Deoxyribozyme probe for specifically distinguishing G-quadruplex and single-chain structure of G-rich sequence and application of deoxyribozyme probe

By designing deoxyribozyme probes that specifically distinguish between G-rich sequence-based G-quadruplexes and single-stranded structures, and using specific deoxynucleotide sequences and cofactor Mg2+, efficient cleavage and highly specific recognition of G-rich sequence-based single-stranded structures were achieved under physiological conditions. This solves the problems of insufficient stability and specificity in the detection of DNA structures in existing technologies and is suitable for biosensing applications.

CN121915031APending Publication Date: 2026-04-24DALIAN UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DALIAN UNIV OF TECH
Filing Date
2025-12-30
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and specifically detecting and distinguishing between G-quadruplexes and single-stranded structures in DNA under physiological conditions.

Method used

A deoxyribozyme probe that specifically distinguishes between G-rich sequence-based G-quadruplexes and single-stranded structures was designed. Using specific deoxynucleotide sequences and the cofactor Mg2+, it achieves efficient cleavage under conditions of pH 7.2–8.2 and 24℃–31℃.

Benefits of technology

It achieves efficient cleavage and highly specific recognition of G-rich sequence single-stranded structures, making it suitable for biosensing applications and exhibiting significant advantages in stability and specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121915031A_ABST
    Figure CN121915031A_ABST
Patent Text Reader

Abstract

The invention discloses a deoxyribozyme probe capable of specifically distinguishing a G-quadruplex and a single-strand structure of a G-rich sequence and application of the deoxyribozyme probe, and belongs to the technical field of deoxyribozyme probes. The method comprises the following steps: firstly, connecting a phosphorylated library enzyme chain with a substrate chain containing RNA (Ribonucleic Acid) modification sites to construct a linear DNA (Deoxyribose Nucleic Acid) library; then, under the condition that the pH is 7.4, co-incubating the library and a G-rich sequence in a single-chain state, separating and purifying a DNA strip for cutting an RNA site in the library, recovering a positive-sense strand after PCR amplification, and carrying out multiple rounds of screening to obtain the chain deoxyribozyme probe. The obtained probe can specifically detect a G-rich sequence in a single-chain form, has no response to a G-quadruplex structure, and has a good application prospect in the field of biosensing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of deoxyribozyme probe technology, specifically relating to a deoxyribozyme probe that specifically distinguishes between G-tetramplexes and single-stranded structures rich in G sequences and its applications. Background Technology

[0002] In DNA molecules, besides the classic B-type double helix, specific repetitive sequences can fold under appropriate conditions to form various non-B-type DNA structures, such as A-type and Z-type double helices, hairpin structures, triple helices (e.g., H-DNA), and quadruplexes (e.g., G-quadruplexes and i-motifs). Compared to most other non-B-type DNAs that are only stable under extreme conditions (e.g., strong acids or molecular crowding), G-quadruplexes exhibit higher stability under physiological conditions, are widely present in cells, and have significant research value. Studies have found that many organisms' genomes contain sequences with the potential to form G-quadruplexes. In the human genome, there are over 700,000 nucleic acid sequences that may form G-quadruplexes. These sequences are significantly enriched at telomere ends, genome replication initiation sites, promoter regions, and untranslated regions of mRNA. Furthermore, G-quadruplex structures formed at different locations perform different biological functions. The telomere ends of human genes have the highest concentration of G-quadruplexes. The biological functions of this special secondary structure, the G-quadruplex, as currently discovered are as follows: (1) Inhibition of telomerase activity: Studies have found that the G-quadruplex structure at the end of human telomeres can effectively inhibit telomerase activity, thereby inhibiting telomere elongation and cancer cell proliferation.

[0003] (2) Participation in telomere end protection: The continuously formed G-quadruplex can provide a protective capping structure for the telomere end to resist hydrolysis by exonuclease, thereby maintaining the length of the telomere end.

[0004] (3) Regulation of telomere elongation: The parallel conformation of G-quadruplexes formed at the end of telomeres can be bound by telomerase and play a role in elongating telomeres, but the antiparallel and mixed conformations of G-quadruplexes can inhibit telomere elongation.

