Use of dsrna targeting anthrax candidate effector protein gene cscce3

Abstract

The application belongs to the technical field of RNA biological control, and particularly relates to application of dsRNA targeting candidate effector protein gene of anthracnose CsCCE3 , wherein a nucleotide sequence of the dsRNA is shown as SEQ ID No. 2, the dsRNA is transcribed from an anthracnose CsCCE3 gene target gene segment, and a nucleotide sequence of the anthracnose CsCCE3 gene target gene segment is shown as SEQ ID No. 1. The application provides application of the dsRNA targeting candidate effector protein gene of anthracnose CsCCE3 in preparation of products for preventing and treating crop anthracnose, and pathogenicity of rubber tree anthracnose and mango anthracnose can be obviously reduced by loading the above dsRNA on a nanometer material layered double hydroxide, so that the application has an application prospect of high-efficiency and target prevention and treatment of crop anthracnose.

Description

Technical Field

[0001] This invention belongs to the field of RNA biological control technology, specifically involving targeting candidate effector protein genes of anthrax bacteria. CsCCE3 Applications of dsRNA. Background Technology

[0002] Anthrax ( genus Anthrax) Colletotrichum Fungi are a widely distributed group of plant pathogens, hosting over 3200 plant species. They often cause leaf withering and fruit rot, leading to a significant reduction in crop yield. Mango is a specialty fruit of my country, and anthracnose is its main disease, causing 30% to 60% yield loss annually, and in severe cases, even total crop failure. Currently, 13 species of anthracnose pathogens of mangoes in my country have been reported, including *Anthracnose asiaticus* (…). C. asianum ), Siamese anthrax bacteria ( C. siamense ) and fruit anthracnose ( C. fructicola Anthracnose is the dominant species. In tropical, subtropical, and Mediterranean regions, anthracnose also reduces the quality of exported fruits, especially mangoes, an important export fruit in these regions. High incidence of anthracnose not only severely weakens its commercial value but also causes economic losses exceeding 60% after harvest. Furthermore, rubber trees, the core source of natural rubber, are also heavily affected by anthracnose fungi.

[0003] The core mechanism of action of RNA biopesticides is RNA interference technology. It delivers nucleic acid molecules such as double-stranded RNA (dsRNA) into the target organism, allowing them to bind to mRNA of a specific sequence, blocking the translation process of the target gene, thereby interfering with the normal synthesis of related proteins, disrupting the organism's physiological functions, and ultimately inhibiting pests and diseases and achieving effective control.

[0004] RNA pesticides are considered a new generation of pesticide development and are scientifically defined as biological pesticides. Compared with traditional chemical pesticides, they use double-stranded RNA as the main active ingredient and exhibit several outstanding advantages: First, dsRNA has specific targets, enabling efficient silencing of essential genes in specific pests and diseases without involving permanent integration of exogenous genes, thus avoiding safety controversies related to genetically modified organisms (GMOs); second, based on the flexibility of sequence design, dsRNA can act on a variety of targets, including pathogenic microorganisms such as viruses, bacteria, and fungi, thereby expanding its control spectrum; in addition, studies have shown that dsRNA can enter organisms through different pathways, achieving transcellular delivery, and rapidly degrades after action, leaving no persistent residue in the environment, making it more friendly to non-target organisms and ecosystems.

[0005] Based on this, RNA pesticides exhibit significant technical characteristics in the control of agricultural pests: strong targeting, good control efficacy, low likelihood of inducing resistance, and high environmental compatibility. They also possess potential advantages such as relatively short R&D cycles and flexible design, thus being considered one of the important cutting-edge technologies for promoting sustainable agricultural development and green plant protection. However, RNA pesticides still face multiple challenges in practical applications: naked dsRNA is easily degraded by nucleases and ultraviolet radiation in the environment, resulting in a short field retention period; the epidermis of pests presents a barrier to dsRNA absorption, leading to low delivery efficiency and affecting the silencing effect of target genes; furthermore, the large-scale production cost of dsRNA remains high. Therefore, how to develop anthracnose RNA pesticides with strong targeting, excellent control efficacy, and controllable costs is a key issue that urgently needs to be addressed in this field. Summary of the Invention

[0006] The purpose of this invention is to provide candidate effector protein genes targeting anthrax bacteria. CsCCE3 The application of dsRNA can effectively and specifically control crop anthracnose.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] This invention provides a gene targeting candidate effector proteins of anthrax. CsCCE3 The application of dsRNA in the control of crop anthracnose, the nucleotide sequence of which is shown in SEQ ID No. 2, and the dsRNA is produced by anthracnose fungus. CsCCE3 Anthrax bacteria were obtained by transcribing the gene target gene segment. CsCCE3 The nucleotide sequence of the gene target gene segment is shown in SEQ ID No. 1.

