Disease resistance genes, disease resistance proteins, molecular markers and their use for tomato brown rugose fruit virus disease

Abstract

This invention discloses a resistance gene, resistance protein, molecular marker, and their applications against tomato brown fruit wrinkling virus disease, belonging to the field of genetic engineering technology. Using map-based cloning, this invention identifies for the first time a novel resistance gene against tomato brown fruit wrinkling virus disease in tomato chromosome 2. TBR3 By overexpressing in plants TBR3 Genes that significantly enhance plant resistance to tomato brown fruit wrinkling virus disease. Targeting disease resistance genes. TBR3 This invention also designed molecular markers related to resistance to tomato brown wrinkled fruit virus disease, which can accurately distinguish tomato plants carrying disease-resistant genotypes and disease-susceptible genotypes. Therefore, it can be widely used for early disease-resistant breeding screening, solving the problems of difficult early judgment and low breeding efficiency in the breeding process.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a disease resistance gene, disease resistance protein, molecular marker, and application of tomato brown wrinkled fruit virus disease. Background Technology

[0002] tomato( Solanum lycopersicum L. (Tomato) is an annual herbaceous plant belonging to the Solanaceae family and the Tomato genus. It is a widely cultivated dual-purpose economic crop used for both vegetables and fruits, with extremely high nutritional and economic value. It is loved by consumers and occupies an important position in global agricultural production.

[0003] Tomato brownrugose fruit virus (ToBRFV) is a newly emerging disease caused by infection with this virus. The disease causes mosaic or wrinkled leaf phenotypes in tomatoes and develops brown, shrunken spots on the fruit, rendering it completely unmarketable. More seriously, ToBRFV can infect all currently commercially available tomato varieties, and no resistance has been found in cultivated tomatoes. Its outbreak is leading to a global reshuffling of tomato varieties.

[0004] Discovering disease-resistant germplasm resources, cloning disease-resistant genes, and using them for disease-resistant breeding are the most economical, effective, and environmentally friendly strategies for controlling viral diseases. Compared with other members of the Tobacco Mosaic Virus genus, the ToBRFV genome exhibits 9-15% variation. These variations enable it to overcome all known tobacco mosaic virus resistance genes, including Tm-1, Tm-2, and the durable resistance gene Tm-2. 2 Currently, researchers have constructed F2 populations by crossing the disease-resistant material VC554 and the tolerant material VC532 with the susceptible material MM. Through high-throughput sequencing and bioinformatics analysis, they discovered a recessive single-gene-controlled resistance gene on chromosome 11. Furthermore, they found that high resistance to ToBRFV in tomatoes is mediated by the Tm-1 gene on chromosome 2 and a recessive QTL on chromosome 11 (Zinger et al. 2021, 2025). However, the ToBRFV resistance gene in tomatoes has not yet been located. In addition, tightly linked molecular markers can accelerate the disease resistance breeding process and improve the accuracy of selection, making them a necessary condition for marker-assisted selection breeding. Therefore, developing molecular markers tightly linked to the ToBRFV resistance gene in tomatoes has significant practical value for improving the efficiency of tomato disease resistance breeding, expanding the application scope of resistance genes, and ensuring healthy tomato production. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a disease resistance gene, disease resistance protein, molecular marker and its application for tomato brown wrinkled fruit virus disease.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a resistance gene for tomato brown wrinkled fruit virus disease, said resistance gene being a nucleic acid molecule as shown in (i), (ii), or (iii) below:

[0008] (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.1;

[0009] (ii) Nucleic acid molecules other than (i) that encode the amino acid sequence shown in SEQ ID NO.2;

[0010] (iii) A nucleic acid molecule that has 90% or more identity with the nucleic acid molecule defined in (i) or (ii) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.2.

[0011] In the above applications, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA or mRNA.

[0012] The term "identity" used here refers to sequence similarity to native nucleic acid sequences. Identity can be evaluated using computer software, such as the BLAST algorithm (Altschul). et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).

[0013] In the aforementioned nucleic acid molecules, the 90% or more identity can be at least 90%, 92%, 93%, 95%, 96%, 98%, or 99% identity.

