S100A4 protein for regulating immune response as well as preparation method and application of S100A4 protein
By combining HaloTag fusion expression with solid-phase affinity purification, the problems of low purity and insufficient activity in the existing preparation of S100A4 protein have been solved, and efficient and high-purity preparation of S100A4 protein has been achieved, which is suitable for immunomodulatory research, especially the differentiation and activation of γδT cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-06
- Publication Date
- 2026-04-07
AI Technical Summary
Existing methods for preparing S100A4 protein suffer from high costs, low purity, numerous impurities, and insufficient activity. Furthermore, commercially available products are expensive, which affects the results of immunoassay experiments.
A strategy combining HaloTag fusion expression and solid-phase affinity purification was adopted. The Halo-S100A4 eukaryotic expression vector was constructed, the fusion protein was specifically captured by HaloLink™ resin, and the S100A4 protein was released by HaloTEV protease at a specific recognition site. This simplified the purification steps and improved the purity and activity.
This study achieved efficient and high-purity preparation of S100A4 protein, avoiding protein degradation and loss of activity. It is suitable for immunomodulatory research, especially for activating or promoting the differentiation of γδT cells, providing important experimental evidence and material basis.
Smart Images

Figure CN121801966A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and in particular to an S100A4 protein that regulates immune responses, its preparation method, and its applications. Background Technology
[0002] The S100A4 protein (calcium-binding protein) participates in various cellular processes, including motility, angiogenesis, cell differentiation, apoptosis, and autophagy. It enhances cell motility and invasiveness by interacting with non-muscle myosin heavy chain (NMMHC) IIA / MYH9. Mechanistically, it promotes filament depolymerization and increases the content of soluble myosin IIA, thereby forming stable protrusions and promoting chemotaxis. It also regulates the pro-apoptotic function of TP53 by binding to the C-terminal transactivation domain of TP53 in the cell nucleus and reducing its protein levels. In the extracellular space, it stimulates the production of cytokines, including granulocyte colony-stimulating factor (CCL24) in T lymphocytes.
[0003] Furthermore, it stimulates T lymphocyte chemotaxis by acting as a chemo-inducible complex, promoting lymphocyte migration via the PGLYRP1 chemo-inducible complex through CCR5 and CXCR3 receptors. Our self-developed eukaryotic expression S100A4 purified protein has significant advantages over mainstream products on the market: Compared to prokaryotic expression proteins, it can complete the eukaryotic-specific post-translational modifications, has a conformation consistent with the natural protein, possesses high activity without refolding, and offers faster preparation speed, higher purity, and a simpler method, avoiding the problems of residual impurities and insufficient activity in prokaryotic proteins; Compared to traditionally extracted natural proteins, it overcomes raw material limitations, has controllable yield, strong batch stability, and purity far exceeding that of natural extracts, while solving the pain points of traditional methods such as long processing time, cumbersome procedures, and high hidden costs; Compared to ordinary eukaryotic expression proteins on the market, it significantly shortens the preparation cycle and simplifies purification steps while maintaining the high activity advantage of eukaryotic proteins, reducing costs and improving purity, balancing activity, efficiency, and economy, and is more suitable for the high-frequency experimental needs of scientific research. Summary of the Invention
[0004] The purpose of this invention is to provide an S100A4 protein that regulates immune responses, its preparation method, and its applications. Because experiments require determining whether S100A4 activates the differentiation of γδT cells, commercially available S100A4 proteins are relatively expensive and often contain other components that affect experimental results. Therefore, a novel method for preparing S100A4 protein has been designed.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a method for preparing S100A4 protein that regulates immune responses, comprising the following steps: (1) Construction of eukaryotic expression vector: The vector encodes a fusion protein containing the HaloTag protein tag and the S100A4 protein; (2) The vector is introduced into a host cell for expression to obtain cells expressing the fusion protein; (3) Lyse the cells obtained in step (2) and collect the lysate supernatant containing the fusion protein; (4) The lysis supernatant is mixed with a solid affinity medium that can specifically bind the HaloTag protein tag, so that the fusion protein binds to the solid affinity medium through the HaloTag tag; (5) Washing the solid-phase affinity medium containing the fusion protein to remove impurities; (6) Using the solid-phase affinity medium obtained in step (5) of the protease treatment that is capable of cleaving at a specific recognition site between the HaloTag tag and the S100A4 protein, the liquid component containing the cleaved and released S100A4 protein is then collected. (7) Remove the residual solid phase medium from the liquid component collected in step (6) to obtain purified S100A4 protein.