[0009] Preferably, the crops include: rubber trees and mangoes.

[0010] Preferably, the pathogen causing anthrax includes: *Anthrax sicca*. Colletotrichum siamense Asian anthrax bacteria Colletotrichum asianum .

[0011] This invention also provides products for the prevention and control of crop anthracnose, including the above-mentioned gene targeting the candidate effector protein gene of anthracnose bacteria. CsCCE3 dsRNA.

[0012] Preferably, the product further includes layered double hydroxides (LDH) of nanomaterials.

[0013] More preferably, the nanomaterial layered double hydroxide is a magnesium / aluminum layered double hydroxide.

[0014] The present invention also provides a method for controlling crop anthracnose, comprising applying the above-mentioned product to crops.

[0015] More preferably, the product is sprayed onto rubber tree leaves, mango leaves, or mango fruit.

[0016] The beneficial effects of this invention are as follows:

[0017] This invention first obtains dsRNA targeting the candidate effector protein gene CsCCE3 of anthracnose using in vitro dsRNA synthesis technology. Then, it is compounded with layered double hydroxide (LDH) nanomaterials to obtain a dsRNA nanocomposite for crop control. The dsRNA nanocomposite is sprayed onto rubber tree leaves, mango leaves, and mango fruits, and then *Anthracnose sirenus* is inoculated onto these surfaces. Colletotrichum siamense HN08, Asian anthrax bacteria Colletotrichum asianum 02-3, Measure the lesion area to identify candidate effector protein genes targeting anthrax bacteria. CsCCE3 The combination of dsRNA and nano-LDH can effectively and specifically control crop anthracnose. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 for CsCCE3 The diagram shows the protein domain structure and the electrophoresis diagram of the transcription product provided by the present invention. Figure a shows the schematic diagram of the position of dsCsCCE3 on the CsCCE3 protein; Figure b shows the electrophoresis diagram of the transcription product, with lane M being the DNA DL2000 marker and lane 1 being the electrophoresis result of dsCsCCE3.

[0020] Figure 2 The diagrams provided by this invention illustrate the control effect of anthracnose on rubber tree leaves. Figure a shows the phenotype of anthracnose lesions on rubber tree leaves treated with dsRNA; Figure b shows the area of ​​anthracnose lesions on rubber tree leaves treated with dsRNA.

[0021] Figure 3 The diagrams show the control effect of mango leaf anthracnose provided by the present invention. Figure a shows the phenotype of mango leaf anthracnose lesions after spraying with dsRNA; Figure b shows the area of ​​mango leaf anthracnose lesions after spraying with dsRNA.

[0022] Figure 4The diagrams show the control effect of mango anthracnose on mango fruit provided by the present invention. Figure a shows the phenotype of anthracnose lesions on mango fruit after spraying with dsRNA; Figure b shows the area of ​​anthracnose lesions on mango fruit after spraying with dsRNA. Detailed Implementation

[0023] In this invention, unless otherwise specified, the materials, reagents and equipment used are all conventional selections.