[0014] This invention identifies a novel resistance gene for tomato brown fruit wrinkling virus disease in chromosome 2 of tomato using map-based cloning, and names it... TBR3 Gene. The disease resistance gene of this invention can significantly improve the resistance of plants to tomato brown wrinkled fruit virus disease, and has genetic stability, effectively maintaining disease resistance even after multiple generations of backcrossing.

[0015] In a second aspect, the present invention provides a disease-resistant protein against tomato brown wrinkled fruit virus disease, said disease-resistant protein being any of the proteins shown in (A1)-(A3) below:

[0016] (A1) A protein with the amino acid sequence shown in SEQ ID NO.2;

[0017] (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1);

[0018] (A3) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.2.

[0019] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0020] Proteins are the ultimate executors of gene function, and their biological activity directly corresponds to the phenotypic effect of genes. In plant disease resistance responses, resistance genes typically encode proteins with specific structural domains. These proteins, by recognizing pathogen effector molecules and activating downstream defense signaling pathways, ultimately confer a disease-resistant phenotype on the plant. Disease resistance genes TBR3 The disease-resistant protein encoded by the gene is the TBR3 protein.

[0021] A third aspect of the present invention provides the application of the above-mentioned disease-resistant gene in the following (1) or (2):

[0022] (1) Improve the plant's resistance to tomato brown wrinkled fruit virus disease;

[0023] (2) Cultivate plant varieties resistant to tomato brown wrinkled fruit virus disease.

[0024] In the above applications, the resistance of plants to tomato brown fruit wrinkle virus (TBV) is improved or plant varieties resistant to TBV are cultivated by overexpressing disease-resistant genes in plants.

[0025] In some preferred embodiments of the present invention, overexpression of disease resistance genes in plants is achieved using the following substances:

[0026] C1) Expression cassettes containing disease-resistant genes;

[0027] C2) A recombinant vector containing a disease resistance gene, or a recombinant vector containing the expression cassette described in C1);

[0028] C3) Recombinant microorganisms containing disease resistance genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2);

[0029] C4) Transgenic plant cell lines containing disease resistance genes, or transgenic plant cell lines containing the expression cassette described in C1);

[0030] C5) Transgenic plant tissue containing disease resistance genes, or transgenic plant tissue containing the expression cassette described in C1);

[0031] C6) Transgenic plant organs containing disease-resistant genes, or transgenic plant organs containing the expression cassette described in C1).

[0032] In the above applications, the plant is preferably a plant of the Solanaceae family, including but not limited to: tomato, pepper, eggplant, potato, tobacco, etc.

[0033] A fourth aspect of the present invention provides the use of the above-mentioned disease-resistant protein in the following (1) or (2):

[0034] (1) Improve the plant's resistance to tomato brown wrinkled fruit virus disease;

[0035] (2) Prepare drugs for the prevention and control of brown wrinkled fruit virus disease in tomatoes.

[0036] In the above applications, the resistance of plants to tomato brown wrinkled fruit virus disease is improved by overexpressing disease-resistant proteins in plants or by applying disease-resistant proteins exogenously.

[0037] In the above applications, the drug for preventing and controlling tomato brown wrinkled fruit virus disease can use the above-mentioned anti-disease protein as the sole active ingredient; or the anti-disease protein can be used in combination with other substances that resist tomato brown wrinkled fruit virus disease.

[0038] In a fifth aspect, the present invention provides a molecular marker associated with resistance to tomato brown wrinkled fruit virus disease, said molecular marker being InDel- TBR3- 1. InDel- TBR3- 2 and TBR3 -At least one of InDel;

[0039] The InDel- TBR3- 1 is composed of the nucleotide fragment shown in SEQ ID NO.3 and the nucleotide fragment shown in SEQ ID NO.4; the InDel- TBR3- 2 is composed of the nucleotide fragment shown in SEQ ID NO. 5 and the nucleotide fragment shown in SEQ ID NO. 6; TBR3 -InDel consists of the nucleotide fragment shown in SEQ ID NO.7 and the nucleotide fragment shown in SEQ ID NO.8.

