Ribozyme for labeling biotin on target RNA and screening method and application thereof

Abstract

The invention relates to ribozyme for labeling biotin on target RNA (Ribonucleic Acid) as well as a screening method and application thereof. The RNA labeling technology is one of core tools for modern molecular biology research and clinical diagnosis. A specific marker is covalently linked to a target RNA molecule, so that accurate tracking, efficient detection and functional analysis of RNA can be realized. A biotin-streptavidin system becomes one of the technical routes which are most widely applied due to extremely high affinity and signal amplification capability of the biotin-streptavidin system. At present, common biotin-labeled RNA technical methods mainly comprise a chemical solid-phase synthesis method, an enzymatic method and a chemical labeling method. However, the methods have the limitations of poor site specificity, low efficiency, complex manipulation and the like in the use process. The engineering ribozyme for catalyzing RNA biotinylation is obtained by taking 12: 0 biotin coenzyme A as a biotin donor through an in-vitro screening technology. The ribozyme provided by the invention can efficiently and specifically carry out biotin labeling on target RNA, the reaction process is simple, and the labeling activity is up to 90% or above.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a ribozyme for labeling biotin on a target RNA as well as a screening method and application thereof. BACKGROUND

[0002] RNA labeling technology is one of the core tools in modern molecular biology research and clinical diagnosis. By covalently connecting specific labels on target RNA molecules, precise tracking, efficient detection and functional analysis of RNA can be achieved. Among many labeling strategies, the biotin-streptavidin system has become one of the most widely used technologies due to its high affinity and signal amplification capability. Biotin-labeled RNA technology has been widely used in gene expression analysis, pathogen detection, drug development, and single-molecule imaging. The current commonly used methods for biotinylated RNA include chemical solid-phase synthesis, enzymatic method and chemical labeling method. However, these methods have various limitations in use. The chemical solid-phase synthesis method limits the length of the labeled target RNA; the incorporation of biotin-NTP during in vitro transcription results in lack of site specificity and multiple labeling sites on the same target RNA; and the biotin labeling of the RNA end after transcription by specific enzymes or chemical reagents has low efficiency and complex operation. With the rapid development of antisense oligonucleotides (ASO), small interfering RNA (siRNA) and other nucleic acid drugs, there is an urgent need to develop RNA biotin labeling technology with high sensitivity and high specificity.

[0003] In recent years, ribozymes and deoxyribozymes have become a new type of tool for specifically labeling RNA, with high universality and efficiency. Studies have shown that a class of methyltransfer ribozymes using N6-methylguanosine (m6G) as a methyl donor can efficiently and specifically label target RNA with fluorescence. By using this strategy, the development of engineered ribozymes that can catalyze RNA biotinylation is expected to be an effective way to break through the existing technical bottlenecks. SUMMARY

[0004] The present application aims to overcome the limitations of existing RNA biotin labeling technology and provides a ribozyme for labeling biotin on a target RNA as well as a screening method and application thereof.

[0005] The purpose of the present application is achieved by the following technical solutions: In a first aspect, the present application provides a ribozyme for labeling biotin on a target RNA, wherein the nucleotide sequence of the ribozyme is shown in SEQ ID NO. 6 ~ SEQ ID NO. 10.

[0006] Further, the ribozyme is capable of transferring 12:0 biotin-CoA to the 5' end of a substrate RNA, wherein the sequence of the substrate RNA is as shown in SEQ ID NO. 5, SEQ ID NO. 11~ SEQ ID NO. 13.

[0007] Further, the ribozyme comprises a variant sequence having at least 80% sequence identity to the sequence as shown in SEQ ID NO. 6 ~ SEQ ID NO. 10 and retaining the biotin labeling activity.

[0008] Further, the nucleotide sequence of the ribozyme comprises substitution, deletion and / or addition of one or several nucleotides to the sequence as shown in SEQ ID NO. 6 ~ SEQ ID NO. 10.

[0009] Further, the nucleotide sequence of the ribozyme comprises a base with a label or a chemical modification, wherein the label comprises one or more of an isotopic label, a fluorescent label, a biotin label, an enzyme label and a chemiluminescent label; and the chemical modification comprises one or more of methylation modification, amination modification, sulfhydrylation modification, phosphorylation modification, thiolation modification, carboxylation modification and isotopic modification.