[0005] Deoxyribonucleases, also known as DNAzymes, are ssDNA fragments synthesized using in vitro molecular evolution techniques. They possess highly efficient catalytic activity and structure recognition capabilities, and mainly include cleaving deoxyribonucleases, peroxidase-active deoxyribonucleases, linker-active deoxyribonucleases, and metal-chelate reaction-catalyzed deoxyribonucleases. Among them, RNA-cleaving deoxyribonucleases (RCDs) are the most widely studied class. RCDs exhibit good biocompatibility, high flexibility, ease of modification of signaling molecules, and synthetic accessibility, and are therefore widely used in fields such as nucleic acid mutation, in vivo imaging, gene therapy, and tumor diseases. Using DNAzymes to detect G-quadruplex structures holds promise for overcoming the bottlenecks of existing detection methods in terms of stability, specificity, and ease of operation, ultimately achieving highly specific detection of intracellular G-quadruplexes. Summary of the Invention

[0006] Therefore, the purpose of this invention is to provide a deoxyribozyme probe that specifically distinguishes between G-rich sequence-rich G-quadruplexes and single-stranded structures, and its application.

[0007] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a deoxyribonuclease, characterized in that the nucleotide sequence of the deoxyribonuclease is any one of the following sequences (1) to (2): (1) AGACCACAACGGTTTCCGATGAATTACCGCTGTGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG; (2)AGACCACAACGGTTTCCGATGGATTACCGCTGAGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG.

[0008] Secondly, the present invention provides a deoxyribozyme probe, characterized in that the nucleotide sequence of the deoxyribozyme probe is any one of the following sequences (1) to (2): (1)CTATGAACTGACTrATGACCTCACFTACCAAGAGACCACAACGGTTTCCCGATGAATTACCGCTGTGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG; (2)CTATGAACTGACTrATGACCTCACFTACCAAGAGACCACAACGGTTTCCCGATGGATTACCGCTGAGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG; Among them, sequences (1) and (2) all constitute cis-structured deoxyribonucleases, where rA represents RNA base A and FT represents T base containing a fluorescent group.

[0009] Thirdly, the present invention provides a kit for identifying G-rich sequence single-stranded structures, comprising the above-mentioned deoxyribonuclease or deoxyribonuclease probe.

[0010] Based on the above technical solution, the kit further includes cofactors and pH buffer reagents.

[0011] Based on the above technical solution, further, the auxiliary factor is Mg. 2+ .

[0012] Based on the above technical solution, the pH buffer reagent further includes Tris-HCl buffer solution.

[0013] Fourthly, the present invention provides the application of the above-mentioned deoxyribonuclease, the above-mentioned deoxyribonuclease probe, or the above-mentioned kit in biosensing for the specific recognition of single-stranded structures rich in G sequences.

[0014] Based on the above technical solution, it is further used to distinguish between G-quadruplex structures and single-strand structures rich in G sequences.

[0015] Based on the above technical solution, the optimal conditions for specifically recognizing single-stranded structures rich in G sequences are: pH 7.2–8.2, 24℃–31℃, and Mg... 2+ The final concentration is 5~60 mM.

[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) The single-stranded deoxyribozyme obtained in this invention has an increasing cleavage efficiency of the target G-rich sequence single-stranded structure over time.

[0017] (2) The deoxyribozyme probe provided by the present invention has good stability and high specificity, and can play a significant advantage in biosensing applications. Attached Figure Description

[0018] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0019] Figure 1 This is a schematic diagram of the screening process for chain deoxyribonucleases.

[0020] Figure 2 This is a statistical chart showing the cutoff rate results for each of the 12 rounds of in vitro screening.

[0021] Figure 3 The figure shows the experimental results for verifying the catalytic activity and specificity of the enriched chain deoxyribonuclease.

[0022] Figure 4 The figure shows the results of the study on the effect of different monovalent cations on the formation of G-tetrachain structure and cleavage activity of the chain deoxyribonuclease RCD-AG9. In the figure, A is the circular dichroism chromatogram of the AG22 sequence forming G-tetrachain under different monovalent ion conditions, and B is the corresponding cleavage rate result.

[0023] Figure 5 The graph shows the cleavage rate of the chain deoxyribonuclease RCD-AG9 at different pH values.