[0040] Among the molecular markers mentioned above, InDel- TBR3- 1 and InDel- TBR3- 2 belongs to the category of disease resistance genesTBR3 Closely linked InDel molecular markers; where:

[0041] InDel- TBR3- The nucleotide fragment shown in SEQ ID NO.3 of SEQ ID NO.1 was co-separated from the disease resistance gene, with a fragment size of 116 bp; the nucleotide sequence fragment shown in SEQ ID NO.4 was co-separated from the disease susceptibility gene, with a fragment size of 141 bp.

[0042] InDel- TBR3- The nucleotide fragment shown in SEQ ID NO.5 of 2 was co-separated from the disease resistance gene, with a fragment size of 200 bp; the nucleotide sequence fragment shown in SEQ ID NO.6 was co-separated from the disease susceptibility gene, with a fragment size of 245 bp.

[0043] TBR3 -InDel is based on the resistance material TBR3 Genes and Disease-Sensitive Materials TBR3 Functional molecular markers developed based on differences in homologous gene sequences; among them, the nucleotide fragment shown in SEQ ID NO.7 comes from resistant material, representing resistance to brown fruit wrinkling virus disease; the nucleotide fragment shown in SEQ ID NO.8 comes from susceptible material, representing lack of resistance to brown fruit wrinkling virus disease.

[0044] In a sixth aspect, the present invention provides the use of the above-mentioned molecular marker as a target in at least one of the following (1)-(3):

[0045] (1) Identification of disease resistance genes TBR3 ;

[0046] (2) Identification of plant materials resistant to tomato brown wrinkled fruit virus disease;

[0047] (3) Cultivate plant varieties resistant to tomato brown wrinkled fruit virus disease.

[0048] In the above applications, primer pairs for detecting the aforementioned molecular markers are used to identify disease resistance genes. TBR3 Or plant materials resistant to tomato brown wrinkled fruit virus disease.

[0049] In some preferred embodiments of the present invention, the primer pair for detecting the molecular marker is selected from at least one group of primer pair A, primer pair B, and primer pair C;

[0050] The nucleotide sequences of primer pair A are shown in SEQ ID NO. 9 and SEQ ID NO. 10, and are used to detect InDel- TBR3- 1; The nucleotide sequences of primer pair B are shown in SEQ ID NO.11 and SEQ ID NO.12, and are used to detect InDel- TBR3-2; The nucleotide sequences of primer pair C are shown in SEQ ID NO.13 and SEQ ID NO.14, and are used for detection. TBR3 -InDel.

[0051] The beneficial effects of this invention are:

[0052] (1) This invention, through map-based cloning, has for the first time identified a novel resistance gene for tomato brown wrinkled fruit virus in tomato chromosome 2. TBR3 By overexpressing in plants TBR3 Genes that significantly enhance the plant's resistance to tomato brown wrinkled fruit virus disease.

[0053] (2) Targeting disease-resistant genes TBR3 This invention also designs molecular markers related to resistance to tomato brown wrinkled fruit virus disease, which can accurately distinguish tomato plants carrying disease-resistant genotypes and disease-susceptible genotypes. Therefore, it can be widely used for early disease-resistant breeding screening, solving the problems of difficult early judgment and low breeding efficiency in the breeding process. Attached Figure Description

[0054] Figure 1 For overexpression TBR3 In the genetically modified tomato lines TBR3 Gene expression level detection results; in the figure, WT represents the background material TB0249, and TBR3-OE represents overexpression. TBR3 Transgenic tomato strains with genetically modified genes.

[0055] Figure 2 For overexpression TBR3 Phenotypic images of tomato transgenic lines and fruits inoculated with ToBRFV after WT gene expression; in the figures, WT represents the background material TB0249, and TBR3-OE represents overexpression. TBR3 Transgenic tomato strains with genetically modified genes.

[0056] Figure 3 For overexpression TBR3 Results of ToBRFV viral load detection in tomato transgenic lines and fruits inoculated with WT after ToBRFV inoculation; in the figure, WT represents background material TB0249, and TBR3-OE represents overexpression. TBR3 Transgenic tomato strains with genetically modified genes.

