Application of reagent for detecting or inhibiting TCF7L2-Exon14 shear isomer and oral cancer treatment medicine
By detecting and inhibiting the TCF7L2-Exon14 cleavage isomer, the problem of difficult early diagnosis and poor treatment effect of oral cancer has been solved. Early prediction and molecular subtyping of oral cancer have been achieved, and the proliferation and colony formation of oral cancer cells have been significantly inhibited, thus improving diagnostic accuracy and treatment effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-11
- Publication Date
- 2026-04-17
AI Technical Summary
Oral cancer has a high recurrence and metastasis rate, and early diagnosis is difficult. Existing treatment methods have not significantly improved patients' survival rate and quality of life, and there is a lack of effective early diagnostic biomarkers and precision treatment strategies.
Reagents for detecting and inhibiting the TCF7L2-Exon14 splice isoform, using PCR detection reagents and shRNA preparations, were applied for the early diagnosis and treatment of oral cancer. The PCR detection reagent amplifies exon 14 of the TCF7L2 gene using specific primers, the in situ probe hybridization detection reagent is used to detect the TCF7L2-Exon14 splice isoform, and the shRNA preparation is used to inhibit its expression.
It enables early prediction and molecular subtyping of oral cancer, significantly inhibits the proliferation and colony formation of oral cancer cells, and improves the accuracy of diagnosis and the effectiveness of treatment.
Smart Images

Figure CN121874348A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor molecular biology, specifically relating to the application of a reagent for detecting or inhibiting the TCF7L2-Exon14 cleavage isomer and oral cancer treatment drugs. Background Technology
[0002] Oral cancer (lip and oral cavity cancer, hereinafter referred to as "oral cancer") is one of the most common malignant tumors of the head and neck. The occurrence of oral cancer is closely related to a variety of modifiable risk factors. Tobacco, alcohol, betel nut chewing, and human papillomavirus (HPV) infection are the main pathogenic factors. Histologically, oral cancer is predominantly squamous cell carcinoma, accounting for the majority of head and neck malignant tumors. Treatment remains primarily surgical resection, radiotherapy, and chemotherapy, with targeted therapy and immunotherapy becoming adjuvant therapies in recent years. However, due to the generally high recurrence and metastasis rates and difficulties in early diagnosis, the overall 5-year survival rate of oral cancer remains unsatisfactory. Therefore, in-depth analysis of the mechanisms of oral cancer development, screening and diagnostic biomarkers, and precision treatment strategies is of great significance. This can not only improve early diagnosis rates but also promote the optimization of treatment methods and improve patients' survival rates and quality of life.
[0003] Alternative splicing (AS) of pre-mRNA is a core component of eukaryotic gene expression regulation. Through different selections between exons and splice sites, it generates diverse transcripts and protein isoforms, significantly amplifying the functional space encoded by a limited number of genes. Previous studies have shown that over 95% of human multi-exon genes undergo alternative splicing. Furthermore, tumorigenesis and development are closely related to AS imbalance. Research has found that AS events in tumor samples are generally about 30% more frequent than in corresponding normal tissues, and a large number of tumor-specific splice connections are generated. Therefore, alternative splicing itself is a potential target for gene therapy, and the isoforms generated by alternative splicing may become novel biomarkers for early tumor diagnosis and prognostic assessment. Summary of the Invention
[0004] This invention reveals that the coding sequence (CDS) of the TCF7L2 gene consists of multiple exons, which can generate various transcriptional isoforms through alternative splicing of different precursor mRNAs. Exon 14 is a key component of the gene's functional region. Depending on the retention or skipping of exon 14, the TCF7L2 precursor mRNA can produce two main classes of splice isoforms: a long isoform containing exon 14 (TCF7L2-L type) and a short isoform lacking exon 14 (TCF7L2-S type). These two isoforms may also play different roles in oral cancer. This invention found that the expression of the TCF7L2-L splice isoform in oral cancer cells is higher than that in normal oral mucosal cells. Further research confirms that the TCF7L2-L splice isoform can promote the proliferation of oral cancer cells, thus playing an important oncogene role in the malignant progression of oral cancer.
