Quadruple fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit and detection method for simultaneously detecting universal targets of HPIV1, HPIV2, HPIV3 and parainfluenza virus
The quadruple TaqMan probe real-time PCR detection kit enables the simultaneous detection of HPIV1, HPIV2, HPIV3, and universal targets of parainfluenza virus in a single-tube reaction, solving the problem of difficult typing and identification in existing technologies. It achieves rapid, accurate detection and high-throughput screening, and is suitable for parainfluenza virus monitoring in human and animal samples.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-13
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies are insufficient for rapid and accurate typing and identification of HPIV1, HPIV2, and HPIV3 in the same reaction, while also taking into account universal screening for parainfluenza viruses. This results in long testing cycles and low throughput, making it difficult to meet clinical needs.
A quadruple TaqMan probe-based quantitative PCR detection kit was designed, containing a specific primer and probe composition, which can simultaneously detect HPIV1, HPIV2, HPIV3 and parainfluenza virus universal targets in a single tube reaction. Through the specific design of primers and probes and multiplex fluorescence detection, a dual-layer output of typing and screening can be achieved.
It enables the simultaneous identification and detection of HPIV1, HPIV2, and HPIV3 in a single-tube reaction, and improves the reliability and throughput of the detection by using universal targets of parainfluenza viruses for verification. It is suitable for detection in complex samples and sequence variation situations, and is simple, efficient, and suitable for large-scale sample screening and epidemiological surveillance.
Smart Images

Figure CN121826237A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and in vitro diagnostic technology, specifically relating to a quadruple quantitative PCR (qPCR) detection kit and detection method based on TaqMan probes, which is used for the simultaneous detection and typing of human parainfluenza virus type 1 (HPIV1), human parainfluenza virus type 2 (HPIV2), human parainfluenza virus type 3 (HPIV3) and universal targets of parainfluenza viruses. It can also be used for screening and monitoring parainfluenza viruses in respiratory samples from human and animal sources. Background Technology
[0002] Human parainfluenza virus (HPIV) is one of the important pathogens causing acute respiratory infections in infants and young children and immunocompromised individuals. It can cause clinical manifestations such as upper respiratory tract infection, laryngotracheobronchitis, bronchitis, and pneumonia. HPIV1, HPIV2, HPIV3, and HPIV4 cause symptoms highly similar to those of other respiratory viruses (such as influenza virus, respiratory syncytial virus, and adenovirus) during the epidemic season. Clinically, it is difficult to accurately distinguish them based on symptoms and signs alone. Therefore, rapid, sensitive, and specific laboratory testing methods are needed for differential diagnosis and epidemiological surveillance.
[0003] Parainfluenza viruses and their closely related paramyxoviruses can be detected in a variety of hosts (such as pigs, cattle, and other livestock). In the context of "One Health" for public health and animal health, there is a need for both serotyping of human HPIV and broader-coverage parainfluenza virus screening tools to monitor potential cross-species transmission events. Traditional singlet PCR or isolation and culture methods often have long detection cycles and low throughput, and are difficult to meet clinical testing needs in scenarios with limited resources or large sample volumes. Multiplex TaqMan probe qPCR technology can achieve simultaneous amplification and fluorescence detection of multiple targets in the same reaction tube, and has advantages such as high sensitivity, high specificity, simple operation, and suitability for high-throughput screening. Therefore, it is of great significance to establish a quadruple qPCR detection method that can simultaneously detect HPIV1, HPIV2, and HPIV3 in a single tube reaction and use the universal parainfluenza virus target (PIV-ALL) for auxiliary validation. Summary of the Invention
[0004] To address the lack of existing technologies capable of rapidly identifying HPIV1, HPIV2, and HPIV3 in a single reaction while also providing universal parainfluenza virus screening to reduce the risk of missed detections due to sequence variations or host differences, this invention provides a quadruple TaqMan probe-based quantitative PCR detection kit and method for simultaneously detecting HPIV1, HPIV2, HPIV3, and universal parainfluenza virus targets (HPIV1, HPIV2, HPIV3, HPIV4, Porcine parainfluenza virus 1 / 2, and Bovine parainfluenza virus 3). This kit can be applied to various scenarios, including human diagnosis / monitoring and animal sample screening.
[0005] The objective of this invention can be achieved through the following technical solutions:
[0006] In a first aspect, the present invention claims protection for a specific primer and probe composition for detecting HPIV1 (human parainfluenza virus type 1), HPIV2 (human parainfluenza virus type 2), HPIV3 (human parainfluenza virus type 3) and PIV-ALL (parainfluenza virus universal target), the specific primer and probe composition comprising primer pairs and probes for detecting HPIV1, primer pairs and probes for detecting HPIV2, primer pairs and probes for detecting HPIV3, and primer pairs and probes for detecting PIV-ALL;
[0007] Primer pairs and probes used to detect HPIV1:
[0008] Forward primer HPIV1-F: as shown in SEQ ID NO: 1;
[0009] Reverse primer HPIV1-R: as shown in SEQ ID NO: 2;
[0010] HPIV1-Probe: As shown in SEQ ID NO: 3, the 5' end is labeled with a Texas Red fluorescent group and the 3' end is labeled with a BHQ2 quenching group;
[0011] Primer pairs and probes for detecting HPIV2:
[0012] Forward primer HPIV2-F: as shown in SEQ ID NO: 4;
[0013] Reverse primer HPIV2-R: as shown in SEQ ID NO: 5;
[0014] HPIV2-Probe: As shown in SEQ ID NO: 6, the 5' end is labeled with a CY5 fluorescent group and the 3' end is labeled with a BHQ3 quenching group;
[0015] Primer pairs and probes for detecting HPIV3:
[0016] Forward primer HPIV3-F: as shown in SEQ ID NO: 7;
[0017] Reverse primer HPIV3-R: as shown in SEQ ID NO: 8;
[0018] HPIV3-Probe: As shown in SEQ ID NO: 9, the 5' end is labeled with a VIC fluorescent group and the 3' end is labeled with a BHQ1 quenching group;
[0019] Primer pairs and probes for detecting PIV-ALL:
[0020] Forward primer PIV-ALL-F: as shown in SEQ ID NO: 10;
[0021] Reverse primer PIV-ALL-R: as shown in SEQ ID NO: 11;
[0022] The probe PIV-ALL-Probe, as shown in SEQ ID NO: 12, has a FAM fluorescent group labeled at the 5' end and an MGB quencher group labeled at the 3' end.