[0010] In a second aspect, the present application provides a screening method for a biotin-labeled ribozyme for a target RNA, comprising the following steps: (1) After obtaining a PCR product by PCR amplification using a forward primer, a reverse primer and an N70-DNA library, in vitro transcription, electrophoresis, gel recovery and isopropanol precipitation are performed to obtain a high-concentration RNA library; (2) The RNA library obtained in step (1) is subjected to annealing treatment, and 12:0 biotin coenzyme A in a molar amount twice that of the RNA library is added, and the reaction is performed at 37°C for 16 h; (3) The RNA library after the reaction is recovered by ethanol precipitation and resuspended, incubated with 100 μL of streptavidin agarose beads at room temperature for 1 h, and the precipitate is obtained to obtain a complex of the RNA library with the streptavidin agarose beads having the biotin labeling activity; (4) The complex in step (3) is washed 5 times with 1 mL of washing buffer, and the precipitated complex is washed 2 times with 1 mL of water.

[0011] (5) 100 μL of elution buffer is added, and the mixture is incubated at 95°C for 10 min, and the supernatant is taken; (6) Step (5) is repeated to obtain the RNA library with the biotin labeling activity; (7) Repeat steps (1) to (6) for 8 to 10 rounds. The RNA library obtained in each round of step (6) is used as a template for the next round of step (1) after reverse transcription and PCR amplification. (8) Finally, the ribozyme with nucleotide sequences as shown in SEQ ID NO.6 ~ SEQ ID NO.10 is obtained.

[0012] Further, in step (1), the N70-DNA library is shown in SEQ ID NO.1, the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3.

[0013] Furthermore, in step (2), the annealing step involves placing the RNA library in a 65°C metal bath for 5 minutes and then incubating it on ice for 30 minutes.

[0014] Further, in step (4), the washing buffer contains 25 mM HEPES pH 7.4, 8 M Urea, 1 mM EDTA, and 0.01% Tween-20.

[0015] Furthermore, in step (5), the elution buffer contains 95% formamide and 1 mM EDTA.

[0016] Thirdly, the present invention provides an application of the ribozyme described above in the preparation of products labeled with biotin on target RNA, wherein the products include a reagent kit, a biosensor, and a detection chip.

[0017] The beneficial effects of this invention are: 1) Site specificity: Biotin labeling of target RNA at specific sites can be achieved through engineered ribozymes; 2) High efficiency: Labeling activity is over 90% (verified by denaturing PAGE); 3) Simple operation: The labeling reaction only requires 12:0 biotin-coenzyme A, ribozyme and a buffer solution of 50 mM HEPES pH 7.4, 120 mM KCl, 5 mM NaCl and 20 mM MgCl2, without any other auxiliary substances; 4) Universality: Applicable to labeling any RNA containing a substrate strand sequence. Attached Figure Description

[0018] Figure 1 The secondary structure of the N70-RNA library; Figure 2 Electrophoresis diagram of urea-denaturing polyacrylamide gel for preliminary analysis of the labeling activity of ribozyme strand RNA; Figure 3This is a graph showing the labeling efficiency of all ribozyme strand RNAs based on the grayscale of the bands, where Fractionated indicates the labeling efficiency. Figure 4 Electrophoretic images used to verify the interaction between substrate RNA and streptavidin protein before and after labeling for EMSA; Figure 5 This is a graph showing the molecular weight difference between unlabeled and labeled substrate RNA for mass spectrometry analysis. Figure 6 Map of marker sites for labeled substrate strand RNA identified by the shape method; Figure 7 Map of labeling sites on substrate strand RNA after labeling to validate mutants. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0020] RNA library preparation PCR amplification was performed using an N70-DNA library synthesized by a biotechnology company, with the sequence shown in SEQ ID NO.1, the forward primer shown in SEQ ID NO.2, and the reverse primer shown in SEQ ID NO.3. The DNA strands were then purified by isopropanol precipitation. Under buffer conditions of 100 mM HEPES pH 7.9, 60 mM DTT, and 0.1 mM spermidine, the purified DNA strands, nucleotide monomers (4 mM ATP, 4 mM CTP, 4 mM GTP, and 4 mM UTP), and 100 U / μL T7 RNA polymerase were mixed and incubated in a 37°C metal bath for in vitro transcription. The transcription product was the RNA library. The transcription product was subsequently purified by isopropanol precipitation, followed by urea-denaturing polyacrylamide gel electrophoresis to separate the target bands, gel extraction and recovery, and ethanol precipitation purification, ultimately yielding a high-purity RNA library as shown in SEQ ID NO.4.

