Application of mycobacterium tuberculosis Rv3364c protein in preparation of anti-inflammatory drug and anti-inflammatory drug
By interfering with the cGAS-STING signaling pathway through the Mycobacterium tuberculosis Rv3364c protein, the secretion of multiple inflammatory cytokines was inhibited, thus resolving the inflammatory imbalance caused by Mycobacterium tuberculosis infection and achieving anti-inflammatory effects through multiple pathways.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-25
- Publication Date
- 2026-04-10
AI Technical Summary
Current technologies lack effective methods to inhibit the excessive production of inflammatory factors caused by Mycobacterium tuberculosis infection, leading to inflammatory imbalance and disease exacerbation.
By using the Mycobacterium tuberculosis Rv3364c protein to interfere with the cGAS-STING signaling pathway and inhibit the secretion of inflammatory cytokines such as IFN-α, IFN-β, IL-1β and IL-6, the protein was expressed in host cells via a recombinant vector.
It significantly reduced the expression of inflammatory factors such as IFN-α, IFN-β, IL-1β and IL-6, providing anti-inflammatory effects through multiple pathways and avoiding tissue damage caused by excessive inflammatory activation.
Smart Images

Figure CN121818894A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the application of Mycobacterium tuberculosis Rv3364c protein in the preparation of anti-inflammatory drugs and an anti-inflammatory drug, belonging to the field of biotechnology. Background Technology
[0002] Tuberculosis is caused by Mycobacterium tuberculosis (Mycobacterium tuberculosis) Mycobacterium tuberculosis , M.tb Tuberculosis is a chronic infectious disease caused by infection that seriously endangers public health. It is also one of the leading infectious diseases causing death from a single source of infection. The burden of tuberculosis has been further exacerbated by the emergence of widely resistant and multidrug-resistant strains and co-infection with human immunodeficiency virus (HIV).
[0003] The cGAS-STING signaling pathway is a core mechanism in mammalian cells for sensing abnormal cytoplasmic DNA and initiating immune defense, playing a crucial role in various physiological and pathological processes such as anti-infection, anti-tumor, autoimmunity, and inflammation regulation. This pathway senses pathogen DNA or leaked host DNA (such as mitochondrial DNA or genomic DNA), catalyzes the synthesis of the second messenger cGAMP, which in turn activates the STING protein, ultimately inducing the production of type I interferon and pro-inflammatory cytokines, thus initiating the innate immune response. After Mycobacterium tuberculosis infects the body, it is first phagocytosed by alveolar macrophages, which then play a crucial role in the fight against infection. M.tb Macrophages play a crucial role in the infection process. Furthermore, the inflammatory response, primarily driven by macrophages, has a dual effect. On one hand, key cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-1 (IL-1) are essential for establishing a protective immune response; on the other hand, excessive or insufficient production of these cytokines can lead to inflammatory imbalance, thereby promoting the progression of the disease to active tuberculosis.
[0004] However, overactivation of inflammatory signaling pathways can lead to the abnormal accumulation of inflammatory factors, thereby driving the development of various inflammatory diseases and autoimmune diseases. Within the complex network of mechanisms mediating this excessive inflammatory damage, the activation of the cGAS-STING signaling pathway plays a crucial role. This sustained inflammatory response mediated by the cGAS-STING signaling pathway disrupts the body's immune homeostasis, amplifies the inflammatory cascade, and ultimately becomes a key pathogenic link driving tissue damage progression. Therefore, the activation of inflammatory signaling pathways needs to be strictly regulated to prevent overactivation and the abnormal release of downstream inflammatory factors. Studies have shown that inhibiting various stages of cGAS-STING signaling can effectively control the inflammatory response caused by infection, preventing and treating a series of local and systemic adverse consequences resulting from infection.
[0005] In summary, there is an urgent need in this field to develop an immunologically active substance that can effectively inhibit the production of excessive inflammatory factors induced by mycobacterial infection. Summary of the Invention
[0006] Objective of the Invention: The first objective of this invention is to provide the use of Mycobacterium tuberculosis Rv3364c protein to exert anti-inflammatory effects by interfering with the cGAS-STING signaling pathway, thereby addressing the lack of effective methods for reducing inflammatory factors in the prior art. The second objective of this invention is to provide an anti-inflammatory drug.