[0005] Based on the sequence in NCBI (https: / / www.ncbi.nlm.nih.gov / nuccore / 1546278275), this invention can classify TCF7L2 transcripts into two major categories, TCF7L2-L (also named TCF7L2-Exon14 splicing isoform in this invention) and TCF7L2-S, according to the presence or absence of exon 14. This classification is then used to determine the presence of oral cancer-specific splicing patterns in samples, thereby enabling early prediction and molecular typing of oral cancer risk. The sequence of exon 14 of the TCF7L2 gene is shown in SEQ ID NO.1.
[0006] The TCF7L2-L class represents the long isomer group that retains exon 14; the TCF7L2-S class represents the short isomer group that lacks exon 14. This invention provides representative sequences from two types of isoforms, as shown in SEQ ID NO: 2 (TCF7L2-L) and SEQ ID NO: 3 (TCF7L2-S), respectively, corresponding to the coding sequences of NM_001367943.1 and NM_001363501.2 on NCBI. Among them, TCF7L2-S lacks exon 14 compared to TCF7L2-L, which constitutes the main structural difference between the two. The other subtypes differ from the representative sequences only in exon connections or non-coding region length, but have the same splicing feature of the presence or absence of exon 14. That is, different transcripts of TCF7L2-L all have exon 14, while different transcripts of TCF7L2-S do not have exon 14.
[0007] The primary objective of this invention is to provide an application of a reagent for detecting TCF7L2-Exon14 splice isomers, which are used to prepare oral cancer diagnostic agents; the TCF7L2-Exon14 splice isomers are isomers containing exon 14 of the TCF7L2 gene, and the sequence of exon 14 of the TCF7L2 gene is shown in SEQ ID NO.1.
[0008] Isoforms containing exon 14 of the TCF7L2 gene include the following sequence numbers from NCBI: NM_001367943.1, NM_001198528.2, NM_001198527.2, NM_001198525.2, NM_030756.5, NM_001349871.1, NM_001349870.2, and NM_001146285.2.
[0009] Furthermore, reagents for detecting the TCF7L2-Exon14 cleavage isomer include PCR detection reagents or in situ probe hybridization detection reagents.
[0010] Furthermore, the primers of the PCR detection reagent are capable of amplifying exon 14 of the TCF7L2 gene.
[0011] The primers described above were designed based on exon 14 of the TCF7L2 gene, and can be used to detect all TCF7L2 gene transcripts containing exon 14.
[0012] The preferred primer sequences are as follows:
[0013] Upstream primer: 5'-TGAGCGCTCCTAAGAAATGC-3'
[0014] Downstream primer: 5'-CCGCACCAGTTATTCTGTTG-3'.
[0015] The PCR detection reagent also includes a GAPDH internal reference primer, the sequence of which is:
[0016] Upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3'
[0017] Downstream primer: 5'- GGCTGTTGTCATACTTCTCATGG-3'.
[0018] The probe in the in situ probe hybridization detection reagent can hybridize with the region of exon 14 of the TCF7L2 gene.
[0019] The probes described above are designed based on exon 14 of the TCF7L2 gene, and therefore can hybridize with all transcripts containing exon 14, and can be used to detect all TCF7L2 gene transcripts containing exon 14.
[0020] Furthermore, the probe sequence is as follows: Dig-CCAGTTATTCTGTTGATCAAGGCCAAAGCGCGCTC-Dig.
[0021] The second aspect of this invention aims to provide the application of a reagent that inhibits the TCF7L2-Exon14 cleavage isomer, said reagent being used to prepare oral cancer treatment agents; said TCF7L2-Exon14 cleavage isomer being an isomer containing exon 14 of the TCF7L2 gene, said TCF7L2 gene exon 14 sequence being shown in SEQ ID NO.1.
[0022] Furthermore, the reagents used to inhibit the TCF7L2-Exon14 cleavage isoform include: shRNA preparations.
[0023] Preferred shRNA formulations include at least one of the following sequences: ACCTGAGCGCTCCTAAGAAAT; GCCTTGATCAACAGAATAACT.
[0024] The shRNA preparations described above are designed based on exon 14 of the TCF7L2 gene, and therefore can inhibit all transcripts containing exon 14, thus making them suitable for the treatment of oral cancer.
[0025] A third aspect of this invention aims to provide a therapeutic agent for oral cancer, the agent comprising an shRNA formulation that inhibits the TCF7L2-Exon14 splicing isoform, wherein the TCF7L2-Exon14 splicing isoform is an isoform containing exon 14 of the TCF7L2 gene, the sequence of exon 14 of the TCF7L2 gene being shown in SEQ ID NO.1; the shRNA formulation comprising at least one of the following sequences: ACCTGAGCGCTCCTAAGAAAT; GCCTTGATCAACAGAATAACT.