[0023] Secondly, the present invention seeks protection for the use of the above-described specific primer-probe composition in the preparation of a quadruple TaqMan probe-based quantitative PCR detection reaction solution for detecting HPIV1, HPIV2, HPIV3, and PIV-ALL.
[0024] Thirdly, the present invention seeks protection for the use of the above-described specific primer-probe composition in the preparation of a quadruple TaqMan probe real-time PCR detection kit for detecting HPIV1, HPIV2, HPIV3 and PIV-ALL.
[0025] Fourthly, this invention claims protection for a quadruple TaqMan probe-based real-time PCR detection reaction solution for detecting HPIV1, HPIV2, HPIV3, and PIV-ALL, the reaction solution comprising the following components:
[0026] a) The aforementioned specific primer-probe composition;
[0027] b) Hot-start Taq DNA polymerase;
[0028] c) dNTPs;
[0029] d) Magnesium ions;
[0030] e) PCR reaction buffer.
[0031] Fifthly, the present invention claims protection for a quadruple TaqMan probe real-time PCR detection kit for detecting HPIV1, HPIV2, HPIV3 and PIV-ALL, the kit comprising the above-mentioned reaction solution and controls; the controls include positive controls and negative controls, the positive controls being standard templates containing the L gene of HPIV1 as shown in SEQ ID NO: 13, the HN gene of HPIV2 as shown in SEQ ID NO: 14, the L gene of HPIV3 as shown in SEQ ID NO: 15, and the PIV-ALL fragment as shown in SEQ ID NO: 16, respectively, and the negative controls being nuclease-free water.
[0032] Furthermore, the standard template is a recombinant plasmid or synthetic nucleic acid containing the L gene of HPIV1 as shown in SEQ ID NO: 13, the HN gene of HPIV2 as shown in SEQ ID NO: 14, the L gene of HPIV3 as shown in SEQ ID NO: 15, and the PIV-ALL fragment (L gene) as shown in SEQ ID NO: 16.
[0033] The positive standard is prepared by synthesizing the L gene fragment of HPIV1, the HN gene fragment of HPIV2, the L gene fragment of HPIV3, and the universal target fragment (L gene) into a gene and then ligating it into a vector (such as the pMD18-T vector) to construct a recombinant plasmid for use as a standard template; alternatively, in vitro transcription or synthesis of nucleic acid can be used as a standard.
[0034] This kit should be stored at -20°C, and the number of freeze-thaw cycles should be minimized.
[0035] Sixthly, this invention claims a method for simultaneous detection of HPIV1, HPIV2, HPIV3, and PIV-ALL using a quadruple TaqMan probe in real-time PCR for non-diagnostic purposes, the method comprising the following steps:
[0036] Step 1: Extract RNA from the sample and reverse transcribe it into cDNA;
[0037] Step 2: Using the aforementioned specific primer and probe composition, and with the cDNA obtained in Step 1 as a template, prepare a qPCR reaction system, perform PCR amplification, and collect fluorescence signals in the Texas Red, CY5, VIC, and FAM channels, respectively.
[0038] Step 3: Determine whether the sample contains HPIV1 (Texas Red), HPIV2 (CY5), HPIV3 (VIC), and PIV-ALL (FAM) nucleic acids based on the fluorescence signal and Cq value measured by the machine.
[0039] Further, in step 2, the qPCR reaction system is as follows: 10 µL of probe premix, 0.3 µL each of the four pairs of forward and reverse primers in the above-mentioned specific primer and probe composition, 0.1 µL each of the three probes HPIV1, HPIV3, and PIV-ALL, 0.2 µL of the HPIV2 probe, 1 µL of cDNA template, and made up to 20 µL with nuclease-free water. The concentration of primers and probes is 10 μM.
[0040] Furthermore, the reaction program for PCR amplification in step 2 is set as follows:
[0041] The fluorescence channels were set as follows: Texas Red for HPIV1, CY5 for HPIV2, VIC for HPIV3, and FAM for PIV-ALL.
[0042] The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including: 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, while fluorescence signals were collected using a real-time PCR instrument.
[0043] Furthermore, in step 3, the criteria for determining whether HPIV1, HPIV2, HPIV3, and PIV-ALL nucleic acids are present in the sample based on the fluorescence signal and Cq value calculated by the machine are as follows: if the Cq value of a certain channel is ≤35, it is determined to be positive for HPIV1, HPIV2, HPIV3, and PIV-ALL nucleic acids; if the Cq value is ≥38, it is determined to be negative; if 35 < Cq value < 38, it is determined to be suspicious and needs to be retested.
