expected product length for wild-type mice is 500 bp; the expected product length for knock-in deletion mice (Mice with the Fam210b gene knocked into the LoxP sequence) is 600 bp. Positive samples were selected based on the PCR results.
[0194] ② loxP sequence insertion verification
[0195] Bidirectional sequencing was performed on the initially positive samples:
[0196] Use loxP primers: 5'-TACGCCAATACGCAAACCGC-3' (SEQ ID NO.13).
[0197] loxP direction-specific primer: F: 5'-CTTCGTATAATGTACATTATAC-3' (SEQ ID NO.14)
[0198] R: 5'-GTAATCATCGTCGTTTGTATG-3' (SEQ ID NO.15)
[0199] To verify the loxP orientation and integrity, mice with correct loxP orientation (both loxP orientations are the same) and complete loxP sequences were identified as loxP positive. LoxP positive F0 homozygous mice (both alleles carry the loxp sequence) were then identified.
[0200] ③ Off-target effect detection
[0201] Deep sequencing (≥1000×) was performed on the top five off-target sites predicted by bioinformatics software (e.g., CRISPRscan) to confirm the absence of insertion and deletion mutations.
[0202] (2) Establishment of F1 generation model and verification of genetic stability
[0203] ① Genetic transmission: LoxP positive F0 mice were mated with wild-type C57BL / 6JGpt mice to obtain F1 generation mice.
[0204] ② Genotyping of F1 generation mice using a dual-primer system:
[0205] Detection was performed using loxP outer primers, employing loxP primers (SEQ ID NO.13), 600bp.
[0206] loxP direction-specific primer: F: 5'-CTTCGTATAATGTACATTATAC-3' (SEQ ID NO.14)
[0207] R: 5'-GTAATCATCGTCGTTTGTATG-3' (SEQ ID NO. 15), 120 bp.
[0208] The success of loxP insertion in F1 generation mice was verified. The loxP insertion accuracy in F1 generation mice was found to be >95%, and no off-target effects were observed (whole genome deep sequencing threshold <0.1%).
[0209] ③ Probe design and validation: Southern blotting probes were used, employing the genomic sequence located outside the homologous arm (exon 3 of the unedited region of Fam210b) as the probe, bound to the restriction endonuclease site EcoRI, to demonstrate that the exogenous sequence loxP was fully integrated into the specific genomic site, rather than being randomly inserted. Results showed that exon 3 of the Fam210b gene was not inserted, and loxP was fully integrated into the specific genomic site.
[0210] ④ Successful insertion of the loxP site was detected using PCR: Wild-type mice = 8.2 kb; Knock-in mice (with loxP site insertion) = 8.2 kb + 5.5 kb (5.5 kb is the newly added loxP site and the introduced restriction enzyme site). Figure 5 As shown. The positive rate in the F1 generation was ≥30%, and no loss / mutation of the loxP sequence was observed after three consecutive passages.
[0211] (3) Knock out the Fam210b gene, cross-breed F0 or F1 positive mice with tissue-specific Alb-Cre mice to obtain offspring, namely mice with liver-specific knockout of the Fam210b gene.
[0212] 3. Fam210b gene knockout efficiency in Fam210b gene deletion mice
[0213] The knockout efficiency was tested using the Western blotting and RT-qPCR experiments described above. Figure 6 A and Figure 6 B represents the results identified by Western blotting and RT-qPCR, respectively. LoxP abundance indicates the Fam210b gene mRNA expression level. The results show that Fam210b was successfully knocked out in the liver at both the protein and transcriptional levels, with a knockout efficiency of 80%. Figure 6 This demonstrates that our method successfully constructed a heritable, genotype-stable Fam210b gene-deleted mouse, i.e., Fam210b. - / - Mice.
[0214] Example 4. Establishment of a mouse model of drug-induced liver injury
[0215] Based on the actual body weight of the mice, acetaminophen (APAP) was administered intraperitoneally at a dose of 300 mg / kg. The mice were euthanized 24 hours later. Peripheral blood and liver tissue were collected at different time points after injection. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using the methods described above. The control group was treated with Fam210b. + / + Mice, experimental group used Fam210b - / - Mice. Figure 7 The results showed that at 24, 48, and 72 hours after inducing acute liver injury, the serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the experimental group mice were significantly higher than those in the control group, indicating more severe liver function impairment in the mice. This suggests that the presence of the Fam210b gene has a protective effect against acute liver injury in mice.