[0026] This invention uses semi-quantitative RT-PCR to detect the expression of the TCF7L2-Exon14 splice isoform in normal oral mucosal epithelial cells and oral cancer cells. The results showed that the expression of the TCF7L2-Exon14 splice isoform was significantly increased in oral cancer tissues compared to normal oral mucosal epithelial cells. Therefore, the high expression of the TCF7L2-Exon14 splice isoform in oral cancer tissues suggests that it may play an important biological role in the development and progression of oral cancer, and could serve as a molecular marker for oral cancer diagnosis or a therapeutic target. Attached Figure Description
[0027] Figure 1 The result is that the TCF7L2-L splice isoform is highly expressed in oral cancer;
[0028] in: Figure 1 A: Semi-quantitative RT-PCR was used to detect the expression of the TCF7L2-L splice isoform in oral cancer cells and normal oral mucosal epithelial cells. HOK represents normal oral mucosal epithelial cells, while SCC9, CAL27, SAS, and SCC15 represent oral cancer cells. ; Figure 1 B: In situ hybridization assay was used to detect the expression of the TCF7L2-L cleavage isomer in oral cancer tissues and paired adjacent normal tissues; Figure 1 C: Statistical graph of expression of TCF7L2-L cleavage isomer in oral cancer tissue and paired adjacent normal tissue, p<0.001.
[0029] Figure 2 Semi-quantitative RT-PCR assay was performed to detect the interference effect of TCF7L2-L cleavage isomer knockdown in oral cancer cell lines. ;
[0030] in: Figure 2 A: Semi-quantitative RT-PCR experiment to detect the interference effect of TCF7L2-L cleavage isomer in oral cancer cell line SCC9; Figure 2 B: Semi-quantitative RT-PCR experiment to detect the interference effect of TCF7L2-L cleavage isomer in oral cancer cell line CAL27.
[0031] Figure 3 Effects of in vitro knockdown of the TCF7L2-L cleavage isomer on the proliferation and clonogenic ability of oral cancer cells;
[0032] in: Figure 3 A: The CCK8 assay was used to examine the effect of knocking down the TCF7L2-L cleavage isomer on the proliferation of oral cancer cells SCC9. Figure 3 B: The CCK8 assay was used to examine the effect of knockdown of the TCF7L2-L cleavage isoform on the proliferation of oral cancer cells CAL27; Student's t-test was used for statistical analysis, and ns represents no significance. ; Figure 3 C: EdU assay to detect the effect of knockdown of the TCF7L2-L cleavage isomer on the proliferation of oral cancer cells CAL27. Figure 3 D: Statistical graph of the effect of EdU assay on the proliferation of oral cancer cells CAL27 by knockdown of TCF7L2-L cleavage isomer; Figure 3E: EdU assay to detect the effect of knockdown of TCF7L2-L cleavage isomer on the proliferation of oral cancer cells SCC9; Figure 3 F: A statistical graph showing the effect of knockdown of the TCF7L2-L cleavage isomer on the proliferation of oral cancer cells SCC9, as determined by the EdU assay. The statistical analysis was performed using Student's t-test. ns represents no significant difference. ; Figure 3 G: Plate colony formation assay to detect the effect of knockdown of TCF7L2-L cleavage isomer on the colony-forming ability of oral cancer cells CAL27 and SCC9; Figure 3 H: Statistical graph of the effect of knockdown of the TCF7L2-L cleavage isomer on the colony formation of oral cancer cells SCC9. Figure 3 I: Statistical graph of the effect of TCF7L2-L cleavage isoform knockdown on CAL27 oral cancer cell colony formation. Statistical analysis was performed using Student's t-test. ns represents no significance. .
[0033] Figure 4 Western blot analysis was used to detect the overexpression of TCF7L2-L and TCF7L2-S cleavage isomers in oral cancer cell lines.