[0021] The PCR reaction system is as follows: Forward primer: 1.2 μM primer 1; Reverse primer: 1.2 μM primer 2; 1x Taq buffer: 20 mM Tris-HCl (pH 9.0), 20 mM KCl, 10 mM (NH4)2SO4, 1.5 mM MgCl2; dNTP: 0.2 mM; Template: 100 nMN60-DNA library; DNA polymerase: 0.05 U / μL; The reaction procedure for PCR amplification is shown below: Pre-denaturation: 94℃, 3 min; Denaturation: 94℃, 30 s; Annealing: 58℃, 30 s; Extension: 72℃, 30 s; Cycling: repeat denaturation-annealing-extension for 15 cycles; Final extension: 72℃, 3 min; Storage: 4℃.

[0022] SEQ ID NO.1: 5'-GGACACAAGTTGACGCTGCCCGTCAGCCGAAAGGTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCGTCGCGCACTCATC-3' SEQ ID NO.2: 5'-CCGCGAAATTAATACGACTCACTATAGGACACAAGTTGACGCTGCCCGTCAGCCGAAAG-3' SEQ ID NO.3: 5'-CGCACTCATTTCGCCTCACGGCTCATCAGGACGGCTAGCCGTCGATGAGTGCGCGACGCTGCC-3' SEQ ID NO. 4: 5'-GGACACAAGUUGACGCUGCCCGUCAGCCGAAAGGUUGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCGUCGCGCACUCAUC-3'. like Figure 1 As shown, the secondary structure of the RNA library consists of 70 random nucleotide sequences and two sequence constant regions. The 5' end consists of a stem-loop structure and a sequence that pairs with the 3' end.

[0023] Screening process The RNA library was annealed under a buffer of 50 mM HEPES pH 7.4, 120 mM KCl, 5 mM NaCl, and 40 mM MgCl2, i.e., incubated in a 65°C metal bath for 5 min followed by incubation on ice for 30 min. Then, twice the molar amount of the ligand for the RNA library—12:0 biotin-coenzyme A (CAS No.: 2260670-05-9)—was added, and the reaction was carried out at 37°C for 16 h. After the reaction, the RNA library was recovered by ethanol precipitation and resuspended in 200 μL of binding buffer (20 mM HEPES pH 7.4, 0.5 M NaCl, 1 mM EDTA). The RNA library was then incubated with 100 μL of streptavidin agarose beads at room temperature for 1 h. After incubation, the supernatant was removed, and the precipitate was the biotin-labeled RNA library complex with streptavidin agarose beads. The precipitated complex was washed with 1 mL denaturing wash buffer (25 mM HEPES pH 7.4, 8 M Urea, 1 mM EDTA, 0.01% Tween-20) five times. The precipitated complex was then washed with 1 mL H2O twice. Finally, 100 μL of elution buffer (95% formamide, 1 mM EDTA) was added to the precipitated complex, and the mixture was incubated at 95°C for 10 min. The supernatant was then collected twice. The collected supernatant was the biotin-labeled RNA library. The supernatant was purified by ethanol precipitation and resuspended in 20 μL H2O, followed by reverse transcription-PCR amplification to obtain the DNA strands for the next round of library extraction.

[0024] The RNA library for the next round of screening was then prepared by repeating step (1), and the next round of screening was performed. The entire screening process consisted of 8 to 10 rounds. The screening pressure was increased by shortening the ligand incubation time or reducing the amount of RNA input in each round (pressure parameters are shown in Table 1), gradually enriching RNA sequences with high biotinylated activity. Finally, the final round product was sent for sequencing to obtain the sequence information of the ribozymes with biotinylated activity.