[0007] Technical solution: The application of the Mycobacterium tuberculosis Rv3364c protein and / or products expressing Mycobacterium tuberculosis Rv3364c protein described in this invention in the preparation of anti-inflammatory drugs.
[0008] Furthermore, the amino acid sequence of the Rv3364c protein is shown in SEQ ID NO:1.
[0009] SEQ ID NO: 1: MKARLPDSPLDWLVSKFAREVPGVAHALLVSVDGLPVAASEHLPRERADQLAAVTSGLASLAGGAAQLFDGGQVLQSVVEMQNGYLLLMQVGDGSALAALAATGCDIGQIGYEMAILVERVGGVVQSCRR.
[0010] Furthermore, the nucleotide sequence encoding the Rv3364c protein is shown in SEQ ID NO:2.
[0011] SEQ ID NO:2:atgaaagcccgcttgccggacagcccgcttgactggctggtgtcgaagttcgcccgcgaggttcccggggtggcccatgcattgctggtgtcgg tcgacgggcttcccgtggcggccagcgaacatctaccacgcgaacgcgccgatcagttggccgcggtgacgtccgggctggccagcctggccggcggcgc cgcgcaactgttcgacggcgggcaggtgctgcagtcggtggttgagatgcagaacggctacctgctgttgatgcaggtgggagacgggtcggcgctggcg gcgctggccgcgaccggatgcgatatcggccagatcggttatgagatggccatccttgtcgagcgggtgggcggcgttgttcaatcctgccggcgatag.
[0012] Furthermore, the anti-inflammatory drug inhibits the secretion of inflammatory cytokines by interfering with the cGAS-STING signaling pathway.
[0013] Furthermore, the cGAS-STING signal path includes an IFN-β signal path and an NF-κB signal path.
[0014] Furthermore, the inflammatory cytokines include IFN-α, IFN-β, IL-1β, and IL-6.
[0015] Furthermore, the product includes a recombinant vector and a host cell.
[0016] Furthermore, the recombinant vector includes prokaryotic expression vectors and eukaryotic expression vectors.
[0017] The present invention discloses an anti-inflammatory drug comprising Mycobacterium tuberculosis Rv3364c protein and / or a product expressing Mycobacterium tuberculosis Rv3364c protein.
[0018] Furthermore, the drug also includes pharmaceutically acceptable carriers or excipients.
[0019] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention discloses for the first time that the Rv3364c protein can inhibit the secretion of inflammatory cytokines by interfering with the cGAS-STING signaling pathway, thereby exerting an anti-inflammatory effect, including significantly reducing the expression of inflammatory factors such as IFN-α, IFN-β, IL-1β, and IL-6. It targets not a single pro-inflammatory factor, but multiple factors and multiple pathways, providing a new approach to anti-inflammation. Attached Figure Description
[0020] Figure 1 The Rv3364c recombinant protein was shown to inhibit the transcriptional level of LPS-induced macrophage inflammatory factor IFN-β.
[0021] Figure 2 The results showed that overexpression of the Rv3364c eukaryotic plasmid inhibited the activation of the IFN-β and NF-κB signaling pathways.
[0022] Figure 3 Rv3364c overexpression showed that it inhibited the expression of Mycobacterium smegmatis-induced macrophage inflammatory factors IFN-α, IFN-β, IL-1β and IL-6.
[0023] Among them, the significance difference was assigned a value. P <0.05 (*) P <0.01 (**), P <0.001 (***). Detailed Implementation
[0024] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0025] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques are well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: A LABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; *theseries METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATINSTRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.
[0026] Example 1: Recombinant Rv3364c protein inhibits LPS-induced IFN-β expression in macrophages (1) Prokaryotic expression and identification of recombinant Rv3364c protein Design primers with both XhoI and Hind III restriction sites: Forward primer: 5'-atggagctcggtaccctcgagATGAAAGCCCGCTTGCCG-3' (SEQ ID NO: 3); Reverse primer: 5'-agactgcaggtcgacaagcttCTATCGCCGGCAGGATTGA-3' (SEQ ID NO: 4).