[0034] Figure 5 Effects of in vitro overexpression of TCF7L2-L and TCF7L2-S cleavage isomers on the proliferation and clonogenic ability of oral cancer cells;
[0035] in: Figure 5 A: Plate colony formation assay was used to examine the effect of overexpression of TCF7L2-L and TCF7L2-S splice isomers on the colony-forming ability of oral cancer cells SCC9. Figure 5 B: Statistical graph of the effect of overexpression of TCF7L2-L and TCF7L2-S cleavage isomers on SCC9 colony formation in oral cancer cells. The statistical analysis was performed using Student's t-test. ns represents no significance. ; Figure 5 C: EdU assay to detect the effect of overexpression of TCF7L2-L and TCF7L2-S cleavage isomers on the proliferation of oral cancer cells CAL27; Figure 5 D: Statistical graph of the effect of EdU assay on the proliferation of oral cancer cells CAL27 by overexpression of TCF7L2-L and TCF7L2-S cleavage isomers; Figure 5 E: EdU assay to detect the effect of overexpression of TCF7L2-L and TCF7L2-S cleavage isomers on the proliferation of oral cancer cells SCC9; Figure 5F: Statistical graph of the effect of EdU assay on the proliferation of oral cancer cells SCC9 by overexpression of TCF7L2-L and TCF7L2-S cleavage isomers; statistical analysis was performed using Student's t-test method, ns represents no significance. . Detailed Implementation
[0036] The following examples are intended to further illustrate the present invention, but not to limit the scope of protection of the present invention.
[0037] The cell lines used in the cell experiments of this invention include normal oral mucosal cells (HOK) and oral cancer cell lines CAL27, SCC9, SAS, and SCC15 (purchased from Ningbo Mingzhou Biotechnology Co., Ltd.). Cell culture was carried out in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture, and maintained in a constant temperature incubator at 37°C, 5% CO2, and 95% humidity.
[0038] The distinction between the TCF7L2-L and TCF7L2-S cleavage isomers of this invention was designed based on exon 14 of TCF7L2, using online design on the Primer 5.0 website. The final primer synthesis was commissioned to Shanghai Sangon Biotech Co., Ltd.
[0039] (1) TCF7L2-L primers
[0040] Upstream primer: 5'-TGAGCGCTCCTAAGAAATGC-3', see SEQ ID NO.4;
[0041] Downstream primer: 5'-CCGCACCAGTTATTCTGTTG-3', see SEQ ID NO.5;
[0042] The GAPDH internal reference primer in the PCR reagent is:
[0043] Upstream primer: 5'- GGAGCGAGATCCCTCCAAAAT -3', see SEQ ID NO.6;
[0044] Downstream primer: 5'- GGCTGTTGTCATACTTCTCATGG-3', see SEQ ID NO.7;
[0045] All experimental results in this invention were analyzed using statistical methods: t-tests were used to evaluate differences between two groups. p < 0.05 was used to indicate statistical significance, and all p-values were performed using two-tailed tests. Statistical analysis was conducted using Graphpad 9.5 software.
[0046] Example 1: Expression of TCF7L2-L cleavage isomer in normal oral mucosal epithelial cells and oral cancer cells
[0047] 1. RNA extraction from normal oral mucosal epithelial cells and oral cancer cells
[0048] (1) Discard the culture medium from the cell culture, wash once with PBS to remove as much liquid as possible; add 1 mL of pre-cooled TRIzol directly, shake gently, scrape off with a spatula, and repeatedly pipette until completely homogenized, then transfer to a 1.5 mL enzyme-free EP tube;
[0049] (2) Add 200 μL of chloroform (trichloromethane) to the EP tube, shake to mix, and let stand at room temperature for 15 min while pre-cooling the centrifuge.
[0050] (3) Once the upper layer begins to separate, place it in a centrifuge and centrifuge at 4 ℃, 12000 rpm / min for 15 min;
[0051] (4) Remove the EP tube and carefully aspirate the supernatant aqueous phase into a new RNase-free centrifuge tube (avoid disturbing the intermediate layer); the volume of the aqueous phase is usually about 60% of the initial TRIzol volume; supernatant: RNA phase, lower layer: phenol phase, intermediate layer: dye;
[0052] (5) Add an equal volume of pre-cooled isopropanol and mix well. Let stand at 4°C for 30 min. Centrifuge at 4°C, 12000 rpm / min for 30 min. Discard the supernatant and let the RNA settle at the bottom of the tube.