[0025] Table 1: Parameters for each round of screening Preparation of ribozyme chains and substrate chains The active sequence obtained from sequencing was split from the loop region GAAA of sequence constant region 2. Figure 1The 5' end of each RNA strand is a substrate strand with a sequence identical to that shown in SEQ ID NO. 5; the 3' end is a ribozyme strand with a different sequence. All of these sequences were constructed into the pUT-7 plasmid, and then purified by PCR amplification and isopropanol precipitation to obtain DNA containing these sequences. The purified DNA was mixed with nucleotide monomers (ATP, CTP, GTP, and UTP) and T7 RNA polymerase, and incubated in a 37°C metal bath for in vitro transcription to obtain substrate strand RNA and ribozyme strand RNA with the sequences shown in SEQ ID NO. 5, respectively.

[0026] SEQ ID NO.5: 5'-GGACACAAGUUGACGCUGCCCGUCAGCC-3' Identification of ribozyme labeling activity 4.1 Preliminary analysis of ribozyme strand RNA labeling activity using urea-denaturing polyacrylamide gel electrophoresis. Substrate strand RNA to a final concentration of 5 μM was mixed with 10 μM of different ribozyme strand RNAs and annealed in a buffer solution of 50 mM HEPES (pH 7.4), 120 mM KCl, 5 mM NaCl, and 20 mM MgCl2 (65°C metal bath for 5 min, followed by incubation on ice for 10 min). Then, 10 μM of 12:0 biotin-coenzyme A was added, and the reaction was carried out at 37°C for 16 h. The reaction mixture was then mixed with an equal volume of 2× loading buffer (8 M urea, 1× TBE, 0.1% bromophenol blue), and the biotin labeling of the substrate strand RNA by ribozyme strand RNA to substrate strand RNA was analyzed by urea denaturing polyacrylamide gel electrophoresis.

[0027] Because the labeled substrate RNA carries biotin, its molecular weight is larger than that of the unlabeled substrate RNA, causing its electrophoretic band to lag behind that of the unlabeled substrate RNA. Therefore, the brighter the lag substrate RNA band, the stronger the biotin labeling activity of the ribozyme RNA for the substrate RNA. Figure 2 The biotin-labeling capability of all ribozyme strand RNAs was demonstrated. Figure 3 The labeling efficiency of all ribozyme strand RNAs quantified based on band grayscale is shown. The five sequences with the strongest labeling activity are named SEQ ID NO.6 ~ SEQ ID NO.10 in descending order of activity, and their sequences are as follows: SEQ ID NO.6: GGCUGUCGGUCCGCUGUACGGUUCUGGCGUACGUUAGUGUGCGUAAAUCGUCGAGCUUCUCUCGCGUUUCCAGGUGGGCAGCGUCGCGCACUCAUC SEQ ID NO.7: GGCUGUCGGUCCGCUGUGCGGUUCUGGCGUACGUUAGUGUGCGUAAAUCGUCGAGCUUCUCUCGCGUUUCCAGGUGGGCAGCGUCGCGCACUCAUC SEQ ID NO.8: GGCUGUCGGUCCGCUGUGCGGUUCUGGCGUACGUUAGUGUGCGUAAAUCGUCGAGCUCUCUCGCGUUUCCAGGUGGGCAGCGUCGCGCACUCAUC SEQ ID NO.9: GGCUGUCGGUCCGCUGUGCGGUUCUGGCGUACUCUAGUGUGCGUAAAUCGUCGAGCUUCUCUCGCGUUUCCAGGUGGGCAGCGUCGCGCACUCAUC SEQ ID NO.10: GGCUGUCGGUCCGCUGUGCGGUUCUGGCGUACUCUAGUGUGCGUAAAUCGUCGAGCUCUCUCGCGUUUCCAGGUGGGCAGCGUCGCGCACUCAUC 4.2 Obtaining labeled substrate RNA The substrate RNA (SEQ ID NO. 5) at a final concentration of 30 μM was mixed with the RNA containing the most active labeled ribozyme sequence as shown in SEQ ID NO. 6 and annealed in a buffer solution of 50 mM HEPES pH 7.4, 120 mM KCl, 5 mM NaCl, and 20 mM MgCl2, i.e., incubated at 65°C in a metal bath for 5 min, followed by incubation on ice for 10 min. Then, 12:0 biotin-coenzyme A at a final concentration of 60 μM was added, and the reaction was carried out at 37°C for 16 h.