[0216] Example 5. Fam210b agonist has a significant protective effect against drug-induced liver injury in mice.
[0217] Acute liver injury was induced in control mice (AAV-NC, using the NC described in Example 2) and experimental mice (AAV-OE Fam210b mice as described in Example 2, which were treated with the Fam210b agonist) by administering APAP 300 mg / kg (using the method described in Example 4). The mice were euthanized 24 hours later. Liver tissue was fixed in 4% paraformaldehyde, then dehydrated, embedded in paraffin, and sectioned. Paraffin sections were stained with hematoxylin and eosin. Figure 8 A showed that the area of necrosis in the liver of the experimental group mice due to acute injury was significantly smaller than that of the control group mice, suggesting that the use of the Fam210b agonist alleviated acute liver injury in AAV-OE Fam210b mice. Similar results were also observed in… Figure 8The apoptosis detection results (TUNEL staining of paraffin sections) of sample B showed that the use of Fam210b agonists significantly reduced the production of apoptotic cells in acutely injured liver. The differences between the experimental and control groups were statistically significant. These results suggest that Fam210b agonists play a protective role in acute liver injury, and can alleviate or reduce acute liver injury; therefore, Fam210b agonists can be used to treat, alleviate, or reduce acute liver injury.
[0218] Example 6. Under drug-induced liver injury conditions, Fam210b gene deletion exacerbates liver injury.
[0219] Control group mice (Fam210b) were given + / + ) and experimental group mice (Fam210b - / - Acute liver injury was induced in mice with APAP 300 mg / kg. Mice were euthanized at 24, 48, and 72 hours post-induction. Liver tissue was fixed in 4% paraformaldehyde, then dehydrated, embedded in paraffin, and sectioned. Paraffin sections were stained with hematoxylin and eosin. Figure 9 A indicates that at different time points after injury (24 hours, 48 hours, and 72 hours), the absence of the Fam210b gene reduces the protective effect on the liver, increases the area of liver damage and necrosis in mice, and exacerbates liver damage. Therefore, Fam210b protein can effectively protect against hepatocyte damage at different time points after injury. Figure 9 The apoptosis staining results of B also showed that 24 hours after injury, Fam210b... - / - The number of apoptotic hepatocytes in mice was significantly increased, suggesting that the presence of the Fam210b gene can reduce hepatocyte apoptosis. Figure 9 C shows mice lacking the Fam210b gene (Fam210b). - / - In mice, abnormally elevated liver function (ALT and AST levels) indicated severe hepatocellular damage. In summary, this demonstrates that the Fam210b gene has a direct protective effect against acute liver injury, and that deletion of the Fam210b gene in the liver directly leads to exacerbated hepatocellular damage during acute liver injury.
[0220] Hydrogen peroxide production level is a commonly used indicator for measuring oxidative stress in cells and tissues, and can indicate the degree of intracellular oxidative stress damage. The hydrogen peroxide production rate was detected using a buffer solution (containing 137 mM KCl, 2 mM KH2PO4, 20 mM HEPES, and 20 μM EGTA). Mitochondria were seeded at 0.3 mg / mL in 96-well plates, and 20 μM Amplex Red and 4 μg / mL HRP were added. After incubation at 37°C for 30 minutes, fluorescence intensity was detected at an excitation wavelength of 530 nm and an emission wavelength of 590 nm. The substrates used were: glutamate (5 mM), malic acid (5 mM), succinic acid (5 mM), rotenone (10 μM), and antimycin A (6.5 μM). Hydrogen peroxide was used as a positive control, and a standard curve was established to determine the hydrogen peroxide content. Fam210b was also tested. fl / fl Mice and Fam210b - / - Hydrogen peroxide levels in the mitochondria of mouse hepatocytes Figure 10 The results show that Fam210b - / - The significantly increased hydrogen peroxide levels in mice indicate intracellular oxidative stress damage in hepatocytes, proving that hepatocytes are damaged.
[0221] Example 7. High expression of human FAM210B protein is associated with liver damage.
[0222] 1. In a database of patients with acute liver injury, the expression of human FAM210B protein was higher than that in normal liver tissue.