[0024] This invention provides anthrax bacteria CsCCE3 dsCsCCE3, a gene targeting the target gene region, was transcribed to control crop anthracnose. Anthracnose fungus. CsCCE3 The nucleotide sequence of the gene target gene segment is: CACGGCGCTGACCAAGAACGTCACGGCCACTTCTGGAACCGGCGCCGTCAGCGCAGCGGGAACGTTGTCTCCCTTCGGAGGTATCGGAGTCGGCTGTGGCATCAACTGGGCCGAGGGCCAGTCTTTTGGAGGTGGTCTTCAATCCGGCTC GGACTCTTTCGGCCTTGGTGGCGGATTCACCATCACCAAGGACACCATGAACATTGGTCTTGGCATCGGCATCAACCCTATCAAGTTCAACTCCAGCGTGAACTACGAAGCTTCGACTAACGGCACCGTGACCATGACCTTCACCTCCACGACGGCGATCAAG (SEQ ID No. 1); The nucleotide sequence of dsCsCCE3 is: CUUGAUCGCCGUCGUGGAGGUGAAGGUCAUGGUCACGGUGCCGUUAGUCGAAGCUUCGUAGUUCACGCUGGAGUUGAACUUGAUAGGGUUGAUGCCGAUGCCAAGACCAAUGUUCAUGGUGUCCUUGGUGAUGGUGAAUCCGCCACCAAGGCCGAAAGAGUCCGAGCCGGAUUGAAGACCACCTCCAAAAGACUGGCCCUCGGCCCAGUUGAUGCCACAGCCGACUCCGAUACCTCCGAAGGGAGACAACGUUCCCGCUGCGCUGACGGCGCCGGUUCCAGAAGUGGCCGUGACGUUCUUGGUCAGCGCCGUG (SEQ ID No. 2); The dsRNA sequence shown in SEQ ID No. 2 is inversely complementary to the nucleotide sequence shown in SEQ ID No. 1.

[0025] Example 1

[0026] 1. Anthrax Bacteria Candidate Effector Protein Genes CsCCE3 It is an important pathogenic factor of anthrax, and its full-length gene sequence is: ATGGTCAACTCATTCGTCAAGCTCGTCGCCTTCGCTGGCCTCGCATCCGCCGGAATTCTTTCTCCGCGCCAGAATACCACGCCCGCTGTTGACATCACGGCGCTGACCAAGAACGTCACGGCCACTTCTGGAACCGGCGCCGTCAGCGCAGCGGGAACGTTGTCTCCCTTCGGAGGTATCGGAGTCGGCTGTGGCATCAACTGGGCCGAGGGCCAGTCTTTT The gene GGAGGTGGTCTTCAATCCGGCTCGGACTCTTTCGGCCTTGGTGGCGGATTCACCATCACCAAGGACACCATGAACATTGGTCTTGGCATCGGCATCAACCCTATCAAGTTCAACTCCAGCGTGAACTACGAAGCTTCGACTAACGGCACCGTGACCATGACCTTCACCTCCACGACGGCGATCAAGTGTGAAGAGACCACGGTTGATGGCGTCAGGGGTGTCAAGTGTACTTCCTCG (SEQ ID No. 8) may have the potential to serve as a target for the prevention and control of anthrax; according to CsCCE3 A pair of specific primers, dsCsCCE3-F (SEQ ID No. 3) and dsCsCCE3-R (SEQ ID No. 4), were designed. Using DNA extracted from the highly pathogenic wild-type strain *Anthrax asiaticus* 02-3 as a template (obtained from laboratory sampling and identification), a DNA fragment (SEQ ID No. 1) was amplified and used for subsequent dsCsCCE3 synthesis (based on...). CsCCE3 Primers were designed from 96bp to 408bp of the gene to synthesize a gene targeting a candidate effector protein of anthrax. CsCCE3 The dsRNA is selected because it covers the core coding region at the 5' end of the gene, has a length that matches the optimal silencing range of dsRNA, and has high specificity. It also meets the primer design parameters, which can ensure silencing efficiency, reduce off-target risk, and is suitable for subsequent experimental operations. The specific primer sequences are shown in Table 1.

[0027] Table 1 Primer Information

[0028]

[0029] 2. Polymerase chain reaction (PCR) amplification was performed using 2× Rapid Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-03). The PCR product was purified and recovered using an agarose gel DNA recovery kit (HiPure Gel Pure DNA Mini Kit, Guangzhou Meiji Biotechnology Co., Ltd., catalog number: D2111-03) to finally obtain the target DNA fragment (SEQ ID No. 1). The 50 μL reaction system is shown in Table 2.

[0030] Table 2 50μL reaction system

[0031]

[0032] Note: After mixing, gently pipette to mix thoroughly, and briefly centrifuge the reagents to the bottom of the tube.

[0033] (1) The PCR reaction procedure is as follows:

[0034] (a) Pre-denaturation at 95°C for 5 min.

[0035] (b) Denaturation at 95°C for 30 seconds.

[0036] (c) Anneal at 58°C for 30 seconds.

[0037] (d) 72°C for 10 seconds.

[0038] (e) Repeat steps (b) to (d) 35 times.

[0039] (f) Extend at 72°C for another 10 min.