[0028] After the reaction, RNA was recovered from the reactants by ethanol precipitation and resuspended in binding buffer (20 mM HEPES pH 7.4, 0.5 M NaCl, 1 mM EDTA). The RNA at this point was a mixture of ribozyme strand RNA, unlabeled substrate strand RNA, and labeled substrate strand RNA. The RNA mixture was then incubated with streptavidin agarose beads at room temperature for 1 h. After incubation, the supernatant was removed, and the precipitate was the complex of labeled substrate strand RNA and streptavidin agarose beads. The precipitate complex was washed with 1 mL denaturing wash buffer (25 mM HEPES pH 7.4, 8 M Urea, 1 mM EDTA, 0.01% Tween-20), repeated 5 times. The precipitate complex was then washed with 1 mL H2O, repeated twice. Finally, 100 μL of elution buffer (95% formamide, 1 mM EDTA) was added to the precipitated complex, and the mixture was incubated in a 95°C metal bath for 10 min. The supernatant was then collected, and this process was repeated twice. The supernatant was purified by ethanol precipitation and resuspended in 20 μL of H2O to obtain the labeled substrate RNA.

[0029] 4.3 Verification of biotin-carrying substrate RNA after labeling using EMSA method Ribozyme strand RNA, labeled reaction mixture, unlabeled substrate strand RNA, and labeled substrate strand RNA obtained in step 4.2 were incubated with streptavidin protein at room temperature for 1 h. A control group without streptavidin protein was also included for all samples. EMSA analysis of all samples showed hysteresis bands in both the labeled substrate strand-streptavidin protein complex and the labeled reaction mixture-streptavidin protein complex. Figure 4 The red arrow indicates the migration band generated after binding to streptavidin protein, confirming the success of biotin labeling.

[0030] 4.4 Mass spectrometry verification confirmed that the labeled substrate RNA contained biotin. Unlabeled substrate RNA and labeled substrate RNA obtained in step 4.2 were dialyzed into 0.1 M NH4OAc using a 3.5 kDa dialysis bag, with the dialysate changed multiple times. High-resolution quadrupole time-of-flight mass spectrometry (Q-TOFMS, ESI mode) analysis showed that the molecular weight of the labeled substrate RNA was 423.3 Da higher than that of the unlabeled substrate RNA. Figure 5 The result is highly consistent with the theoretical value of 424.2 Da of the product of cleavage of 12:0 biotin-coenzyme A from the acetyl group, proving that the labeled substrate RNA strand carries a biotin group.

[0031] Marker site identification 5.1 SHAPE Analysis Because the labeled substrate RNA carries a biotinylate label, this labeling can cause steric hindrance, affecting the reverse transcription process. Therefore, the labeling site can be determined by analyzing the termination site of the labeled substrate RNA in the reverse transcription experiment. Reverse transcription was performed on both labeled and unlabeled substrate RNA, with ddNTP termination reactions used as base position references. Figure 6 As shown, the sequencing gel revealed that the reverse transcription product of the labeled substrate RNA terminated at the G12 site, suggesting that the labeling site was located at the adjacent U11 nucleotide.

[0032] 5.2 Site Mutation Verification The labeling site U11 of substrate RNA SEQ ID NO.5 was mutated to U11G / U11A / U11C / U11dT, and named SEQ ID NOs 11-14, respectively. The labeling ability of RNA with the ribozyme sequence SEQ ID NO.6 for these mutated substrate chains was then identified. The results are as follows: Figure 7 As shown, the RNA with SEQ ID NO.6 can label wild-type substrate chain RNA and mutant substrate chains U11G / U11A / U11C RNA, but it completely loses labeling activity for the deoxythymidine mutant (U11dT), indicating that the RNA with SEQ ID NO.6 labels biotin to the 2'-OH of the ribose of substrate chain U11.