[0027] Table 1 PCR amplification system
[0028] Table 2 PCR reaction procedure
[0029] The genome was extracted from Mycobacterium tuberculosis (ATCC 25177) as a template. The Rv3364c gene (sequence shown in SEQ ID NO:2) was amplified by PCR using the sequences of SEQ ID NO:3 and SEQ ID NO:4 as primers. The PCR reaction system and procedure are shown in Tables 1 and 2. The Rv3364c product was recovered by agarose gel electrophoresis and ligated into the pColdⅠ plasmid (purchased from Novagen) digested with XhoI and HindIII. This plasmid was then transformed into E. coli DH5α competent cells (purchased from TAKAR) and screened on ampicillin-resistant LB agar. Positive clones were selected for identification, and after sequencing (Nanjing Genscript Biotech Co., Ltd.), the prokaryotic expression plasmid pColdⅠ-Rv3364c was obtained. Confirmation results showed that the Rv3364c gene expression sequence in the prokaryotic expression plasmid pColdⅠ-Rv3364c is as shown in SEQ ID NO:2.
[0030] Single positive colonies were picked and placed in 4 mL of ampicillin-resistant LB broth, and incubated overnight at 37°C in a shaker. The next day, the recombinant bacteria were inoculated at a 1:100 ratio into ampicillin-resistant LB broth, and incubated at 37°C in a shaker until the OD value reached 0.4-0.6. Isopropyl-β-D-thiogalactopyranoside IPTG was added to a final concentration of 0.5 mmol / L, and incubated at 25°C and 180 rpm for 24 h in a shaker. The bacterial cells were collected by centrifugation and washed three times with sterile PBS. The bacterial cells were lysed using an ultrasonic lysate in an ice-water mixture (30 W, 3 s lysis, 5 s interval, 5-8 min lysis). The supernatant was then collected by centrifugation at 10,000 rpm for 10 min. The supernatant was collected after centrifugation, and the precipitate was resuspended in an equal volume of sterile PBS. The supernatant collected after centrifugation only needed to be purified using a Ni-Agarose His-tagged protein purification kit. First, the column was pretreated by adding 7.5 mL of sterile ultrapure water, 12.5 mL of charge buffer, and 7.5 mL of binding buffer sequentially to wash the His-tagged purification column. Then, the sample was loaded and passed through the column. Finally, 25 mL of binding buffer, 15 mL of washing buffer, and 15 mL of elute buffer were added, the column was capped, and the column was incubated at room temperature for 20 min. The purified protein was collected in a sterile 1.5 mL finger tube and analyzed by SDS-PAGE and Western Blot. Sequencing was then performed to confirm the expression of the protein's amino acid sequence. See SEQ ID NO:1 for details.
[0031] (2) Recombinant Rv3364c protein inhibits LPS-mediated secretion and expression of inflammatory cytokines. Mouse macrophages RAW264.7 (purchased from ATCC) were used at a concentration of 5 × 10⁻⁶. 5 Cells were seeded in 24-well cell culture plates and stimulated with 1 μg / ml of recombinant Rv3364c protein (endotoxin-free). A control group without stimulation was also included. After 2 hours of culture, 100 ng / ml of lipopolysaccharide (LPS) was added for further stimulation. Cells were collected for RNA extraction, and the transcriptional level of IFN-β was measured. The qPCR primers, reaction system, and procedure are shown in Tables 3-5. The results showed that Rv3364c significantly inhibited the transcriptional level of IFN-β. Figure 1 ).
[0032] Table 3 Primers for quantitative fluorescence
[0033] Table 4 qRT-PCR system
[0034] Table 5 qRT-PCR reaction procedure
[0035] Example 2: Overexpression of the Rv3364c eukaryotic plasmid inhibits the activation of the IFN-β and NF-κB signaling pathways. (1) Construction and identification of recombinant Rv3364c eukaryotic plasmid Design primers with both EcoRI and XhoI restriction sites: Forward primer: 5'-tggccatggaggcccgaattcATGAAAGCCCGCTTGCCG-3' (SEQ ID NO: 5); Reverse primer: 5'-ccgcggccgcggtacctcgagCTATCGCCGGCAGGATTGA-3' (SEQ ID NO: 6).