[0040] (g) Cycle at 4°C.

[0041] (2) Briefly centrifuge the PCR products. Measure the volume with a pipette and transfer it to a sterile 1.5 mL centrifuge tube.

[0042] (3) Add an equal volume of GDP buffer solution and mix by inverting or vortexing.

[0043] (4) Attach the HiPure DNA column to the collection tube. Transfer the mixture to the DNA column. Centrifuge at 12,000×g for 30 seconds.

[0044] (5) Discard the filtrate and put the column back into the collection tube. Add 600 μL of DW2 buffer to the column. Centrifuge at 12,000 × g for 30 seconds.

[0045] (6) Discard the filtrate and put the column back into the collection tube. Add 300 μL of Buffer DW2 to the column. Centrifuge at 12,000 × g for 2 minutes.

[0046] (7) Place the column into a 1.5 mL centrifuge tube and add 30 μL of elution buffer to the center of the column membrane. Incubate for 2 minutes. Centrifuge at 12,000 × g for 1 minute. Discard the column and store the DNA at -20°C.

[0047] 3. dsRNA was synthesized in vitro using the T7 RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: TR102-02). T7 RNA polymerase recognizes DNA templates with a T7 promoter and uses four NTPs as substrates to synthesize dsCsCCE3 in vitro. The specific method is as follows:

[0048] a. Prepare a 20 μL reaction system as shown in Table 3.

[0049] Table 3 20μL reaction system

[0050]

[0051] b. The PCR product dsCsCCE3 (SEQ ID No. 2) was obtained by reacting at 37°C for 6 hours in a PCR instrument.

[0052] c. Dilute 100 U / μL RNase T1 to 10 U / μL with RNase T1 dilution buffer, and incubate the transcription product to digest excess template DNA and single-stranded RNA. The incubation system is shown in Table 4.

[0053] Note: RNase T1 specifically degrades single-stranded RNA and the three G bases at the 5′ end. Diluted RNase T1 should be used as soon as possible and should not be stored.

[0054] Table 4 Incubation System

[0055]

[0056] Note: After mixing, gently pipette to mix thoroughly, and briefly centrifuge the reagent to the bottom of the tube.

[0057] d. Incubate at 37 ℃ for 30 min to obtain pure dsCsCCE3 (SEQ ID No.2).

[0058] e. Electrophoretic detection of the transcription product (i.e., dsCsCCE3 as shown in SEQ ID No. 2), the results are as follows: Figure 1 As shown in Figure b.

[0059] f. Product purification

[0060] RNA was purified using the magnetic bead method.

[0061] (1) Remove the RNA purification beads from 4°C and allow them to equilibrate at room temperature for 30 min. Invert or vortex to mix before use.

[0062] (2) Add 80 μL of magnetic bead solution to the transcription product and pipette to mix the solution thoroughly more than 10 times.

[0063] (3) Incubate at room temperature for 8 min to allow the RNA to fully bind with the magnetic beads.

[0064] (4) Place the PCR tube on the magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant. When aspirating the supernatant, be careful not to disturb the magnetic beads.

[0065] (5) Keep the PCR tube on the magnetic rack at all times, add 200 μL of freshly prepared 80% ethanol, being careful not to disturb the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat this step once.

[0066] (6) Open the lid and air dry the magnetic beads for 5-10 minutes. Dry until there is no water on the surface of the magnetic beads. Over-drying will affect the elution of RNA.

[0067] (7) Remove the PCR tube from the magnetic rack, add 40 μL of RNase-free water, use a pipette to blow the magnetic beads off the tube wall, mix thoroughly, and incubate at room temperature for 3 min.

[0068] (8) Place the PCR tube on a magnetic rack. After the solution has clarified, carefully transfer the supernatant to a new RNase-free EP tube, being careful not to pick up the magnetic beads. To avoid the magnetic beads affecting subsequent experiments, reserve 1-2 μL of solution when transferring the product to prevent picking up the magnetic beads.

[0069] (9) Detect the A260 absorbance of the product to determine its concentration, and store the purified product (i.e. dsCsCCE3) at -20℃.

[0070] 3. Preparation of anthrax inoculum: The Siamese anthrax bacteria in the preservation tube... Colletotrichum siamense HN08, Asian anthrax bacteria Colletotrichum asianum02-3 (all strains were isolated and identified by laboratory sampling) were activated on PDA solid medium. Fresh mycelia were scraped from the edges of the activated strains and cultured in PD liquid medium at 28°C for 4 days. The fresh spore suspension was then filtered and diluted to 1×10⁻⁶. 6 per mL.