[0044] Unlike conventional single-target detection or simple multiplex splicing, this invention's technical solution focuses on a dual-output approach: "HPIV1 / HPIV2 / HPIV3 genotyping detection + universal parainfluenza virus target screening." Addressing key engineering challenges such as crosstalk, primer competition, and non-specific amplification in multiplex systems, a four-channel TaqMan probe system (TexasRed, CY5, VIC, FAM) is constructed and matched with corresponding quenchers (BHQ1 / 2 / 3) and MGB structures. Simultaneously, deoxyinosine (dI) is introduced as a universal base at the variable site of the universal target primer to reduce degeneracy and improve mismatch tolerance. This enhances the amplification efficiency and detection specificity of the universal target in a multiplex quantitative PCR system. Furthermore, the design of the universal target considers the sequence conservation of parainfluenza viruses / closely related paramyxoviruses from different host sources, making it suitable for parainfluenza-related screening and monitoring in human and animal samples. By controlling the amplified fragment length and primer-probe complementarity to achieve multiplex reaction compatibility, this kit enables both genotyping and screening coverage in a single-tube reaction, realizing a "3-genotyping + 1-general" stratified detection logic. It possesses clear engineering technical characteristics and industrialization potential.
[0045] The primers and probes used in this invention are designed based on conserved regions of HPIV1, HPIV2, HPIV3, and parainfluenza viruses, and significant homology with common respiratory pathogens is excluded through sequence alignment. In one embodiment, influenza virus (Influenza A / B), respiratory syncytial virus (RSV), adenovirus (AdV), human rhinovirus (HRV), human metapneumovirus (hMPV), coronavirus OC43, NL63, etc., can be selected as controls for specificity verification to assess the risk of cross-reactivity.
[0046] Compared with the prior art, the quadruple qPCR detection method of the present invention has the following technical advantages:
[0047] 1. It can simultaneously identify and detect HPIV1, HPIV2, and HPIV3 in a single PCR reaction tube, and set a universal parainfluenza virus target as an auxiliary verification / early warning signal, forming a "genotyping + universal" two-layer interpretation logic, improving the detection reliability in complex sample or sequence variation situations; providing a simple, efficient, and low-cost method for laboratory diagnosis of human parainfluenza virus infection.
[0048] 2. The quadruple TaqMan probe qPCR detection kit of the present invention can realize the simultaneous detection of four targets; according to existing validation results, the minimum detection concentrations of the present invention for HPIV1, HPIV2, HPIV3 and the general target are 20 copies / μL, 100 copies / μL, 50 copies / μL and 50 copies / μL, respectively.
[0049] 3. This invention significantly reduces the workload of single-detection methods through multiplexing design, improves detection throughput and efficiency, and is suitable for large-scale sample screening and epidemiological monitoring.
[0050] 4. The universal target design for parainfluenza viruses takes into account the conserved regions of parainfluenza viruses / closely related paramyxoviruses, and can be used for parainfluenza-related screening and monitoring in human and animal samples. When the genotyping target is negative but the universal target is positive, it can indicate the presence of other types / variants or closely related viruses and recommends retesting (such as repeated testing, supplementary genotyping, or sequencing confirmation).
[0051] 5. The primers and probes of the kit of this invention are designed and compared based on public sequence databases. Combined with Tm coordination, complementarity control and fluorescence channel / quencher matching in multiplex reactions, the amplification efficiency and signal-to-noise ratio are improved, which facilitates standardization, promotion and industrial application.
[0052] 6. The method of this invention is simple to operate and the amplification and interpretation process is standardized, making it suitable for clinical laboratories and third-party testing institutions to rapidly detect and identify human parainfluenza virus.
[0053] 7. This invention can serve as a basic detection unit for parainfluenza virus surveillance under the "One Health" framework, supporting the use of the same set of interpretation logic to output results in different scenarios such as medical institutions, disease control and surveillance, and animal disease surveillance, thereby improving data comparability and monitoring efficiency.
[0054] 8. Deoxyinosine (dI) modification was introduced in primer design to reduce degeneracy and improve mismatch tolerance. Attached Figure Description
[0055] Figure 1 This document describes the preparation of standards and standard curves for the quadruple TaqMan qPCR detection method in Example 1; where A represents the fluorescence amplification curves of the HPIV1 plasmid standard after 10-fold serial dilutions, with a concentration range of 1×10⁻⁶. 1 –1×10 7 copies / μL; B is the fluorescence amplification curve of HPIV2 plasmid standard after 10-fold serial dilution, with a concentration range of 1×10⁻⁶. 1 –1×10 7 copies / μL; C represents the fluorescence amplification curve of the HPIV3 plasmid standard after 10-fold serial dilution, with a concentration range of 1×10⁻⁶. 1 –1×10 7 copies / μL; D represents the fluorescence amplification curve of the PIV-ALL plasmid standard after 10-fold serial dilution, with a concentration range of 1×10⁻⁶. 1 –1×10 7copies / μL; E represents the standard curves corresponding to HPIV1, HPIV2, HPIV3, and PIV-ALL, and the linear regression equations and correlation coefficients (R²) for each curve. 2 The amplification efficiency (Eff) is shown in the legend in the figure.