[0223] Based on spatial transcriptomic images from the spatial transcriptomic database of patients with acute liver injury (https: / / liverregenerationatlas.hendersonlab.mvm.ed.ac.uk), it was found that, compared with normal liver tissue, the areas of acute liver injury induced by APAP ( Figure 11 The expression abundance of FAM210B protein is higher around the yellow area in the middle. Figure 11 The yellower the color, the higher the abundance, indicating that liver damage is associated with high expression of FAM210Bb protein. Figure 11 ).
[0224] 2. High expression of FAM210B protein is associated with more severe clinical acute liver injury.
[0225] Paraffin-embedded tissue sections were used from patients with acute liver injury at the Second People's Hospital of Anhui Province. Figure 12As shown in Figure A, immunohistochemical staining results revealed differences in the expression levels of FAM210B protein in the liver tissues of different patients. When liver function is normal, GGT (gamma-glutamyl transferase), AST (aspartate aminotransferase), and ALT (alanine aminotransferase) in hepatocytes are at healthy serum levels. However, when hepatocyte damage leads to a disease state in the hepatobiliary system, the levels of these indicators in serum become abnormally elevated. Tracking liver function indicators based on FAM210B protein expression information can... Figure 12 Sample A was scored using immunohistochemical staining based on the degree of staining, and a linear correlation analysis was performed between the scores and clinical liver function indicators (AST, ALT, and GGT levels) (see [link to relevant documentation]). Figure 12 B). Linear correlation analysis showed that the more severe the liver injury, the higher the expression of FAM210B protein in the liver tissue. Damaged liver tissue requires higher FAM210B protein expression to help with subsequent liver repair, which also proves that human FAM210B protein helps in the recovery of acute liver injury.
[0226] Example 8. Fam210b agonist has a significant protective effect against acute liver injury in mice.
[0227] Using the treatment method described in Example 2, Fam210b gene overexpression mice (AAV-OE Fam210b) and negative control mice (AAV-NC) were obtained, and the mice were subjected to the following treatments and tests.
[0228] 1. Management of traumatic liver injury
[0229] Mice were anesthetized by intraperitoneal injection of 4% chloral hydrate (140-160 μl / 20-25g). The hair in the surgical area of the abdomen was shaved, and then depilatory cream was used to completely remove the vellus hair. The mice were immobilized in a supine position. An incision was made in the middle of the abdomen (5 mm below the umbilicus), and the abdominal muscles were bluntly dissected to open the abdominal cavity. The intestines were gently opened with a saline-moistened cotton swab to expose the liver. The roots of the left lateral and middle lobes of the liver (including blood vessels and bile ducts) were ligated with surgical sutures. The left and middle lobes of the liver (approximately 70% of the total liver weight) were removed using surgical scissors, preserving the right lobe and caudate lobe (approximately 30%). After removing the excised tissue and confirming no bleeding, the wound was compressed with a moistened cotton swab for 1-2 minutes. A layered suturing method was used (i.e., suturing the abdominal muscles first, then the skin), and the wound was thoroughly disinfected. Postoperatively, the mice were placed on a 37°C heated blanket until they were fully awake (usually 30-60 minutes).
[0230] 2. Cell proliferation detection
[0231] Cell proliferation was detected using the EdU-488 cell proliferation assay kit (Beyotime, C0072S), and the specific steps included:
[0232] (1) To observe the cell proliferation of the liver at 24, 48 and 72 hours after hepatectomy, EdU (5-ethnyl-2'-deoxyuridine) should be injected intraperitoneally into the hepatectomized mice at a dose of 100 mg / kg 3 hours before sample collection. (For example, if the plan is to observe the hepatocyte proliferation 24 hours after hepatectomy, the EdU-488 cell proliferation detection reagent should be successfully injected 21 hours after hepatectomy, and the liver sample of the mouse should be collected 3 hours later, i.e., 24 hours after hepatectomy), and the liver and mouse weight should be weighed and counted.
[0233] (2) After obtaining the sample, prepare the sample into frozen sections: add 4% paraformaldehyde fixative and fix at room temperature for 15 minutes; wash 3 times with PBS solution for 3-5 minutes each time; incubate with PBS solution containing 0.3% Triton X-100 at room temperature for 10-15 minutes; wash 3 times with PBS solution for 3-5 minutes each time;
[0234] (3) Prepare Click reaction solution: Prepare a total volume of 500 μl of Click reaction solution according to the formula of 430 μl Click Reaction Buffer + 20 μl Copper and Protectant + 1 μl Picolyl Azide 488 + 50 μl Click Additive Solution. Note that the reaction solution should be used within 15 minutes after preparation.