[0006] Preferably, the eukaryotic expression vector is a HaloTag mammalian expression vector; the coding sequence of the S100A4 protein is preceded by a V5 tag sequence.
[0007] Preferably, in step (2), the host cell is a 293T cell and the transfection reagent is lipo2000.
[0008] Preferably, in step (4), the solid-phase affinity medium is a HaloLink™ resin covalently coupled with chloroalkyl ligands, and the fusion protein binds to the resin at 3~5°C for 10~15h.
[0009] Preferably, in step (6), the protease is HaloTEV protease, and the cleavage condition is shaking at 22~25℃ for 1.5~2.5h.
[0010] Preferably, in step (1), the nucleotide sequence of the vector is as shown in SEQ ID NO: 1.
[0011] This invention provides an S100A4 protein, which is prepared by the method described above.
[0012] This invention provides the application of the S100A4 protein in the preparation of reagents or drugs for regulating immune responses.
[0013] Preferably, the regulation of the immune response includes activating or promoting the differentiation of γδT cells.
[0014] Compared with the prior art, the present invention has the following beneficial effects: First, this invention innovatively employs a strategy combining HaloTag fusion expression with solid-phase affinity purification, successfully achieving efficient and high-purity preparation of the S100A4 protein. By constructing the Halo-S100A4 eukaryotic expression vector, specifically capturing the fusion protein using HaloLink™ resin, and cleaving and releasing the target protein at specific recognition sites using HaloTEV protease, not only is purification efficiency significantly improved, but the protein degradation or activity loss problems common in traditional methods are also avoided. This method is simple to operate, has good reproducibility, and is suitable for large-scale preparation, providing a reliable protein source for subsequent functional studies.
[0015] Secondly, the S100A4 protein prepared by this invention exhibits excellent biological activity and structural integrity. Due to the use of a eukaryotic expression system, the protein can undergo correct post-translational modifications, and its conformation is highly consistent with the natural protein, achieving high activity without complex refolding steps. Compared to commercially available prokaryotically expressed or naturally extracted S100A4 proteins, the protein obtained by this invention has higher purity and fewer impurities, avoiding interference from exogenous components in experimental results, making it particularly suitable for immunomodulatory studies with stringent requirements for protein activity.
[0016] Finally, in terms of application value, the S100A4 protein provided by this invention exhibits clear functional potential in regulating immune responses, particularly in effectively activating or promoting the differentiation of γδT cells. This provides important experimental evidence and material basis for the development of S100A4-based immunomodulatory reagents or drugs. This method balances preparation efficiency, cost control, and product quality, possessing high prospects for scientific research and translational applications, and can provide new tools and ideas for research and treatment in related fields such as tumor immunology and inflammatory diseases. Attached Figure Description
[0017] Figure 1 The sequencing peak results after the Halo-S100A4 vector (around 70~120bp).
[0018] Figure 2 The sequencing peak results after the Halo-S100A4 vector (around 410~440bp).
[0019] Figure 3 To verify the protein expression map (approximately 46.1 kDa, band is correct).
[0020] Figure 4 The image below shows the preparation results of S100A4 protein (the arrow in the image below points to the S100A4 protein purified by this preparation method, approximately 13.1 kDa, with a concentration of 0.18 mg / ml after BCA assay).