[0024] Figure 6 The graph shows the cleavage rate of the chain deoxyribonuclease RCD-AG9 at different temperatures.

[0025] Figure 7 For the chain deoxyribonuclease RCD-AG9 in different Mg 2+ Cutting rate results at different concentrations.

[0026] Figure 8 The figure shows the experimental results of the specificity of the chain deoxyribonuclease RCD-AG9 for divalent metal ions.

[0027] Figure 9 The results show the kinetic characterization of the chain deoxyribonuclease RCD-AG9, where A is the gel development result and B is the curve of the cutting rate changing with time.

[0028] Figure 10 The results represent the sequence-specific characterization of the chain deoxyribonuclease RCD-AG9. Detailed Implementation

[0029] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0030] The names and sequences of the nucleic acids involved in the examples are shown in Table 1.

[0031] Table 1. Description of Nucleic Acid Names, Sequences, and Uses

[0032] Example 1: Directed construction and purification of library-substrate complex F30-DL1 (1) Phosphorylation of DNA library DL1 The DNA library DL1 (SEQ ID NO.1) was mixed with T4 polynucleotide kinase (PNK) and incubated at 37°C for 50 min to phosphorylate the DNA library DL1. The phosphorylation reaction system is shown in Table 2.

[0033] Table 2. Components of L1 phosphorylation reaction in DNA library (50 μL)

[0034] (2) Ligation reaction of DNA library-substrate complex An equimolar amount of reverse substrate strand F30 (SEQ ID NO.2), 1.2 times the amount of auxiliary strand DS1 (SEQ ID NO.3), and T4 DNA ligase were added to a phosphorylated DNA library. The ligation reaction system is shown in Table 3. All components were mixed evenly and reacted at room temperature for 2.5 h to construct the DNA library-substrate complex DL1-F30.

[0035] Table 3. Composition of the ligation reaction (100 μL)

[0036] (3) Ethanol precipitation recovery of the complex Add 2.5 volumes of cold ethanol, 0.1 volumes of 3 mol / L sodium acetate, and 2 μL of 1 μg / μL glycogen to the ligation reaction system, and freeze at -20°C for 30 min to carry out DNA precipitation. Centrifuge the precipitated mixture at low temperature and high speed (4°C, 14000 rpm, 20 min), remove the supernatant, and vacuum dry for 5 min to obtain F30-DL1 complex solid powder.

[0037] (4) dPAGE gel purification complex F30-DL1 solid powder was reconstituted with 20 μL of ultrapure water and purified by 10% denaturing polyacrylamide gel electrophoresis (dPAGE). The location of the target band was determined by gel imaging, and the gel was excised and recovered. DNA was extracted by elution buffer (5M NaCl, 1M Tris (pH 7.5), 0.5M EDTA (pH 8.0)). The eluent was precipitated with cold ethanol and vacuum dried to obtain the library-substrate complex F30-DL1 powder required for forward screening.

[0038] Example 2: In vitro catalytic screening and enrichment of active sequences (1) Complex folding and catalytic reaction The F30-DL1 powder prepared in Example 1 was dissolved in 30 µL ddH2O, heated at 90 °C for 2 min, and then cooled to room temperature to allow the complex to fold into a catalytically active conformation. Then, 50 µL Tris-HCl solution (pH 7.4), 10 µL MgCl2 solution (150 mM), and 10 µL target sequence AG22 solution (100 µM) were added for forward screening and incubation for 3 h. The reaction components are shown in Table 4. The reaction was terminated by adding cold ethanol.

[0039] Table 4. Composition of in vitro catalytic positive screening reaction (100 μL)

[0040] (2) Isolation and recovery of active sequences The product after the positive screening reaction was separated and purified by 10% denaturing polyacrylamide gel electrophoresis. The corresponding band of the cleavage product was cut off and the active DNA sequence of the first round of screening was obtained by cold ethanol precipitation.

[0041] (3) PCR amplification of active sequences Using DNA sequences capable of cleavage recovered through forward screening as templates, the target sequences were amplified in large quantities by two-step PCR using upstream primer FP (SEQ ID NO.4), downstream primer RP1 (SEQ ID NO.5), and RP2 (SEQ ID NO.6). The PCR program conditions are shown in Table 5, and the reaction systems are shown in Tables 6 and 7.