[0053] (6) Add 1 mL of anhydrous ethanol, gently shake the centrifuge tube to resuspend the precipitate, centrifuge at 4 ℃, 10000 g / min for 5 min, discard the supernatant as much as possible, and repeat twice;
[0054] (7) Invert the precipitate and dry it at room temperature for 5-10 minutes. Do not dry it too much, otherwise it will be difficult to dissolve. Add enzyme-free water to dissolve the precipitate.
[0055] (8) Turn on the Biodrop uLITE spectrophotometer, first calibrate the instrument with 1 μL of enzyme-free water, after mixing and separating the sample to be tested, take 1 μL to detect the RNA concentration and purity and record it. Store the sample in a -80 ℃ refrigerator.
[0056] 2. cDNA preparation
[0057] (1) Perform reverse transcription reaction according to the instructions of the reverse transcription kit (Thermo Corporation). Take 0.2 mL of enzyme-free EP tube, add 2 μg of RNA volume (V) and 1 μL of primer to each well. When detecting mRNA expression level, select Oligo(dT) primer. Add water to make up to 12 μL, mix thoroughly and centrifuge briefly.
[0058] (2) Remove from water bath at 65 ℃ for 5 min and immediately place on ice;
[0059] (3) Add 4 μL of 5× reaction buffer, 1 μL of RiboLock ribonuclease inhibitor, 2 μL of dNTP mixture and 1 μL of reverse transcriptase to each EP tube in sequence, for a total volume of 20 μL;
[0060] (4) After thorough mixing and flash separation, place the product into a PCR instrument and set the reverse transcription program as follows: 42℃ for 60 min for reverse transcription, 70℃ for 5 min for inactivation of reverse transcriptase, and 4℃ for simulated ice bath. The cDNA product can then be used directly for semi-quantitative RT-PCR reaction or stored at -20℃ and can be used within one week.
[0061] 3. PCR amplification
[0062] The PCR amplification system was performed according to the instructions for the high-potency amplification enzyme provided by Novizan Biotech, and the system is shown in Table 1:
[0063] Table 1 PCR Amplification System
[0064]
[0065] PCR reaction program: 95℃ pre-denaturation for 5 minutes, 94℃ denaturation for 30 seconds, annealing at 65℃ for 30 seconds, extension at 72℃ for 2 minutes, for a total of 32 cycles; 72℃ for 5 minutes.
[0066] 4. Results
[0067] The expression of the TCF7L2-L splice isoform was detected in normal oral mucosal epithelial cells and oral cancer cells using semi-quantitative RT-PCR. The results showed that compared with normal oral mucosal epithelial cells (HOK), the expression of the TCF7L2-L splice isoform was significantly increased in oral cancer cells. (See attached figures). Figure 1 A.
[0068] Example 2: Expression of TCF7L2-L cleavage isomer in oral cancer tissue and paired adjacent normal tissue
[0069] To detect the expression of the TCF7L2-L cleavage isoform in oral cancer tissues, a specific oligonucleotide probe for TCF7L2-L (Dig-CCAGTTATTCTGTTGATCAAGGCCAAAGCGCGCTC-Dig, see SEQ ID NO. 8) was designed and synthesized. In situ hybridization experiments were then performed on 96 pairs of oral cancer tissues and paired adjacent normal tissues to detect the expression of TCF7L2-L. The results showed that the expression of TCF7L2-L in oral cancer tissues was higher than that in paired adjacent normal tissues. (See SEQ ID NO. 8 for details). Figure 1B, Figure 1 C represents the corresponding quantitative analysis result.
[0070] In situ hybridization experimental procedures
[0071] (1) Dewaxing and hydration: The tissue sections were placed in a 65℃ oven for 2 hours to melt the paraffin. They were then quickly placed in xylene I and xylene II for dewaxing twice, 10 minutes each time. Subsequently, they were placed in anhydrous ethanol for 5 minutes, 95% alcohol for 5 minutes, 85% alcohol for 5 minutes, 75% alcohol for 5 minutes, and distilled water for 5 minutes.
[0072] (2) Place in 3% H2O2 at room temperature for 10 min to inactivate peroxidase, and wash twice with distilled water for 5 min each time;
[0073] (3) Expose RNA fragments, add freshly diluted pepsin with 3% citric acid to the slices, digest at room temperature for 20 min, wash three times with 0.5M PBS for 5 min each time, and wash once with distilled water;
[0074] (4) Prehybridization: Add 20 μL of prehybridization solution to each slide, incubate at 37℃ for 2-4 h, remove excess liquid, and do not wash.