[0021] Figure 5 The image shows the experimental results of EDU.
[0022] Figure 6 A graph showing the statistical differences in EDU experimental results. Detailed Implementation
[0023] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0024] Example 1
[0025] This invention provides a method for preparing S100A4 protein to regulate immune responses. The main principle is to first construct a Halo-S100A4 overexpression vector (band approximately 46.1 kDa), then fuse the S100A4 protein (band approximately 13.1 kDa after adding the V5 tag) with a HaloTag tag (a 33-34 kDa mutant hydrolase derivative) for expression. The results are as follows... Figure 1 , 2 3.
[0026] HaloLink™ resin, immobilized with chloroalkyl ligands, rapidly forms stable and irreversible covalent bonds with the HaloTag tag in the expressed fusion protein, specifically capturing the fusion protein without loss even after rigorous washing. The fusion protein is then cleaved with TEV protease to separate it from the resin. The N-terminal HQ tag of the TEV protease can be further separated from the target protein by the HisLink™ resin, ultimately yielding purified S100A4 protein. Figure 4 (The band below 15kDa).
[0027] The specific preparation steps are as follows: S1: Construct the Halo-S100A4 eukaryotic expression vector (fuse the S100A4 protein with the HaloTag tag for expression, and add a V5 tag before the S100A4 sequence for easy detection later), and send it to a relevant biotechnology company for construction using double enzyme digestion.
[0028] S2: Sequencing after the Halo-S100A4 recombinant vector was returned revealed a frameshift mutation due to an extra base. Primers were redesigned for seamless cloning. Halo vector cloning primers R:CGGTTGAGCTCTGAATTCGGAAGCGATCGC (as shown in SEQ ID NO: 2) F:TCTAGATTTGGGCCCAATTCCTGCAGGATT (as shown in SEQ ID NO: 3) S100A4 gene cloning primers (for seamless cloning to the Halo vector) F:GCGATCGCTTCCGAATTCAGAGCTCAACCGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGATGGCGTGCCCTCTGGAGAAG (as shown in SEQ ID NO: 4) R:AATCCTGCAGGAATTGGGCCCAAATCTAGATCATTTCTTCCTGGGCTGCTTATC (as shown in SEQ ID NO: 5) S3: The sequence was sent to the relevant biotechnology company again for sequencing, and the sequence was found to be correct.
[0029] The results are shown in SEQ ID NO: 1.
[0030] TCCGAATTCAGAGCTCAACCGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGATGGCGTGCCCTCTGGAGAAGGCCCTGGATGTGATGGTGTCCACCTTCCACAAGTACTCGGGCAAAGAGGGTGACAAGTTCAAGCTCAACAAGTCAGAACTAAAGGAGCTGCTGACCCGGGAGCTGCCCAGCTTCTTGGGGAAAAGGACAGATGAAGCTGCTTTCCAGAAGCTGATGAGCAACTTGGACAGCAACAGGGACAACGAGGTGGACTTCCAAGAGTACTGTGTCTTCCTGTCCTGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGATCTAGATTTGGGCCCAATTCCTGCAGGATTTTGCGGCCGCTTGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTTAAGCAAGTAAAACCTCTACAAATGTGGTAAAATCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGCGGATCTGCGCAGCACCATGGGCCTGAAATAACCTCTGAAAGATGAACTTGGGTTAGTACCTTCTGAGCGGAAGACCAGCTGTGGAATGTGTGTCAGTTAGGTGTGGAAAGTCCCCAGGCTCCCCCAGT
[0031] S4: Western blot analysis was performed on 293T cell samples from a single well in a 48-well plate. An empty Halo plasmid was used as a control to assess the success rate of transient transfection and the expression level of the target protein. The detected bands were between 55-40 kDa, and the control group showed no bands, indicating that the plasmid was constructed correctly. Figure 3 ). Figure 1 , 2 The sequencing results of the constructed Halo-S100A4 vector show that the S100A4 protein with the V5 tag was indeed inserted into the Halo vector, and the peaks were normal.