[0071] 4. Layered double hydroxide (LDH) nanomaterials loaded with dseGFP (dsRNA targeting enhanced Green Fluorescent Protein, a double-stranded RNA molecule encoding enhanced green fluorescent protein GFP). dseGFP was synthesized in the laboratory, and its nucleotide sequence is: GCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCG (SEQ ID No. 7). Based on the gene SEQ ID No. 7, a pair of specific primers dseGFP-F (SEQ ID No. 5) and dseGFP-R (SEQ ID No. 6) were designed. The primer sequences are shown in Table 1. The specific synthesis method is the same as that for dsCsCCE3.

[0072] Magnesium / aluminum layered double hydroxide MgAl-LDH (purchased from Nanjing Xianfeng Nanomaterials Technology Co., Ltd., product number: XFL02) was dissolved in DEPC water to obtain LDH working solution (200 μg / mL); dseGFP was diluted with LDH working solution to prepare LDH-dseGFP mixture (final concentration of dseGFP in the mixture was 200 ng / μL); the diluted LDH-dseGFP mixture was placed in a 55℃ water bath and allowed to stand for 1 min, then quickly transferred to a high-speed vortex shaker and shaken for 2 min, and allowed to stand for 2 min. At this time, dseGFP was adsorbed on the LDH surface to form stable LDH-dseGFP nanoparticles.

[0073] 5. Layered double hydroxide (LDH) nanomaterials loaded with dsCsCCE3.

[0074] Magnesium / aluminum layered double hydroxide MgAl-LDH was dissolved in DEPC water to obtain LDH working solution (200 μg / mL). dsRNA was diluted with LDH working solution to prepare LDH-dsRNA mixture (final concentration of dsRNA in the mixture was 200 ng / μL). The diluted LDH-dsRNA mixture was placed in a 55 ℃ water bath and allowed to stand for 1 min, then quickly transferred to a high-speed vortex mixer and vortexed for 2 min, followed by standing for 2 min. At this point, dsRNA was adsorbed onto the LDH surface, forming stable LDH-dsCsCCE3 nanoparticles.

[0075] 6. Application of LDH-dsCsCCE3 in the prevention and control of anthracnose in rubber trees.

[0076] The preventive effect of LDH-dsCsCCE3 nano-formulation on anthracnose of rubber trees was analyzed, and two treatment groups were designed.

[0077] The first group was sprayed with LDH-dseGFP as a control;

[0078] The second group was treated with LDH-dsCsCCE3.

[0079] Rubber leaves with uniform growth and size were selected, and two treatment groups (LDH-dsCsCCE3 group and control LDH-dseGFP group) were set up for the experiment, with 5 leaves in each group.

[0080] Two groups of rubber tree leaves were sprayed with the corresponding treatment solution (LDH-dsCsCCE3 or LDH-dseGFP) evenly sprayed on each leaf. After treatment and standing for 24 hours, six evenly distributed inoculation points were selected on each leaf, and 5 μL of a 1×10⁻⁶ solution was added to each inoculation point. 6 The inoculation procedure was completed using a suspension of *Anthrax sicca* HN08 spores per mL. Results are shown below. Figure 2 .

[0081] Combination Figure 2 The results showed significant differences between the control LDH-dseGFP and LDH-dsCsCCE3, such as Figure 2 As shown in Figure a, the lesion area in the LDH-dsCsCCE3 treatment (right) was significantly smaller than that in the control treatment (left). Figure 2 As shown in Figure b, the average lesion area in the control group was 0.2467 cm². 2 The average lesion area in the treatment group was 0.0647 cm². 2Therefore, the dsCsCCE3 treatment resulted in a 73.77% reduction in lesion area compared to the control. This indicates that applying LDH-dsCsCCE3 can effectively reduce anthracnose infection of rubber tree leaves and provides good protection.

[0082] 7. Application of LDH-dsCsCCE3 in the prevention and control of mango anthracnose.

[0083] The preventive effect of LDH-dsCsCCE3 nano-formulation on mango anthracnose was analyzed, and two treatment groups were designed.

[0084] The first group was sprayed with LDH-dseGFP as a control;

[0085] The second group was treated with LDH-dsCsCCE3.