[0235] (4) After removing the washing solution in step b, add 200 μl of Click reaction solution to each slice and incubate at room temperature in the dark for 30 minutes.
[0236] (5) Remove the Click reaction solution and wash three times with PBS solution for 3-5 minutes each time;
[0237] (6) Nuclear staining: Dilute 1000X Hoechst 33342 with PBS solution to 1X Hoechst 33342, add 200 μl of 1X Hoechst 33342 to each slice, and incubate at room temperature in the dark for 10 minutes.
[0238] (7) Remove Hoechst 33342 by washing three times with PBS solution for 3-5 minutes each time;
[0239] (8) After mounting, observe the staining under a fluorescence microscope.
[0240] Results (e.g.) Figure 13 As shown in Figure A, at 24, 48, and 72 hours after hepatectomy, the proportion of proliferating hepatocytes in mice overexpressing the Fam210b gene was significantly higher than that in negative control mice (*p < 0.05, **p < 0.01). This indicates that overexpression of the Fam210b protein promotes the proliferation of mouse hepatocytes and helps the liver recover to normal levels.
[0241] Results (e.g.) Figure 13 As shown in Figure C, at 48 and 72 hours after hepatectomy, the liver weight to body weight ratio in the AAV-OE group was significantly higher than that in the AAV-NC group, with statistically significant differences (**p < 0.01, ***p < 0.001). This suggests that overexpression of Fam210b protein promotes liver regeneration after hepatectomy.
[0242] 3. RT-qPCR detection of the expression of cell proliferation-related factors
[0243] RNA was extracted from mouse hepatocytes at different time points (24, 48, and 72 hours), and the expression of cell proliferation-related factors (Pcna, Ccnd1, Ccnb1, and Ccna2) was detected using RT-qPCR. The results ( Figure 13 (B) This shows that at different time points after hepatectomy (24, 48, and 72 hours), the levels of cell proliferation-related factors in mice overexpressing the Fam210b gene were significantly higher than those in negative control mice. This indicates that overexpression of the Fam210b protein in the liver can protect and repair damaged hepatocytes and promote their proliferation.
[0244] In conclusion, Fam210b agonists can be used to treat, alleviate, or reduce acute liver injury and promote liver regeneration.
[0245] References
[0246] 1. Maiwall R, Kulkarni AV, Arab JP, Piano S. Acute liver failure. Lancet 2024; 404: 789-802.
[0247] 2. Jaeschke H, Ramachandran A. Acetaminophen Hepatotoxicity: Paradigm for Understanding Mechanisms of Drug-Induced Liver Injury. Annu Rev Pathol2024; 19: 453-478.
[0248] sequence list
[0249] SEQ ID NO.1: Forward primers for amplifying the Fam210b gene
[0250] GTTGCTTTCTGAGGATCCGCCACCATGGCCGGGCTGTTGACG
[0251] SEQ ID NO.2: Reverse primer for amplifying the Fam210b gene
[0252] AGGCTTGGTGGCTGGAGGT
[0253] SEQ ID NO.3: Forward primer for amplifying the 3×FLAG tag
[0254] CCTCCAGCCACCAAGCCTGACTACAAGGATGA
[0255] SEQ ID NO.4: Reverse primer for amplifying the 3×FLAG tag
[0256] TTGATTATCGATAAGCTTTTTATTTGTCGTCATCATC
[0257] SEQ ID NO.5: Forward primers for identifying transformants in colony PCR
[0258] TCCTCTTGGCCTTGGTTTTG
[0259] SEQ ID NO.6: Reverse primers for identifying transformants in colony PCR
[0260] CATAGCGTAAAAGGAGCAACA
[0261] SEQ ID NO.7: sgRNA targeting exon 1 of the Fam210b gene
[0262] GCTAGCTAGCGGACCTGAAGG
[0263] SEQ ID NO.8: sgRNA targeting exon 2 of the Fam210b gene
[0264] TCCGATCGAAGCTTCGATCCG
[0265] SEQ ID NO.9: loxP sequence
[0266] ATAACTTCGTATAATGTACATTATACGAAGTTAT