[0036] The genome of *Mycobacterium tuberculosis* (purchased from ATCC) was extracted and used as a template. The Rv3364c gene (sequence shown in SEQ ID NO:2) was amplified by PCR using the sequences of SEQ ID NO:5 and SEQ ID NO:6 as amplification primers. The PCR reaction system and procedure were the same as in Example 1, as shown in Tables 1 and 2. The Rv3364c product was recovered by agarose gel electrophoresis and ligated into the pCMV plasmid (purchased from Clontech) digested with EcoRI and XhoI. This plasmid was then transformed into *E. coli* DH5α competent cells (purchased from TAKAR) and screened on resistant LB solid medium. Positive clones were selected for identification, and after sequencing (Nanjing Genscript Biotech Co., Ltd.), the eukaryotic expression plasmid pCMV-Myc-Rv3364c was obtained. Confirmation results showed that the Rv3364c gene expression sequence in the eukaryotic expression plasmid pCMV-Myc-Rv3364c was as shown in SEQ ID NO:2.
[0037] Rv3364c overexpression inhibits the activation of the IFN-β and NF-κB signaling pathways. Forward primer: 5'-tggccatggaggcccgaattcCATGCAGCCTTGGCACGG-3' (SEQ ID NO: 7); Reverse primer: 5'-ccgcggccgcggtacctcgagTCAAAATTCATCAAAAACTGGAAAC-3' (SEQ ID NO: 8).
[0038] Forward primer: 5'-tggccatggaggcccgaattcGAATTCGGATGCCCCACTCC-3' (SEQ ID NO: 9); Reverse primer: 5'-ccgcggccgcggtacctcgagggCTCGAGTCAAGAGAAATCCGTGC-3' (SEQ ID NO: 10).
[0039] Based on the cGAS and STING gene sequences of the genus *Homo* published in the NCBI Nucleotide database, primers were designed for constructing eukaryotic expression plasmids, using EcoRI and XhoI restriction enzymes. The cGAS gene was amplified by PCR using primers with sequences SEQ ID NO: 7 and SEQ ID NO: 8. The STING gene was amplified by PCR using primers with sequences SEQ ID NO: 9 and SEQ ID NO: 10. The PCR reaction system and procedure were consistent with Example 1, as shown in Tables 1 and 2. The cGAS and STING products were recovered by agarose gel electrophoresis and ligated into the EcoRI and XhoI-digested pCMV plasmid (purchased from Clontech). The pCMV plasmids were then transformed into *E. coli* DH5α competent cells (purchased from TAKAR) and screened on ampicillin-resistant LB agar. Positive clones were selected for identification, and after sequencing (Nanjing Genscript Biotech Co., Ltd.), the eukaryotic expression plasmids pCMV-HA-cGAS and pCMV-HA-STING were obtained.
[0040] HEK293T cells (purchased from ATCC) were used at a rate of 2 × 10⁻⁶. 5Cells were seeded at a density of 1 / mL in 24-well cell culture plates. After uniform cell adhesion, the cells were transfected with IFN-β promoter luciferase reporter gene plasmid IFN-β-Luc / NF-κB-Luc (purchased from Miaoling Biotechnology), pRL-TK Renilla luciferase plasmid (purchased from Promega), pCMV-HA-cGAS, pCMV-HA-STING, pCMV-Myc (purchased from TAKAR), and Rv3364c eukaryotic expression plasmid pCMV-Myc-Rv3364c (200 ng, 400 ng, and 800 ng, respectively) according to the Lipofectamine 2000 (purchased from Invitrogen) instructions. 24 h after transfection, the culture medium was discarded, and the cells were washed twice with PBS. Then, 100 μL of Passive Lysis Buffer was added to each well, and the cells were lysed at room temperature for 10 min. 100 μL of Luciferase Substrate solution (purchased from Novizan Biosciences) melted to room temperature was added to an opaque white 96-well plate, followed by 20 μL of cell lysate. The mixture was quickly mixed and then placed in a microplate reader to detect luciferase activity. Results showed that Rv3364c significantly inhibited cGAS-STING-induced IFN-β and NF-κB signaling pathway activation levels. Figure 2 ).