[0033] SEQ ID NO.11: 5'-GGACACAAGUGGACGCUGCCCGUCAGCC-3' SEQ ID NO.12: 5'-GGACACAAGUAGACGCUGCCCGUCAGCC-3' SEQ ID NO.13: 5'-GGACACAAGUCGACGCUGCCCGUCAGCC-3' SEQ ID NO.14: 5'-GGACACAAGU(dT)GACGCUGCCCGUCAGCC-3' Application of ribozymes A ribozyme-specific recognition sequence, i.e., the substrate strand sequence as shown in SEQ ID NO.5 (5'-GGACACAAGUUGACGUUGCCCCGACGGCU-3'), was introduced at the 5' end of the target RNA to be biotin-labeled. 5 μM of the target RNA was mixed with 10 μM of RNA containing the ribozyme sequence SEQ ID NO.6 in a buffer solution of 50 mM HEPES pH 7.4, 120 mM KCl, 5 mM NaCl, and 20 mM MgCl2. The mixture was incubated at 65°C for 5 min in a metal bath and then on ice for 10 min. Subsequently, 10 μM of 12:0 biotin-coenzyme A was added, and the mixture was incubated at 37°C for 16 h. The labeled target RNA was separated by urea-denaturing polyacrylamide gel electrophoresis or enriched using streptavidin magnetic beads.

[0034] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A ribozyme for labeling biotin onto target RNA, characterized in that, The nucleotide sequence of the ribozyme is shown in SEQ ID NO.6 ~ SEQ ID NO.

10.

2. The ribozyme for labeling biotin onto target RNA as described in claim 1, characterized in that, The ribozyme is capable of transferring 12:0 biotin-CoA to the 5' end of the substrate RNA, wherein the substrate RNA sequence is shown in SEQ ID NO.5, SEQ ID NO.11~SEQ ID NO.

13.

3. The ribozyme for labeling biotin onto target RNA as described in claim 1, characterized in that, The ribozyme comprises a variant sequence that has at least 80% sequence identity with the sequences shown in SEQ ID NO. 6 to SEQ ID NO. 10 and retains biotinylate labeling activity.

4. The ribozyme for labeling biotin onto target RNA as described in claim 1, characterized in that, The nucleotide sequence of the ribozyme includes bases with labels or chemical modifications, wherein the labels include one or more of isotope labels, fluorescent labels, biotin labels, enzyme labels, and chemiluminescent labels; and the chemical modifications include one or more of methylation, amination, thiolation, phosphorylation, thiolation, carboxylation, and isotopeation.

5. A method for screening biotinylated ribozymes labeled with target RNA according to any one of claims 1-4, characterized in that, The method includes the following steps: (1) After obtaining PCR products by PCR amplification using forward primers, reverse primers, and N70-DNA library, high-concentration RNA library was obtained by in vitro transcription, electrophoresis, gel recovery, and precipitation with isopropanol. (2) Anneal the RNA library obtained in step (1), add 12:0 biotin-coenzyme A at twice the molar amount of the RNA library, and react at 37°C for 16 h. (3) The RNA library after the reaction was recovered by ethanol precipitation and resuspended, and incubated with 100 μL streptavidin agarose beads at room temperature for 1 h. The precipitate was collected to obtain the complex of the RNA library with biotin-labeled activity and streptavidin agarose beads. (4) Wash the complex from step (3) 5 times with 1 mL of washing buffer, and wash the precipitated complex 2 times with 1 mL of water; (5) Add 100 μL of elution buffer, let stand at 95°C for 10 minutes, and take the supernatant; (6) Repeat step (5) to obtain an RNA library with biotinylated activity; (7) Repeat steps (1) to (6) for 8 to 10 rounds. The RNA library obtained in each round of step (6) is used as a template for the next round of step (1) after reverse transcription and PCR amplification. (8) Finally, the ribozyme with nucleotide sequences as shown in SEQ ID NO.6 ~ SEQ ID NO.10 was obtained.

6. The screening method as described in claim 5, characterized in that, In step (1), the N70-DNA library is shown in SEQ ID NO.1, the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

7. The screening method as described in claim 5, characterized in that, In step (2), the annealing process involves placing the RNA library in a 65°C metal bath for 5 minutes and then incubating it on ice for 30 minutes.

8. The screening method as described in claim 5, characterized in that, In step (4), the washing buffer contains 25 mM HEPES pH 7.4, 8 M Urea, 1 mM EDTA, and 0.01% Tween-20; in step (5), the elution buffer contains 95% formamide and 1 mM EDTA.

9. The use of the ribozyme according to any one of claims 1-4 in the preparation of a product labeled with biotin on target RNA.

10. The application as described in claim 9, characterized in that, The products include reagent kits, biosensors, and detection chips.

Images