[0032] S5: One day before transfection, seed 293T cells into two 15cm culture dishes, add 20ml of antibiotic-free complete culture medium to each well, and culture until the cell density reaches 70%~90% (to ensure that the cells are in good condition at the time of transfection).
[0033] S6: Preparation of DNA / liposome complex. Take 1.5 ml of serum-free medium or Opti-MEM, add 150 μg of plasmid DNA (prepared in step S3), mix gently, and incubate at room temperature for 5 min. Take another 3 ml of serum-free medium, add 300 μL of Lipo2000, mix gently, and incubate at room temperature for 5 min. Combine the two solutions, gently pipette 5 times, and incubate at room temperature for 20 min (to form a stable complex; avoid prolonged incubation).
[0034] Discard the old culture medium from the culture dish containing 293T cells and add 1.5 ml of serum-free culture medium. Slowly add 1.5 ml of the prepared complex to each well, gently shake the culture plate to distribute it evenly, and incubate at 37°C and 5% C. After 6 hours in the incubator, the culture medium containing the complex was aspirated and replaced with 20 ml of fresh complete culture medium, and the culture was continued.
[0035] S7: After 48 hours, gently wash the adhered cells with PBS, then scrape the bottom and gently collect the cells with a sterile scraper. Centrifuge the cells at 200×g for 5 minutes and discard the supernatant. Resuspend the cell pellet in 1.25 ml of NP40 (NP40 to cell culture is approximately 1 ml: 2–6 × 10⁻⁶). 7 (Ensure cells are fully lysed). Add 50 μL of a 50× protease inhibitor mixture, sonicate on ice using 10-second pulses, with a 10-second cooling time between each cycle, for a total of 1 minute, at a power output of 2.5 (3~6W). Then, lyse on a rotating disc at 4°C for 30 minutes, centrifuge at 10,000×g for 15 minutes at 4°C, and collect the cell lysate supernatant (add 1 ml of NP40 to the cell pellet and run a Western blotting test later to check for complete cell lysis).
[0036] S8: Resuspend the HaloLink resin by thoroughly inverting the bottle. Add 200 μl of HaloLink resin slurry to a 2 ml EP tube (resin to cell culture ratio approximately 200 μl: 2–6 × 10⁻⁶). 7 Centrifuge at 1500×g for 5 min at room temperature and discard the supernatant. Add 1.25 ml of NP40 to the EP tube; invert and mix well, place on a turntable and rotate for 5 min, centrifuge at 1500×g for 5 min at room temperature, discard the supernatant, and repeat 4 times, for a total of 5 washes. Do not remove the supernatant after the last wash before use.
[0037] S9: Discard the supernatant from step S8 and add the cell lysate supernatant (prepared in S7) to the resin. Mix thoroughly by inverting, place the tube on a tube vortex mixer, and incubate overnight at 4°C (ensure the rotation / shaking speed is sufficient to keep the resin suspended).
[0038] S10: On the second day, centrifuge at 1500×g for 5 min, remove the supernatant (transfer to another test tube for analysis of binding efficiency).
[0039] S11: Wash the resin obtained in step S10 with 1.5 ml of NP40; invert and mix thoroughly, then mix on a turntable for 10 min (Note: Ensure the rotation / shaking speed is sufficient to keep the resin suspended). Centrifuge at 1500 × g for 5 min. Discard the supernatant. Repeat the washing 3 times. After the final wash, do not remove the supernatant before use.