[0041] Example 3: Rv3364c protein overexpression inhibits the transcriptional expression of host inflammatory factors induced by recombinant Mycobacterium smegma. (1) Construction and identification of recombinant smegma rMS::pMV261-Rv3364c Design primers with both EcoRI and Hind III restriction sites: Forward primer: 5'-gcggatccagctgcagaattcATGAAAGCCCGCTTGCCG-3' (SEQ ID NO: 11); Reverse primer: 5'-tacgtcgacatcgataagcttCTAGTGATGATGGTGATGATGTCGCCGGCAGGATTGA-3' (SEQ ID NO: 12).
[0042] Genome extract from Mycobacterium tuberculosis was used as a template. The Rv3364c gene (sequence shown in SEQ ID NO: 2) was amplified by PCR using the sequences SEQ ID NO: 11 and SEQ ID NO: 12 as primers. The PCR reaction system and procedure were the same as in Example 1, as shown in Tables 1 and 2. The purified Rv3364c amplification product was recovered by agarose gel electrophoresis and cloned into the pMV261 vector (purchased from Novopro) digested with EcoRI and Hind III. This vector was then transformed into E. coli DH5α competent cells and screened on kanamycin-resistant LB agar. Positive clones were sent to Nanjing GenScript Biotech for sequencing. The correctly sequenced DH5α (pMV261-Rv3364c) clones were expanded, and single colonies were picked and inoculated into kanamycin-resistant LB liquid medium, incubated overnight at 37°C in a shaker. The next day, the plasmid was extracted and electroporated into Mycobacterium smegma competent cells. Single colonies grown after electroporation were selected for PCR identification. The successfully identified strain was named rMS::pMV261-Rv3364c.
[0043] (2) Overexpression of Rv3364c recombinant Mycobacterium smegmatis inhibits the transcription of IFN-α, IFN-β, IL-1β and IL-6 in macrophages. Mouse RAW264.7 macrophages (purchased from ATCC) were cultured and infected with recombinant bacteria rMS::pMV261-Rv3364c at an MOI ratio of 10:1. Mycobacterium smegmatis rMS::pMV261 containing the empty vector DH5a-pMV261 was used as a control group. Six hours after infection, cells were collected and RNA was extracted. The transcriptional levels of inflammatory cytokines were measured by RT-PCR. The qPCR reaction system and procedure were the same as in Example 2, as shown in Tables 4 and 5; the qPCR primers are shown in Table 6.
[0044] Table 6 Primers for Quantitative Fluorescence
[0045] The results showed that, compared with the rMS::pMV261 empty vector strain, the transcriptional levels of IFN-α, IFN-β, IL-1β, and IL-6 in the recombinant strain rMS::pMV261-Rv3364c were significantly downregulated. Figure 3 ).
Claims
1. Application of Mycobacterium tuberculosis Rv3364c protein and / or products expressing Mycobacterium tuberculosis Rv3364c protein in the preparation of anti-inflammatory drugs.
2. The application according to claim 1, characterized in that, The amino acid sequence of the Rv3364c protein is shown in SEQ ID NO:
1.
3. The application according to claim 1, characterized in that, The nucleotide sequence encoding the Rv3364c protein is shown in SEQ ID NO:
2.
4. The application according to claim 1, characterized in that, The anti-inflammatory drug inhibits the secretion of inflammatory cytokines by interfering with the cGAS-STING signaling pathway.
5. The application according to claim 4, characterized in that, The cGAS-STING signal pathway includes the IFN-β signal pathway and the NF-κB signal pathway.
6. The application according to claim 1, characterized in that, The inflammatory cytokines include IFN-α, IFN-β, IL-1β, and IL-6.
7. The application according to claim 1, characterized in that, The product includes recombinant vectors and host cells.
8. The application according to claim 7, characterized in that, The recombinant vectors include prokaryotic expression vectors and eukaryotic expression vectors.
9. An anti-inflammatory drug, characterized in that, The drug contains Mycobacterium tuberculosis Rv3364c protein and / or products expressing Mycobacterium tuberculosis Rv3364c protein.
10. The anti-inflammatory drug according to claim 9, characterized in that, The drug also includes pharmaceutically acceptable carriers or excipients.