[0042] PCR products were isolated and purified using 10% dPAGE. Due to the spatial modification of the downstream primer RP2, PCR amplification yielded sense strands (73 nt) and antisense strands (94 nt) of different lengths. The sense strands were excised from the gel, vacuum dried, and dissolved in ultrapure water to form secondary libraries for the next round of screening. The concentrations were determined by Nanodrop after screening.

[0043] Table 5 PCR Procedure Conditions

[0044] Table 6. PCR1 reaction system (50 μL)

[0045] Table 7 PCR2 reaction system (50 μL)

[0046] (4) Multi-round iterative screening Steps (1) to (3) were repeated for a total of 12 rounds of screening. The cut percentage (clv%) was calculated using the following formula to characterize the enrichment of the DNA library after each round of screening. The results are as follows: Figure 2 As shown in the figure. A negative control without the target AG22 solution was set up in the experiment. It was observed that the DNA cleavage activity increased sharply in the 7th round, and was much higher than the cleavage rate of the negative control. Therefore, the reaction time and target amount of the positive screening were gradually reduced, from 3 h to 30 min, and the final target concentration was reduced from 10 µM to 100 nM, thereby obtaining deoxyribozymes with higher catalytic activity.

[0047]

[0048] Where clv% is the cleavage percentage, clv is the amount of library that underwent cleavage, and unclv is the amount of library that did not undergo cleavage.

[0049] The DNA obtained from the final round of screening was subjected to high-throughput sequencing. The top 10 sequences with the highest enrichment rates were selected for experimental verification. The verification system is shown in Table 8. The ligation products of the top ten sequences and substrate F30 were dissolved in 40 µL ddH2O, and two sets of experiments were performed for each sequence. Table 8 shows the reaction system (100 μL) for the first ten sequences.

[0050] The results are as follows Figure 3 As shown, the results indicate that RCD-AG9 (SEQ ID NO.8) and RCD-AG10 (SEQ ID NO.9) can distinguish between G-quadruplexes and single chains, exhibiting high catalytic activity and high specificity.

[0051] Example 3 Characterization of deoxyribozyme performance (1) Characterization of catalytic activity and substrate specificity The chain-like deoxyribonuclease RCD-AG9 obtained in Example 2 was dissolved in 20 µL ddH2O, heated at 90°C for 2 min, and then cooled to room temperature. 50 µL Tris-HCl solution (pH 7.4, 20 mM), 10 µL MgCl2 solution (150 mM), 10 µL monovalent ion solution (1.5 M), and 10 µL target sequence AG22 solution (100 µM) were added, and the reaction was carried out for 1 h. A control group without monovalent ions was also included. Separation was performed using a 10% dPAGE gel, and the cleavage rate was calculated. Figure 4 As shown, the results show K + The cutting rate suppression is the highest for Li. +The inhibition level is the lowest. At the same concentration, the better the G-quadruplex structure is formed, the lower the cleavage rate, indicating that the deoxyribozyme that specifically recognizes the G-rich sequence single-stranded structure has been successfully obtained through in vitro screening.

[0052] (2) pH characterization Taking the chain deoxyribonuclease RCD-AG9 (SEQ ID NO.8) as an example, in Mg 2+ Under conditions of consistent concentration, seven different pH reaction buffers with pH ranges of 3-8 were prepared. The other components and concentrations in the reaction system were the same as those in the catalytic activity and substrate specificity characterization experiments described above. Each reaction buffer was incubated for 1 hour, and the mixture was separated by a 10% dPAGE gel. The results are as follows: Figure 5 As shown in the figure. Experimental results show that there is no catalytic activity at pH 3 and 4; moderate catalytic activity at pH 5-7; and the highest cleavage rate in the pH range of 7.4-8.

[0053] (3) Characterization of reaction temperature Taking the chain deoxyribonuclease RCD-AG9 (SEQ ID NO.8) as an example, under the conditions of maintaining the metal ion concentration and pH 7.4, the other components and contents in the reaction system were the same as those in the above-described characterization experiments of catalytic activity and substrate specificity. After incubation at different temperatures for 1 hour, the mixture was separated by 10% dPAGE gel. Figure 6 As shown, the cleavage rate is highest at 25℃ and 30℃, and decreases as the temperature gradually increases.