[0040] S12: Add 50 μl of HaloTEV protease to 300 μl of NP40 solution, discard the supernatant from step S11, and add 6 μl of HaloTEV protease cleavage solution to the settled resin (HaloTEV to cell culture is approximately 6 μl: 2–6 × 10⁻⁶). 7 (The number of cells can be adjusted according to the actual situation); after mixing, shake on a mixing vortex mixer for 2 hours at room temperature (22~25°C). Then, centrifuge at 1,500×g for 5 minutes to collect the supernatant (elution buffer 1). To ensure no resin elution, transfer eluent 1 to a new 1.5 ml EP tube. Centrifuge at 10,000×g for 15 seconds.
[0041] S13: Add 300 μl of NP40 solution to the resin obtained in step S12, mix thoroughly, and rotate on a turntable at room temperature for 30 minutes. Then centrifuge at 1,500×g for 5 minutes to collect the supernatant (elution buffer 2). To ensure no resin elution, transfer the eluent to a new 1.5 ml EP tube. Centrifuge at 10,000×g for 15 seconds.
[0042] S14: Repeat step S13 to obtain eluent 3.
[0043] S15: To ensure the eluent is resin-free, centrifuge eluents 1, 2, and 3 (10,000 × g, 1 min) and transfer them to new 1.5 ml EP tubes. Reserve 30 μl of each eluent for concentration testing. (Add 300 μl of NP40 to the eluted resin for later elution efficiency testing.)
[0044] Experimental Example 1
[0045] 24-well plates were seeded using 293T plasmids. The next day, Halo-S100A4 plasmids were instantaneously transfected with empty Halo plasmids as controls. Western blotting was performed 48 hours later to verify protein expression. Figure 3 As can be seen, compared with the empty Halo transfection group, the Halo-S100A4 overexpression group has a band in the 55~40kDa range, indicating that the vector was successfully constructed and the protein was successfully expressed.
[0046] Experiment Example 2
[0047] In Experiment 1, successful protein expression was confirmed. Next, the S100A4 protein was purified. Following the method in Example 1, the purification efficiency was verified by Western blotting using the supernatant obtained in step S10 (4°C overnight incubation with resin), eluents ①, ②, and ③ (in S12, 13, and 14), resin precipitate (in S15), and cell precipitate (in S7) (the loading order was the same). The results showed that most of the protein bound to the resin was successfully cleaved by the TEV enzyme. The eluent ① was analyzed using a BCA kit. The specific steps were as follows: Mix reagent A and reagent B at a volume ratio of 50:1 (e.g., 2 mL A + 40 μL B) and mix thoroughly. Add 5 μL of BSA standards of different concentrations to each well of a 96-well plate. -A1: 5 μL PBS (0 mg / mL, blank) -A2: 5 μL 0.125 mg / mL BSA -A3: 5 μL 0.25 mg / mL BSA -A4: 5 μL 0.5 mg / mL BSA -A5: 5 μL 1.0 mg / mL BSA -A6: 5μL 2.0 mg / mL BSA Take 5 μL of the original sample and add 45 μL of PBS, then mix thoroughly. The sample is now diluted 10-fold. Add 5 μL of the diluted sample to each well of a 96-well plate. Add 100 μL of working solution to each well (standard and sample wells) and gently vortex to mix. Incubate the 96-well plate at 37°C for 30 min. Remove the plate, cool to room temperature, and measure the absorbance at 562 nm using a microplate reader.
[0048] A standard curve was plotted using the absorbance of the standards, and a regression equation was obtained. Substituting the sample absorbance into the equation, the original concentration was finally measured to be 0.18 mg / mL.
[0049] Experimental Example 3
[0050] The activity of the protein extracted using the above method was detected by EDU assay. Figure 5 The specific procedure involved seeding two wells of a 24-well plate with huh7 cells whose S1000A4 levels were knocked down, at a density of approximately 50%. After cell adhesion, a self-prepared S100A4 protein was added at concentrations of 0 ng / ml and 10 ng / ml, respectively. The experimental results showed that the self-prepared S100A4 protein promoted cell proliferation, indirectly indicating its protein activity. The following are the standard operating procedures for a 24-well plate: 1. Cell Culture and EdU Incorporation: Seed cells in 24-well plates and allow them to adhere and grow to a suitable density (approximately 50%-80%). Add EdU working solution, typically at a concentration of 10 μM. Incubate at 37°C for 30 min.