[0056] Figure 2 Figure 10 shows the results of a simulation experiment of co-infection with any two of the four pathogens. 4 (copies / μL), which is the detection result graph of dual co-infection (pair combination) samples; where A is the fluorescence amplification curve of the HPIV1 and HPIV2 simulated co-infection sample; B is the fluorescence amplification curve of the HPIV1 and HPIV3 simulated co-infection sample; C is the fluorescence amplification curve of the HPIV1 and parainfluenza virus universal target simulated co-infection sample; D is the fluorescence amplification curve of the HPIV2 and HPIV3 simulated co-infection sample; E is the fluorescence amplification curve of the HPIV2 and parainfluenza virus universal target simulated co-infection sample; F is the fluorescence amplification curve of the HPIV3 and parainfluenza virus universal target simulated co-infection sample.
[0057] Figure 3 Figure 10 shows the results of simulation experiments on triple and quadruple co-infection. 4 (copies / μL), where A is the fluorescence amplification curve of the sample simulating triple co-infection with HPIV1, HPIV2, and HPIV3; B is the fluorescence amplification curve of the sample simulating triple co-infection with HPIV1, HPIV2, and the universal target of parainfluenza virus; C is the fluorescence amplification curve of the sample simulating triple co-infection with HPIV1, HPIV3, and the universal target of parainfluenza virus; D is the fluorescence amplification curve of the sample simulating triple co-infection with HPIV2, HPIV3, and the universal target of parainfluenza virus; and E is the fluorescence amplification curve of the sample simulating quadruple co-infection with HPIV1, HPIV2, HPIV3, and the universal target of parainfluenza virus.
[0058] Figure 4 The diagram shows the fluorescence amplification curves for detecting common respiratory pathogen control samples and positive samples of HPIV1, HPIV2, HPIV3, and HPIV4 using the quadruple qPCR detection method established in this invention. Detailed Implementation
[0059] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention. Experimental methods and reagents not specifically described in the embodiments are performed according to conventional conditions in the art.
[0060] Example 1
[0061] In this embodiment, a four-fold TaqMan probe-based real-time PCR detection kit for universal targets of HPIV1, HPIV2, HPIV3, and parainfluenza virus with good specificity, sensitivity, and stability is provided. The steps are as follows:
[0062] 1. Construction and validation of detection methods
[0063] (1) Synthesize qPCR primer pairs and TaqMan probes for detecting universal targets of HPIV1, HPIV2, HPIV3 and parainfluenza virus. The specific sequences of the primers and probes are as follows:
[0064] Nucleotide sequences of primer pairs and TaqMan probes used for detecting HPIV1 (human parainfluenza virus type 1):
[0065] HPIV1-F: 5'-CTTCCTAGACTGGGCATCAGA-3' (SEQ ID NO: 1)
[0066] HPIV1-R: 5'- AGAGGATTAGGTGATTCCTG-3' (SEQ ID NO: 2)
[0067] HPIV1-Probe: 5'-Texas Red-CATGCAACCTCCCACATCAC-BHQ2-3' (SEQ ID NO: 3);
[0068] Nucleotide sequences of primer pairs and TaqMan probes used for detecting HPIV2 (human parainfluenza virus type 2):
[0069] HPIV2-F: 5'-AGAATACCATCATTTTCACTC-3' (SEQ ID NO: 4)
[0070] HPIV2-R: 5'-CAGATTGTTGTATTATCCCCA-3' (SEQ ID NO: 5)
[0071] HPIV2-Probe: 5'-CY5-TTGTGAGTGTAACACCAATG-BHQ3-3' (SEQ ID NO: 6).
[0072] Nucleotide sequences of primer pairs and TaqMan probes used for detecting HPIV3 (human parainfluenza virus type 3):
[0073] HPIV3-F: 5'-TTGGTTACATCCTCGTCTTG-3' (SEQ ID NO:7)
[0074] HPIV3-R: 5'-TGACAAAATCCTTCTATACCCC-3' (SEQ ID NO: 8)
[0075] HPIV3-Probe: 5'-VIC-CCAGAATCAGGGTGATCCTC-BHQ1-3' (SEQ ID NO: 9).
[0076] Nucleotide sequences of primer pairs and TaqMan probes used for detecting PIV-ALL (a universal target of parainfluenza virus):
[0077] PIV-ALL-F: 5'-ATWGARGGNYNNTGYCARAA-3' (SEQ ID NO: 10)
[0078] PIV-ALL-R: 5'-CWATNRNYTGRTTRTCNCCYT-3' (SEQ ID NO: 11)
[0079] PIV-ALL-Probe: 5'-FAM-TTRTTCCCTTGVACCAT-MGB-3' (SEQ ID NO: 12).
[0080] In the sequence listings SEQ ID NO:10 and SEQ ID NO:11 of this application, 'N' specifically refers to inosine (abbreviated as I), indicating that inosine is used instead of inosine at this position in the actual primer synthesis.