[0075] (5) Hybridization: Dissolve the digoxigenin-labeled oligonucleotide probe in 100 μM stock solution and store at -20℃. Take an appropriate amount of probe and dilute it to 5 μM working solution. Add 20 μL of the diluted working solution to each slice and hybridize overnight at 37℃.
[0076] (6) Washing after hybridization: Wash twice with 2×SSC solution preheated at 30-37℃ for 5 min each time, wash for 15 min with 0.5×SSC solution, wash for 15 min with 0.2×SSC solution, and repeat the washing with 0.2×SSC solution once if necessary;
[0077] (7) Blocking: Add blocking solution to the slide, block at 37°C for 30 minutes, then shake off the excess liquid. No rinsing is required.
[0078] (8) Add biotinylated mouse anti-digoxin: incubate at 37℃ for 60 min, then wash with PBS 4 times, 5 min each time;
[0079] (9) Add SABC: Incubate in a 37℃ oven for 20 min, then wash with PBS 3 times, 5 min each time;
[0080] (10) Add biotinylated peroxidase: incubate in a 37°C oven for 20 min, then wash with PBS 4 times, 5 min each time;
[0081] (11) DAB color development: Prepare the color development working solution fresh. After mixing evenly, drop it onto the tissue section for about 5-10 minutes. Observe the color change under a microscope, then put it in water and wash away the excess color with distilled water;
[0082] (12) Hematoxylin counterstaining: Add hematoxylin to the slide to stain the nucleus, stain at room temperature for about 2-5 minutes, then rinse with running water for about 30 minutes, and observe the staining under a microscope;
[0083] (13) Dehydration: Place in 75%, 85%, 95% and 100% graded alcohols for 5 minutes each time, and xylene II and xylene I for 10 minutes each time until clear. Place in a fume hood to air dry.
[0084] (14) Mounting: Add an appropriate amount of neutral resin to the slide and mount it. After drying, observe and photograph it under a microscope.
[0085] (15) Expression level scoring criteria: ImageJ software was used for quantification. The specimens were semi-quantitatively processed by combining the average staining intensity and the percentage of positive cells. The judgment criteria are as follows: According to the positive staining intensity: ① no staining of cells is 0 points, ② cells are stained light brown is 1 point, ③ cells are stained brown without background staining, or cells are stained dark brown but the background is light brown is 2 points, ④ cells are stained dark brown and there is no background staining is 3 points. According to the percentage of positive cells: ① no positive cells are present is 0 points, ② positive cells <25% is 1 point, ③ 25% < positive cells <50% is 2 points, ④ positive cells 50-75% is 3 points, ④ positive cells 75-100% is 4 points. The final score is the product of the two scores. 0 points is no expression, 1-4 points is low expression, and 6-12 points is high expression.
[0086] Example 3: Detection of the knockdown effect of TCF7L2-L cleavage isomer in oral cancer cell lines
[0087] To test the efficiency of TCF7L2-L knockdown, Shanghai Jikai Gene Technology Co., Ltd. designed and synthesized interference sequences (sh-TCF7L2-L) and blank control sequences (sh-NC) targeting TCF7L2-L. sh-TCF7L2-L-1: ACCTGAGCGCTCCTAAGAAAT (SEQ ID NO. 9); sh-TCF7L2-L-2: GCCTTGATCAACAGAATAACT (SEQ ID NO. 10). The interference sequences were cloned into the GV102 vector (constructed by Shanghai Jikai Gene Technology Co., Ltd.) to obtain the knockdown plasmid. To evaluate the knockdown efficiency of TCF7L2-L, well-grown oral cancer cells were seeded into 6-well plates. When the cell confluence reached 50%-70%, the interference sequences and blank control sequences of TCF7L2-L were transiently transfected into oral cancer cells CAL27 and SCC9 using lipofectamine 3000, and cultured for another 48 hours. Cells were collected, and the expression level of TCF7L2-L was detected using RT-qPCR (using the aforementioned TCF7L2-L-specific primers). RT-qPCR results showed that, compared with the sh-NC group, TCF7L2-L expression was significantly downregulated in the sh-TCF7L2-L group, indicating that the interfering sequence could effectively inhibit TCF7L2-L expression, and the knockdown plasmid was successfully constructed. (See attached image). Figure 2 .