[0267] SEQ ID NO.10: Sequence of exons 1 to 2
[0268] GAGGCCCCGGTCTCGGCCCCGCCCACCGCGCTGTGTTGGAGCTGATTCCCGAGTGGGCACACTGGAGCT GCGCTCGCGGCGCCATGGCCGGGCTGTTGACGCTGCTTGGCCCGGCAGGAAGAGTGAGCACCCGGCTGCGGCCCC TGGCCCCTTGGCTCCTGGGAACCGCCACCTCCTGTGCTCCACCGCTCTGGGCCTTAGCCTTGTCCCATCCGGTTCCG GACGCCCGACTGCTGCGCACGGCCCGCGGGGACTGTCTCAGCCGCCAG GAGCCCAACAGGACCCCCGAGCCAGGAGGCAGTGTCACCGGCA CAGAGAAAAAGCTAAGCAGAACACAGCAGCTGAAGAAGGTTTTCCAAGAGTACGGGGCCGTGGGCGTGTCAATGCAC ATTGGGATCTCCCTGGTGTCCTTGGGGATATTTTACACAGTTGTTTCCAG
[0269] SEQ ID NO.11: Outer primer (forward)
[0270] CAGGTGCTGGAGTTCCTGAC
[0271] SEQ ID NO.12: Outer primer (reverse)
[0272] GATCCGAGTCCTGGTTCCTT
[0273] SEQ ID NO.13: loxP primer
[0274] TACGCCAATACGCAAACCGC
[0275] SEQ ID NO.14: loxP direction-specific primer (forward)
[0276] CTTCGTATAATGTACATTATAC
[0277] SEQ ID NO.15: loxP direction-specific primer (reverse)
[0278] GTAATCATCGTCGTTTGTATG
[0279] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. Application of recombinant vectors containing the Fam210b gene in the preparation of drugs for treating or preventing liver injury or promoting liver regeneration.
2. The application according to claim 1, wherein the recombinant vector inserts the Fam210b gene and a 3×FLAG tag between the restriction endonucleases BamHI-HF and HindIII-HF of the AAV8-TBG vector.
3. Application of reagents for detecting Fam210b protein levels in the preparation of reagents for the diagnosis or prognosis of liver injury.
4. The application according to claim 3, wherein the reagent for detecting the Fam210b protein level is an antibody against the Fam210b protein.
5. A method for constructing liver-specific knockout mice of the Fam210b gene, comprising: Mice containing the loxP sequence were constructed using a CRISPR complex and a homology-directed repair template. These mice were then mated with Cre tool mice to obtain liver-specific knockout mice of the Fam210b gene. The CRISPR complex comprises Cas9 protein and sgRNA. The sequence of the homology-directed repair template, from the 5' end to the 3' end, consists of: the left homology arm sequence, the loxP sequence, the sequences of exons 1 to 2 of the Fam210b gene, the loxP sequence, and the right homology arm sequence. The nucleotide sequence of the loxP sequence is shown in SEQ ID NO. 9, and the sequences of exons 1 to 2 of the Fam210b gene are shown in SEQ ID NO.
10.
6. The method of claim 5, wherein the sgRNA is sgRNA 1 and sgRNA 2, the nucleotide sequence of sgRNA 1 is shown in SEQ ID NO. 7, and the nucleotide sequence of sgRNA 2 is shown in SEQ ID NO.
8.
7. The method of claim 5, further comprising: The CRISPR complex and the homologous targeted repair template were injected into mouse zygotes, and the zygotes were then transplanted into pseudopregnant female mice. The offspring of the pseudopregnant female mice were mice containing the loxP sequence.
8. The use of mice obtained by the method of any one of claims 5-7 in screening for drugs that treat or prevent liver injury or promote liver regeneration.
9. The application according to any one of claims 1-4 or 8, wherein the liver injury is acute liver injury.
10. The application according to any one of claims 1-4 or 8, wherein the liver injury is drug-induced liver injury.
Citation Information
Patent Citations
Systemic lupus erythematosus disease diagnostic kit based on FAM210B gene
CN118389671A
Novel systemic lupus erythematosus mouse model and application thereof
CN118892100A
Methods for treating injuries
WO2020172343A2