[0054] (4) Mg 2+ Concentration-dependent characterization Taking the chain deoxyribonuclease RCD-AG9 (SEQ ID NO.8) as an example, under the conditions of pH 7.4 and temperature 25℃, the other components and contents in the reaction system were the same as those in the above-mentioned characterization experiments of catalytic activity and substrate specificity. Different Mg... 2+ The concentration-dependent nature of deoxyribozymes was characterized at various concentrations. Experimental results are as follows: Figure 7 As shown, with Mg 2+ As the concentration increases, the cleavage rate of the deoxyribozyme also increases, reaching 60% at 50 mM.

[0055] (5) The influence of divalent metal ions on characterization Taking the chain deoxyribonuclease RCD-AG9 (SEQ ID NO.8) as an example, under the conditions of pH 7.4 and temperature 25℃, the other components and contents in the reaction system were the same as those in the above-mentioned characterization experiments of catalytic activity and substrate specificity. Different divalent metal ions were changed, and the mixture was incubated for 1 h and separated by 10% dPAGE gel. The experimental results are as follows: Figure 8 As shown. This deoxyribonuclease is effective against Mg.2+ It has the highest activity response to Mn 2+ and Ca 2+ It responds, but its catalytic activity is low and it does not respond to other divalent metal ions.

[0056] (6) Kinetic characterization of deoxyribonuclease Taking the chain deoxyribonuclease RCD-AG9 (SEQ ID NO.8) as an example, kinetic characterization was performed at pH 7.4 and 25℃, with time gradients set to 1, 5, 10, 20, 30, 40, 60, 120, and 180 min. After the reaction, the reaction sample was characterized by passing it through a 10% dPAGE gel, and the cleavage rate was calculated. The results are shown below. Figure 9 As shown.

[0057] (7) Sequence-specific characterization Taking the chain deoxyribonuclease RCD-AG9 (SEQ ID NO.8) as an example, other DNA structural sequences existing in the cell were selected for specific characterization of the target, and the results are as follows: Figure 10 As shown.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A deoxyribozyme, characterized in that, The deoxyribonuclease nucleotide sequence is any one of the following sequences (1) to (2): (1) AGACCACAACGGTTTCCGATGAATTACCGCTGTGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG; (2)AGACCACAACGGTTTCCGATGGATTACCGCTGAGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG.

2. A deoxyribozyme probe, characterized in that, The nucleotide sequence of the deoxyribozyme probe is any one of the following sequences (1) to (2): (1)CTATGAACTGACTrATGACCTCACFTACCAAGAGACCACAACGGTTTCCCGATGAATTACCGCTGTGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG; (2)CTATGAACTGACTrATGACCTCACFTACCAAGAGACCACAACGGTTTCCCGATGGATTACCGCTGAGTCTAGTAGCCAAAGACGTGGCCCTAGCATAACCCCTTG; In sequence (1)~(2), rA represents RNA base A, and FT represents T base containing a fluorescent group.

3. A kit capable of specifically distinguishing between G-rich sequence-rich G-quadruplexes and single-stranded structures, comprising the deoxyribozyme of claim 1 or the deoxyribozyme probe of claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit includes cofactors and pH buffers.

5. The reagent kit according to claim 4, characterized in that, The cofactor is Mg 2+ .

6. The reagent kit according to claim 4, characterized in that, The pH buffer reagent includes Tris-HCl buffer.

7. The application of the deoxyribonuclease of claim 1, the deoxyribonuclease probe of claim 2, or the kit of any one of claims 3-6 in biosensing for the specific recognition of single-stranded structures rich in G sequences.

8. The application according to claim 7, characterized in that, Used to specifically distinguish between G-rich sequence-based G-quadruplex structures and single-strand structures.

9. The application according to claim 7, characterized in that, The optimal conditions for specific recognition of single-stranded structures rich in G sequences are: pH 7.2–8.2, 24–31 °C, and Mg... 2+ The final concentration is 5~60 mM.