[0088] Example 4: Effect of in vitro knockdown of TCF7L2-L on oral cancer cell proliferation.
[0089] First, the TCF7L2-L interference sequence and the blank control sequence were transiently transfected into oral cancer cells CAL27 and SCC9 using lipofectamine 3000. After 48 hours of culture, CCK-8 and EdU assays were performed to verify their effects on cell proliferation. Based on the results of the CCK-8 assay from day 1 to day 4, a significant difference in cell proliferation was found between the TCF7L2-L knockdown group and the blank control; the EdU assay showed a significant difference in cell proliferation between the TCF7L2-L knockdown group and the blank control; knockdown of TCF7L2-L can affect the proliferation of oral cancer cells; the results are shown in the table below. Figure 3 AF.
[0090] Example 5: Effect of in vitro knockdown of TCF7L2-L on clonogenic formation of oral cancer cells
[0091] First, the interference sequence of TCF7L2-L and the blank control sequence were transiently transfected into oral cancer cells CAL27 and SCC9, respectively, using lipofectamine 3000. Colony formation assays were then performed to verify their effect on cell colony formation ability. The results showed that knockdown of TCF7L2-L significantly inhibited the colony formation ability of oral cancer cells. (See attached results). Figure 3 GI.
[0092] Cloning experiment steps:
[0093] (1) Cell preparation: Culture the cells in a suitable culture medium until they grow to the logarithmic growth phase (cell density is approximately 5 × 10⁻⁶). 5 –1×10 6 When the cell volume reaches ( / mL), discard the culture medium and wash twice with PBS buffer. Then, perform trypsin digestion and centrifuge to collect the cells.
[0094] (2) Prepare cell suspension: Resuspend the digested cells in fresh culture medium at a certain ratio, and add them evenly to a 6-well plate under sterile conditions to ensure that the initial cell number of each well is consistent and that the cells are evenly distributed on the plate surface.
[0095] (3) Place the culture plate in an incubator at 37°C and incubate for about a week. Change the culture medium every 2 days during this period.
[0096] (4) Observe cell growth: Observe the cell growth status under a microscope. When cells are visible to aggregate and form obvious cell clumps, it is considered that a clone has been formed.
[0097] (5) Fixation and staining: Discard the culture medium, fix the cells with 4% paraformaldehyde solution for about 15–20 min, wash with PBS and then add crystal violet staining solution for about 10–15 min. Then wash gently with water to remove excess dye, air dry and count the number of clones and perform statistical analysis.
[0098] Example 6: Detection of overexpression effects of TCF7L2-L and TCF7L2-S splice isomers in oral cancer cell lines
[0099] To assess the expression efficiency of the TCF7L2-L overexpression vector, eukaryotic overexpression vectors pcDNA3.1-CMV-TCF7L2-L-3flag and pcDNA3.1-CMV-TCF7L2-S-3flag (constructed by Shanghai Jikai Gene Technology Co., Ltd.) were constructed based on representative sequences in the sequence listing and expressed in oral cancer cells. Oral cancer cells CAL27 with good growth were seeded into 6-well plates. When cell confluence reached 50%-70%, the endotoxin-free plasmid pcDNA3.1 empty vector and the eukaryotic overexpression vectors pcDNA3.1-CMV-TCF7L2-L-3flag (TCF7L2-L) and pcDNA3.1-CMV-TCF7L2-S-3flag (TCF7L2-S) were transiently transfected into oral cancer cells CAL27 using lipofectamine 3000. The cells were then cultured for 48 hours. Cells were collected, and the expression level of TCF7L2-L was detected using Western blotting. Western blotting results showed that the bands for TCF7L2-L and TCF7L2-S were increased compared to the control group. (See attached image). Figure 4 This indicates that the overexpression vectors of TCF7L2-L and TCF7L2-S were successfully constructed. Figure 4 The vector in the text refers to the empty vector plasmid.
[0100] Example 7: Effects of in vitro overexpression of TCF7L2-L and TCF7L2-S on clonogenesis of oral cancer cells
[0101] First, the endotoxin-free plasmid pcDNA3.1 empty vector and the eukaryotic overexpression vectors pcDNA3.1-CMV-TCF7L2-L-3flag (TCF7L2-L) and pcDNA3.1-CMV-TCF7L2-S-3flag (TCF7L2-S) were transiently transfected into oral cancer cells SCC9 using lipofectamine 3000. Colony formation assays were then performed to verify their effects on cell colony formation ability. The results showed that overexpression of TCF7L2-L significantly promoted the colony formation ability of the oral cancer cell line SCC9, while TCF7L2-S had no significant promoting effect on the colony formation ability of the oral cancer cell line SCC9. (See attached figures). Figure 5 A, 5B.