[0081] (2) Constructing standard template plasmids
[0082] The standard template plasmid is a recombinant plasmid containing the L gene of HPIV1, the HN gene of HPIV2, the L gene of HPIV3, and the PIV-ALL fragment. The L gene fragments of HPIV1, HN gene fragments of HPIV2, L gene fragments of HPIV3, and the universal target fragment were synthesized and ligated into a vector (such as the pMD18-T vector) to construct a recombinant plasmid for use as the standard template plasmid. The detailed construction process of the recombinant plasmid is as follows: Reference gene sequences of human parainfluenza virus types 1 (HPIV1), 2 (HPIV2), 3 (HPIV3), and other parainfluenza-related viruses were downloaded from the NCBI database. Multiple sequence alignment analysis was performed on the above sequences using MEGA 7 software to screen regions with high sequence conservation in each target gene as target fragments for subsequent construction. Based on the screening results, the target gene sequences were designed, with reference sequences HPIV1 (PX380302.1, CTTCCTAGACTGGGCATCAGACCCCTATTCATGCAACCTCCCACATTCACAAAGTATAACAACTATAATCAAAAATGTAACAGCTAGATCAGTATTGCAGGAATCACCTAATCCTCT, SEQ ID NO:13) and HPIV2 (NC_003443.1, AGAATACCATCATTTTCACTCATTAAGACCCATTGGTGTTACACTCACAATGTAATGCTTGGAGATTGCCTCGATTTCACGACATCTAATCAGTATTTAGCAATGGGGATAATACAACAATCTG, SEQ ID NO:13). NO:14), HPIV3 (NC_075446.1, TTGGTTACATCCTCGTCTTGAAGGAAGTACAATCTATGTAGGTGATCCTTACTGTCCTCCATCAGATAAAGAACATATATCATTAGAGGATCACCCTGATTCTGGATTCTACGTTCACAACCCAAGAGGGGGTATAGAAGGATTTTGTCA, SEQ ID NO:15), and other parainfluenza viruses (NC_021928.1, ATTGAAGGTCTGTGCCAAAAATTATGGACCATGATTTCAATTGCTACTATATTGTTGTCATCTGCAGAATCTAAGACTAGAGTAATGAGCATGGTTCAAGGAGACAATCAAACAATAG, SEQ ID NO:16), and the designed gene sequences were commissioned to Suzhou Silicon-based Biotechnology Co., Ltd. for synthesis.
[0083] 2. Establishment of the standard curve
[0084] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 copies / μL - 1×10 1 HPIV1, HPIV2, HPIV3 and universal target plasmid standards (or equivalent standards) in copies / μL.
[0085] (2) Place the above plasmid standards into the qPCR reaction system, use the above primers and probes to perform PCR amplification, and collect the fluorescence signal.
[0086] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg) 2+ The following components were added: ions, dNTPs mixture, hot-start Taq DNA polymerase, etc.; 0.3 µL each of HPIV1-F / HPIV1-R, HPIV2-F / HPIV2-R, HPIV3-F / HPIV3-R, and PIV-ALL-F / R; 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe; 0.2 µL of HPIV2-Probe; 1 µL of cDNA template; and nuclease-free water to a total volume of 20 µL. The concentrations of all primers and probes were 10 μM.
[0087] (4) qPCR reaction program: The fluorescence channels were set as follows: the universal target was the FAM channel, HPIV3 was the VIC channel, HPIV1 was the Texas Red channel, and HPIV2 was the CY5 channel; the temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, and the fluorescence signal was collected by a real-time PCR instrument.
[0088] (5) Standards for obtaining HPIV1, HPIV2, HPIV3 and universal targets are obtained from 1×10 7 copies / μL - 1×10 1 Fluorescence amplification curves were generated at multiple concentration gradients (copies / μL), and corresponding standard curves were established based on the copy number and Cq value of the standard.
[0089] like Figure 1 As shown, Figure 1 The AD values in the figures represent amplification curves of different concentrations of HPIV1, HPIV2, HPIV3, and PIV-ALL standards. Figure 1E in the figure represents the corresponding standard curve. The results show that the detection method of the present invention can achieve a stable amplification and quantification relationship over a wide dynamic range, providing a basis for subsequent sensitivity and repeatability evaluation.
[0090] 3. Best suited for exploring reaction systems
[0091] (1) Use a concentration of 1×10 4 HPIV1, HPIV2, HPIV3 and universal target standard templates (copies / μL) were placed into the qPCR reaction system. Different concentrations of primers were used in each system for PCR amplification, and fluorescence signals were collected.
[0092] (2) The optimal primer concentration qPCR reaction system is as follows: 10 µL Probe Master Mix (probe method premix), 0.1 µL of each of the 4 probes, 1 µL of cDNA template, and nuclease-free water to make up to 20 μL. The concentration of both primers and probes is 10 μM. The 8 primers are set up in different combinations of addition amount, with the gradient set as 0.1 µL, 0.2 µL, 0.3 µL, 0.4 µL, 0.5 µL, 0.6 µL, 0.7 µL, and 0.8 µL, in order to screen the optimal primer addition amount.
[0093] (3) The optimal probe concentration qPCR reaction system is: 10µL Probe Master Mix, 0.3µL of each of the 8 primers, 1µL of cDNA template, and nuclease-free water to make up to 20µL. The concentration of both primers and probes is 10µM. The 4 probes are set up with different addition amounts in gradients of 0.1µL, 0.2µL, 0.4µL and 0.6µL to screen for the optimal amount of probes.
[0094] (4) qPCR reaction program: The universal target is the FAM channel, HPIV3 is the VIC channel, HPIV1 is the Texas Red channel, and HPIV2 is the CY5 channel; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, and the fluorescence signal is collected by a real-time PCR instrument.
[0095] Table 1. Results of the optimal reaction system for the quadruple TaqMan qPCR detection method.
[0096]
[0097] As shown in Table 1, when different combinations of primer concentrations were used in the experiment, the fluorescence intensity of the multiplex qPCR reaction was the highest and the Cq value was the lowest when the probe addition was 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe, 0.2 µL of HPIV2-Probe, and 0.3 µL of primers.