[0051] 2. Cell fixation: Aspirate the culture medium and wash the cells once with PBS. Add 4% paraformaldehyde (PFA) and fix at room temperature for 15 min. Aspirate the PFA and wash the cells once with PBS.
[0052] 3. Permeabilization: Add 0.5% Triton X-100 (dissolved in PBS) and permeabilize at room temperature for 15 min. Aspirate the permeabilization solution and wash the cells once with PBS.
[0053] 4. EdU detection: Prepare Click reaction solution (containing azide fluorescent probe, CuS) Add 200 μl of reaction solution to each well and incubate at room temperature in the dark for 30 min. Aspirate the reaction solution and wash the cells 1–2 times with PBS.
[0054] 5. DNA staining: Add 250 μL of PBS containing Hoechst 33342 (or DAPI) and incubate at room temperature in the dark for 10 min to stain the cell nuclei. Aspirate the staining solution and wash the cells 1–2 times with PBS.
[0055] 6. Fluorescence microscopy observation: Under a fluorescence microscope, EdU (proliferating cells): excitation wavelength approximately 494 nm, emission wavelength approximately 519 nm (green fluorescence). Hoechst / DAPI (all cell nuclei): excitation wavelength approximately 350 nm, emission wavelength approximately 461 nm (blue fluorescence).
[0056] 7. Results are as follows Figure 5 As shown, Figure 6 This is a statistical chart of the data.
[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for preparing S100A4 protein that regulates immune responses, characterized in that, Includes the following steps: (1) Construction of eukaryotic expression vector: The vector encodes a fusion protein containing the HaloTag protein tag and the S100A4 protein; (2) The vector is introduced into a host cell for expression to obtain cells expressing the fusion protein; (3) Lyse the cells obtained in step (2) and collect the lysate supernatant containing the fusion protein; (4) The lysis supernatant is mixed with a solid affinity medium that can specifically bind the HaloTag protein tag, so that the fusion protein binds to the solid affinity medium through the HaloTag tag; (5) Washing the solid-phase affinity medium containing the fusion protein to remove impurities; (6) Using the solid-phase affinity medium obtained in step (5) of the protease treatment that is capable of cleaving at a specific recognition site between the HaloTag tag and the S100A4 protein, the liquid component containing the cleaved and released S100A4 protein is then collected. (7) Remove the residual solid phase medium from the liquid component collected in step (6) to obtain purified S100A4 protein.
2. The preparation method according to claim 1, characterized in that, The eukaryotic expression vector is a HaloTag mammalian expression vector; the coding sequence of the S100A4 protein is preceded by a V5 tag sequence.
3. The preparation method according to claim 1, characterized in that, In step (2), the host cell is 293T cell and the transfection reagent is lipo2000.
4. The preparation method according to claim 1, characterized in that, In step (4), the solid-phase affinity medium is a HaloLink™ resin covalently coupled with chloroalkyl ligands, and the fusion protein binds to the resin at 3~5°C for 10~15h.
5. The preparation method according to claim 1, characterized in that, In step (6), the protease is HaloTEV protease, and the cleavage condition is shaking at 22~25℃ for 1.5~2.5h.
6. The preparation method according to claim 1, characterized in that, In step (1), the nucleotide sequence of the vector is shown in SEQ ID NO:
1.
7. An S100A4 protein, characterized in that, It is prepared by the method described in any one of claims 1 to 6.
8. The use of the S100A4 protein of claim 7 in the preparation of a reagent or drug for regulating an immune response.
9. The application according to claim 8, characterized in that, The regulation of the immune response includes activating or promoting the differentiation of γδT cells.