[0102] Example 8: Effects of in vitro overexpression of TCF7L2-L and TCF7L2-S on the proliferation of oral cancer cells
[0103] First, oral cancer cells SCC9 and CAL27 were transiently transfected with the endotoxin-free plasmid pcDNA3.1 empty vector and the eukaryotic overexpression vectors pcDNA3.1-CMV-TCF7L2-L-3flag (TCF7L2-L) and pcDNA3.1-CMV-TCF7L2-S-3flag (TCF7L2-S) using Lipofectamine 3000. After 48 hours of culture, EdU formation assays were performed to verify its effect on cell proliferation. The results showed that in vitro overexpression of TCF7L2-L promoted the proliferation of oral cancer cells, while TCF7L2-S had no significant promoting effect on the proliferation of oral cancer cell lines. (See attached figures). Figure 5 CF.
[0104] SEQ ID NO:1 Exon 14 of the TCF7L2 gene:
[0105] ACCTGAGCGCTCCTAAGAAATGCCGAGCGCGCTTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCTTGCAG.
[0106] The coding region of the representative sequence of SEQ ID NO: 2 TCF7L2-L
[0107]
[0108] The coding region of the representative sequence of SEQ ID NO: 3 TCF7L2-S
[0109]
Claims
1. The application of a reagent for detecting the cleavage isomer of TCF7L2-Exon14, characterized in that, The reagent is used to prepare oral cancer diagnostic agents; the TCF7L2-Exon14 splice isomer is an isomer containing exon 14 of the TCF7L2 gene, and the sequence of exon 14 of the TCF7L2 gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, Reagents for detecting TCF7L2-Exon14 cleavage isomers include PCR detection reagents or in situ probe hybridization detection reagents.
3. The application according to claim 2, characterized in that, The primers of the PCR detection reagent can amplify exon 14 of the TCF7L2 gene.
4. The application according to claim 3, characterized in that, The primer sequences are as follows: Upstream primer: 5'-TGAGCGCTCCTAAGAAATGC-3' Downstream primer: 5'-CCGCACCAGTTATTCTGTTG-3'.
5. The application according to claim 2, characterized in that, The probe in the in situ probe hybridization detection reagent can hybridize with the region of exon 14 of the TCF7L2 gene.
6. The application according to claim 5, characterized in that, The probe sequence is as follows: Dig-CCAGTTATTCTGTTGATCAAGGCCAAAGCGCGCTC-Dig.
7. The application of a reagent that inhibits the cleavage isomer of TCF7L2-Exon14, characterized in that, The reagent is used to prepare oral cancer treatment agents; the TCF7L2-Exon14 splice isomer is an isomer containing exon 14 of the TCF7L2 gene, and the sequence of exon 14 of the TCF7L2 gene is shown in SEQ ID NO.
1.
8. The application according to claim 7, characterized in that, The reagents used to inhibit the TCF7L2-Exon14 cleavage isoform include: shRNA preparations.
9. The application according to claim 8, characterized in that, shRNA formulations include at least one of the following sequences: ACCTGAGCGCTCCTAAGAAAT; GCCTTGATCAACAGAATAACT.
10. A drug for treating oral cancer, characterized in that, The drug comprises an shRNA preparation that inhibits the TCF7L2-Exon14 splice isoform, wherein the TCF7L2-Exon14 splice isoform is an isoform containing exon 14 of the TCF7L2 gene, and the sequence of exon 14 of the TCF7L2 gene is shown in SEQ ID NO.1; the shRNA preparation comprises at least one of the following sequences: ACCTGAGCGCTCCTAAGAAAT; GCCTTGATCAACAGAATAACT.
Citation Information
Patent Citations
Aluminum profile (914a)
CN3238270D
Aluminum profile (912a)
CN3239352D
Oral cancer diagnostic marker SLC37A4-Exon7 shear isomer and application thereof
CN118547073A
Diagnostic biomarkers of diabetes
US20110275079A1
Targeted treatment of spliceopathy-induced neurological disorders
US20250290074A1