[0098] 4. Sensitivity test
[0099] (1) Prepare a solution with a dilution factor of 10 times and a concentration coverage of 1×10 4 copies / μL - 1×10 2 HPIV1, HPIV2, HPIV3 and PIV-ALL standard templates (copies / μL).
[0100] (2) Place the above plasmid standards into the optimal qPCR reaction system, use the above primers and probes to perform PCR amplification, and collect fluorescence signals.
[0101] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ The mixture of ions, dNTPs, hot-start Taq DNA polymerase, etc., contains 0.3 µL of each of the 8 primers, 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe, 0.2 µL of HPIV2-Probe, 1 µL of cDNA template, and nuclease-free water to a final volume of 20 µL. The concentration of both primers and probes is 10 μM.
[0102] (4) qPCR reaction program: The universal target is the FAM channel, HPIV3 is the VIC channel, HPIV1 is the Texas Red channel, and HPIV2 is the CY5 channel; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, and the fluorescence signal is collected by a real-time PCR instrument.
[0103] (5) Detect the above gradient standards and record the amplification curves and Cq values of each target at different concentrations; determine the limit of detection (LOD) of the method based on the lowest detectable concentration and the repeatability (e.g., ≥95%).
[0104] (6) As shown in Table 2, repeated detections (15 times) were performed near the determined candidate lowest concentration to evaluate the stability of Cq values and detection rate, so as to finally determine the sensitivity (LOD) of HPIV1, HPIV2, HPIV3 and the general target.
[0105] Table 2 Results of the lowest concentration plasmid repeat assay for the quadruple TaqMan qPCR detection method
[0106]
[0107] 5. Simulation test for co-infection sample detection
[0108] (1) Prepare HPIV1, HPIV2, HPIV3 and standard templates of universal targets in pairs, triplets and quadruplets (or select suspected co-infected samples), place them in a qPCR system, use the above primers and probes to perform PCR amplification, and collect fluorescence signals.
[0109] (2) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ The mixture of ions, dNTPs, hot-start Taq DNA polymerase, etc., contains 0.3 µL of each of the 8 primers, 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe, 0.2 µL of HPIV2-Probe, 1 µL of cDNA template, and nuclease-free water to a final volume of 20 µL. The concentration of both primers and probes is 10 μM.
[0110] (3) qPCR reaction program: The universal target is the FAM channel, HPIV3 is the VIC channel, HPIV1 is the Texas Red channel, and HPIV2 is the CY5 channel; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, and the fluorescence signal is collected by a real-time PCR instrument.
[0111] Depend on Figure 2 and Figure 3 It can be seen that when the quadruple detection method of the present invention is used to detect multiple infections of plasmid standards at the lowest concentration, the detection results are all normal, indicating that the method of the present invention is suitable for the detection of co-infected samples.
[0112] 6. Specificity test
[0113] (1) Positive samples / nucleic acid controls of common respiratory pathogens (such as influenza A / B, respiratory syncytial virus RSV, adenovirus, human rhinovirus, human metapneumovirus, coronavirus, etc.) and positive controls of HPIV1, HPIV2, HPIV3 and universal target were placed in a quadruple qPCR system, and PCR amplification was performed using the above primers and probes, and fluorescence signals were collected.
[0114] (2) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg2+ The mixture of ions, dNTPs, hot-start Taq DNA polymerase, etc., contains 0.3 µL of each of the 8 primers, 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe, 0.2 µL of HPIV2-Probe, 1 µL of cDNA template, and nuclease-free water to a final volume of 20 µL. The concentration of both primers and probes is 10 μM.
[0115] (3) qPCR reaction program: The universal target is the FAM channel, HPIV3 is the VIC channel, HPIV1 is the Texas Red channel, and HPIV2 is the CY5 channel; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, and the fluorescence signal is collected by a real-time PCR instrument.
[0116] Figure 4 The amplification curves for specificity verification are shown below: the control respiratory pathogen samples did not produce target channel-specific amplification in this method, while HPIV1, HPIV2, HPIV3 and universal target positive controls could produce amplification signals in their respective channels.
[0117] Depend on Figure 4 It is evident that the method of the present invention can achieve specific amplification of the target and can be used to assess the risk of cross-reactivity with other respiratory pathogens, demonstrating good specificity.
[0118] 7. Stability test
[0119] (1) Prepare a dilution ratio of 10 times, with a concentration coverage of 1×10 4 copies / μL - 1×10 2 HPIV1, HPIV2, HPIV3 and universal target standard templates in copies / μL.
[0120] (2) Place the plasmid standard of the same concentration into the quadruple qPCR reaction system, use the above primers and probes to perform PCR amplification, collect the fluorescence signal, set up 3 identical systems as replicates each time, and perform three replicate experiments in total.
[0121] (3) The qPCR reaction system is as follows: 10 µL Probe Master Mix (containing Mg2+ ions, dNTPs mixture, hot-start Taq DNA polymerase, etc.), 0.3 µL of each of the 8 primers, 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe, 0.2 µL of HPIV2-Probe, 1 µL of cDNA template, and nuclease-free water to make up to 20 µL. The concentration of primers and probes is 10 μM.
[0122] (4) qPCR reaction program: The universal target is the FAM channel, HPIV3 is the VIC channel, HPIV1 is the Texas Red channel, and HPIV2 is the CY5 channel; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, and the fluorescence signal is collected by a real-time PCR instrument.