[0086] Mango leaves of uniform growth and size were selected, and two treatment groups (LDH-dsCsCCE3 group and control LDH-dseGFP group) were set up for the experiment, with 5 leaves in each group.

[0087] Two groups of leaves were sprayed separately: 150 μL of the corresponding treatment solution (LDH-dsCsCCE3 or LDH-dseGFP) was evenly sprayed onto each leaf. After treatment and standing for 24 h, 6 evenly distributed inoculation points were selected on each leaf, and 5 μL of a 1×10⁻⁶ solution was added to each inoculation point. 6 The inoculation procedure was completed using a suspension of Bacillus anthracis 02-3 spores per mL. Results are shown below. Figure 3 .

[0088] The results showed significant differences between the control LDH-dseGFP and LDH-dsCsCCE3, such as Figure 3 As shown in Figure a, the lesion area in the LDH-dsCsCCE3 treatment (right) was significantly smaller than that in the control treatment (left). Figure 3 As shown in Figure b, the average lesion area in the control group was 0.5930 cm². 2 The average lesion area in the treatment group was 0.3187 cm². 2 Therefore, the dsCsCCE3 treatment resulted in a 46.26% reduction in lesion area compared to the control. This indicates that applying LDH-dsCsCCE3 can effectively reduce anthracnose infection of mango leaves and has a good protective effect.

[0089] 8. Application of LDH-dsCsCCE3 in the prevention and control of mango anthracnose.

[0090] The preventive effect of LDH-dsCsCCE3 nano-formulation on mango anthracnose was analyzed, and two treatment groups were designed.

[0091] The first group was sprayed with LDH-dseGFP as a control;

[0092] The second group was treated with LDH-dsCsCCE3.

[0093] Mango fruits of uniform growth and size were selected, and two treatment groups (LDH-dsCsCCE3 group and control LDH-dseGFP group) were set up, with 5 fruits in each group.

[0094] Two groups of fruits were sprayed separately: each fruit was evenly sprayed with 150 μL of the corresponding treatment solution (LDH-dsCsCCE3 or LDH-dseGFP). After treatment and standing for 24 h, six evenly distributed inoculation points were selected on each fruit, and 5 μL of a 1×10⁻⁶ solution was added to each inoculation point. 6 The inoculation procedure was completed using a suspension of Bacillus anthracis 02-3 spores per mL. Results are shown below. Figure 4 .

[0095] The results showed significant differences between the control LDH-dseGFP and LDH-dsCsCCE3, such as Figure 4 As shown in Figure a, the lesion area in the LDH-dsCsCCE3 treatment (right) was significantly smaller than that in the control treatment (left). Figure 4 As shown in Figure b, the average lesion area in the control group was 0.1672 cm². 2 The average lesion area in the treatment group was 0.0666 cm². 2 Therefore, the dsCsCCE3 treatment resulted in a 60.17% reduction in lesion area compared to the control. This indicates that applying LDH-dsCsCCE3 can effectively reduce anthracnose infection of mango fruits and has a good protective effect.

[0096] Obviously, the above embodiments of the present invention are merely examples to illustrate the present invention more clearly, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all implementation methods here. Any obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. The application of dsRNA targeting the anthracnose candidate effector protein gene CsCCE3 in the control of crop anthracnose, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID No.

2. The dsRNA is transcribed from the target gene region of the anthrax CsCCE3 gene. The nucleotide sequence of the target gene region of the anthrax CsCCE3 gene is shown in SEQ ID No.

1. The pathogens of anthrax are Colletotrichum siamense and Colletotrichum asianum. The crops are rubber trees and mangoes.

2. A product for the prevention and control of crop anthracnose, characterized in that, Includes the dsRNA of the anthrax candidate effector protein gene CsCCE3 as described in claim 1.

3. The product according to claim 2, characterized in that, The product also includes layered double hydroxides made of nanomaterials.

4. The product according to claim 3, characterized in that, The nanomaterial layered double hydroxide is a magnesium / aluminum layered double hydroxide.

5. A method for controlling crop anthracnose, characterized in that, This includes spraying the product according to any one of claims 2 to 4 onto rubber tree leaves, mango leaves, or mango fruits, wherein the anthracnose pathogen is: *Colletotrichum siamense* or *Colletotrichum asianum*.

Images