[0123] (5) Statistically calculate the Cq values under different concentration gradients and calculate the coefficient of variation (CV) within and between groups to evaluate the stability and repeatability of the detection method. By repeatedly detecting samples with different concentration gradients and calculating the CV values, the stability and repeatability of this method can be quantitatively evaluated.
[0124] Table 3 Repeatability Tests of the Quadruple TaqMan qPCR Detection Method
[0125]
[0126] As shown in Table 3, the coefficient of variation (CV) for each concentration gradient is less than 1.5%, indicating that the detection method of the present invention has high stability.
[0127] Example 2: Rapid and efficient clinical testing of HPIV1, HPIV2, HPIV3, and PIV-ALL
[0128] Step 1: Extract RNA from the sample and reverse transcribe it into cDNA.
[0129] Total RNA was extracted from clinical respiratory samples (including but not limited to nasopharyngeal swabs, throat swabs, sputum, bronchoalveolar lavage fluid, etc.) and reverse transcribed into cDNA template.
[0130] Reverse transcription was performed using the HiScript® III 1st Strand cDNA Synthesis Kit (a high-efficiency third-generation full-length cDNA one-strand synthesis kit) from Nanjing Novizan Pharmaceutical Co., Ltd. The total reaction volume was 20 µL, including: 1 µL Randomhexamers and 1 µL Oligo (dT).20 VN (oligomeric dT primers), 5 µL enzyme-free water, 5 µL total RNA, mix well and heat at 65 °C for 5 min, then incubate on ice for 2 min. Add: 4 µL 5×gDNA wiper Mix (genomic removal mixture), mix well and heat at 42 °C for 2 min. Add: 2 µL 10×RT Mix (10× reverse transcription reaction mixture) and 2 µL HiScript® II Enzyme Mix (reverse transcriptase mixture).
[0131] The reverse transcription reaction procedure was as follows: heat at 25℃ for 5 min, heat at 50℃ for 45 min, and heat at 85℃ for 2 min. After the reaction, cDNA template was obtained.
[0132] Step 2: Using the specific primer and probe composition designed in Example 1, and the cDNA obtained in Step 1 as a template, a qPCR reaction system was prepared for PCR amplification. Fluorescence signals were collected in the Texas Red, CY5, VIC, and FAM channels, respectively. Positive and negative controls were also established.
[0133] For the sample well: add 1 µL of cDNA from the sample to be tested.
[0134] Positive control well: Add 1 µL of positive control (the positive control is a mixed solution of recombinant plasmids containing the L gene of HPIV1, the HN gene of HPIV2, the L gene of HPIV3, and the PIV-ALL fragment (L gene), with a concentration range of 1×10⁻⁶). 3 (copies / µL).
[0135] Negative control wells: Add 1 µL of nuclease-free water.
[0136] Blank control wells: Add 10µL of nuclease-free water, and do not add primer and probe compositions to the reaction system. This is used to monitor whether the Master Mix is contaminated.
[0137] The qPCR reaction system consisted of 10 µL Probe Master Mix (containing Mg) 2+The following components were prepared: ions, dNTPs mixture, hot-start Taq DNA polymerase, etc.; 0.3 µL each of HPIV1-F / HPIV1-R, HPIV2-F / HPIV2-R, HPIV3-F / HPIV3-R, and PIV-ALL-F / R; 0.1 µL each of HPIV1-Probe, HPIV3-Probe, and PIV-ALL-Probe; and 0.2 µL of HPIV2-Probe. The cDNA template / control and nuclease-free water were added to bring the total volume of the system to 20 µL. The concentration of primers and probes was 10 μM.
[0138] The PCR amplification reaction program is set as follows:
[0139] The fluorescence channels were set as follows: Texas Red for HPIV1, CY5 for HPIV2, VIC for HPIV3, and FAM for PIV-ALL.
[0140] The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including: 95 ℃ denaturation for 10 s, 54 ℃ annealing for 10 s, and 72 ℃ extension for 15 s, while fluorescence signals were collected using a real-time PCR instrument.
[0141] Step 3: Determine whether the sample contains HPIV1, HPIV2, HPIV3, and PIV-ALL nucleic acids based on the fluorescence signal and Cq value measured by the machine. The judgment criteria are as follows: if the Cq value of a certain channel is ≤35, it is judged as positive for HPIV1, HPIV2, HPIV3, and PIV-ALL nucleic acids; if the Cq value is ≥38, it is judged as negative; if 35 < Cq value < 38, it is judged as suspicious and needs to be retested.
[0142] Table 4 Clinical Sample Results
[0143]
[0144] As shown in Table 4, the results of clinical sample testing are consistent with those of known pathogens. This quadruple qPCR method can be used for HPIV typing and broad-spectrum screening in clinical samples.
Claims
1. A specific primer-probe composition for detecting HPIV1, HPIV2, HPIV3, and PIV-ALL, characterized in that, This specific primer-probe composition contains primer pairs and probes for detecting HPIV1, primer pairs and probes for detecting HPIV2, primer pairs and probes for detecting HPIV3, and primer pairs and probes for detecting PIV-ALL. Primer pairs and probes used to detect HPIV1: Forward primer HPIV1-F: as shown in SEQ ID NO: 1; Reverse primer HPIV1-R: as shown in SEQ ID NO: 2; HPIV1-Probe: As shown in SEQ ID NO: 3, the 5' end is labeled with a Texas Red fluorescent group and the 3' end is labeled with a BHQ2 quenching group; Primer pairs and probes for detecting HPIV2: Forward primer HPIV2-F: as shown in SEQ ID NO: 4; Reverse primer HPIV2-R: as shown in SEQ ID NO: 5; HPIV2-Probe: As shown in SEQ ID NO: 6, the 5' end is labeled with a CY5 fluorescent group and the 3' end is labeled with a BHQ3 quenching group; Primer pairs and probes for detecting HPIV3: Forward primer HPIV3-F: as shown in SEQ ID NO: 7; Reverse primer HPIV3-R: as shown in SEQ ID NO: 8; HPIV3-Probe: As shown in SEQ ID NO: 9, the 5' end is labeled with a VIC fluorescent group and the 3' end is labeled with a BHQ1 quenching group; Primer pairs and probes for detecting PIV-ALL: Forward primer PIV-ALL-F: as shown in SEQ ID NO: 10; Reverse primer PIV-ALL-R: as shown in SEQ ID NO: 11; The probe PIV-ALL-Probe, as shown in SEQ ID NO: 12, has a FAM fluorescent group labeled at the 5' end and an MGB quencher group labeled at the 3' end.
2. The use of the specific primer and probe composition of claim 1 in the preparation of a quadruple TaqMan probe real-time PCR detection reaction solution for detecting HPIV1, HPIV2, HPIV3 and PIV-ALL.
3. The use of the specific primer and probe composition of claim 1 in the preparation of a quadruple TaqMan probe real-time PCR detection kit for detecting HPIV1, HPIV2, HPIV3 and PIV-ALL.
4. A quadruple TaqMan probe-based real-time PCR detection reaction solution for detecting HPIV1, HPIV2, HPIV3, and PIV-ALL, characterized in that, The reaction solution contains the following components: a) The specific primer-probe composition of claim 1; b) Hot-start Taq DNA polymerase; c) dNTPs; d) Magnesium ions; e) PCR reaction buffer.
5. A quadruple TaqMan probe-based real-time PCR detection kit for detecting HPIV1, HPIV2, HPIV3, and PIV-ALL, characterized in that, The kit comprises the reaction solution and controls as described in claim 4; the controls include positive and negative controls, wherein the positive controls are standard templates containing the L gene of HPIV1 as shown in SEQ ID NO: 13, the HN gene of HPIV2 as shown in SEQ ID NO: 14, the L gene of HPIV3 as shown in SEQ ID NO: 15, and the PIV-ALL fragment as shown in SEQ ID NO: 16, respectively, and the negative control is nuclease-free water.
6. The reagent kit according to claim 5, characterized in that, The standard template is a recombinant plasmid or synthetic nucleic acid containing the L gene of HPIV1 as shown in SEQ ID NO:13, the HN gene of HPIV2 as shown in SEQ ID NO:14, the L gene of HPIV3 as shown in SEQ ID NO:15, and the PIV-ALL fragment as shown in SEQ ID NO:
16.
7. A method for simultaneous detection of HPIV1, HPIV2, HPIV3, and PIV-ALL using a quadruple TaqMan probe in real-time quantitative PCR for non-diagnostic purposes, characterized in that... The method includes the following steps: Step 1: Extract RNA from the sample and reverse transcribe it into cDNA; Step 2: Using the specific primer and probe composition described in claim 1, a qPCR reaction system is prepared with the cDNA obtained in step 1 as a template, and PCR amplification is performed. Fluorescence signals are collected in the Texas Red, CY5, VIC and FAM channels, respectively. Step 3: Determine whether the sample contains HPIV1, HPIV2, HPIV3 and PIV-ALL nucleic acids based on the fluorescence signal and Cq value calculated by the machine.
8. The method according to claim 7, characterized in that, In step 2, the qPCR reaction system is as follows: 0.3 µL each of four pairs of forward and reverse primers, 0.1 µL each of three probes (HPIV1, HPIV3, and PIV-ALL), 0.2 µL of HPIV2 probe, 1 µL of cDNA template, and nuclease-free water to a final volume of 20 µL. The concentration of both primers and probes is 10 μM.
9. The method according to claim 7, characterized in that, The reaction program for PCR amplification in step 2 is set as follows: The fluorescence channels were set as follows: Texas Red for HPIV1, CY5 for HPIV2, VIC for HPIV3, and FAM for PIV-ALL. The temperature control program is set to: 95 ℃ pre-denaturation for 10 min; Forty cycles were performed, including denaturation at 95 ℃ for 10 s, annealing at 54 ℃ for 10 s, and extension at 72 ℃ for 15 s, while fluorescence signals were collected using a real-time PCR instrument.
10. The method according to claim 7, characterized in that, In step 3, the criteria for determining whether HPIV1, HPIV2, HPIV3, and PIV-ALL nucleic acids are present in the sample based on the fluorescence signal and Cq value calculated by the machine are as follows: if the Cq value of a certain channel is ≤35, it is determined to be positive for HPIV1, HPIV2, HPIV3, and PIV-ALL nucleic acids; if the Cq value is ≥38, it is determined to be negative; if 35 < Cq value < 38, it is determined to be suspicious and needs to be retested.
Citation Information
Patent Citations
Primer group, kit and method for detecting respiratory pathogens
CN109457053A
Multiple real-time PCR kit for detecting parainfluenza virus, method and application thereof
CN111926114A
Primer and probe composition and real-time fluorescent quantitative PCR (polymerase chain reaction) kit for para-influenza virus typing detection
CN113278738A
Real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting influenza virus, respiratory syncytial virus and parainfluenza virus
CN116287473A