[0057] Figure 4 To utilize the molecular marker InDel- of the present invention TBR3- 1. Partial detection results in the BC5F1 population; in the figure, R represents disease-resistant plants and S represents disease-susceptible plants.

[0058] Figure 5 To utilize the molecular marker InDel- of the present invention TBR3-2. Partial detection results in the BC5F1 population; in the figure, R represents disease-resistant plants and S represents disease-susceptible plants.

[0059] Figure 6 To utilize the molecular markers of the present invention TBR3 -Partial detection results of InDel in the BC5F1 population; in the figure, R represents disease-resistant plants and S represents disease-susceptible plants.

[0060] Figure 7 Leaf phenotypes of plants identified as susceptible and resistant by molecular markers after inoculation with ToBRFV; in the figure, A represents plants identified as susceptible by molecular markers; B represents plants identified as resistant by molecular markers.

[0061] Figure 8 The results of virus load detection in leaves of plants identified as susceptible and resistant by molecular markers after inoculation with ToBRFV are shown in the figure. In the figure, A represents plants identified as susceptible by molecular markers, and B represents plants identified as resistant by molecular markers. Detailed Implementation

[0062] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0063] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0064] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein:

[0065] BR1003, a tomato introgression line resistant to ToBRFV, is used as a cultivar of cultivated tomatoes. Solanum lycopersicum Using ) as the genetic background, wild tomatoes () were backcrossed to introduce ) Solanum pennellii The gene fragment was introduced to obtain the material. The material SLL0400, which is susceptible to ToBRFV, is an existing cultivated tomato ( Solanum lycopersicumThe material TB0249, which is susceptible to ToBRFV, is described in the literature "A biotechnology-based male-sterility system for hybrid seed production in tomato" (Du M. et al., The Plant Journal, 2020). The public can obtain the aforementioned biological materials from the applicant. These biological materials can only be used for verifying the patented technology and cannot be used for other purposes.

[0066] Example 1: Map-based cloning of resistance genes for tomato brown wrinkled fruit virus disease

[0067] Using BR1003, a ToBRFV resistant material in our laboratory, we then crossed BR1003 as the resistant parent with SLL0400 as the susceptible parent to obtain F1. The F1 generation was then self-crossed to obtain the F2 segregating population, which was used for map-based cloning of the ToBRFV resistance gene carried by BR1003.

[0068] We constructed disease-resistant and disease-susceptible pools using the aforementioned F2 generation segregating population, with 50 plants in each pool. Linkage identification was performed using primers covering the entire genome, initially mapping the disease resistance gene TBR3 to the 32-39 Mb region on chromosome 2. Using encrypted molecular markers, recombinant single plants were screened from an F2 population of 8900 plants, ultimately finely mapping the disease resistance gene to the 34.0-34.8 Mb region.

[0069] Molecular marker development and synthesis: The target region Indel was identified by comparing the genomes of *Tomato pennerare* and cultivated tomato. Forward amplification primer F and reverse amplification primer R were designed for this Indel using the online primer design software primer3 (https: / / primer3.ut.ee / ). The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0070] Through sequence analysis of the two materials within finely located intervals, we ultimately... TBR3 As our candidate disease-resistant gene. TBR3 The CDS region sequence of the gene is shown in SEQ ID NO.1; the amino acid sequence of the encoded TBR3 protein is shown in SEQ ID NO.2.

[0071] Example 2: Disease Resistance Gene TBR3 Functional verification

[0072] 1. Overexpression TBR3 Construction of transgenic tomato lines

[0073] (1) Construction of the recombinant expression vector pK7FWG2-TBR3:

[0074] Will TBR3 The CDS sequence (SEQ ID NO.1) of the gene was ligated into the pK7FWG2 vector after double digestion with Xho I and EcoRI to construct the recombinant expression vector pK7FWG2-TBR3.

[0075] (3) Preparation of recombinant positive Agrobacterium bacterial suspension:

[0076] The successfully constructed recombinant expression vector pK7FWG2-TBR3 was transformed into Agrobacterium LBA4404 to obtain recombinant positive Agrobacterium.

[0077] Recombinant positive Agrobacterium was inoculated onto YEB solid medium (containing 50 μg / ml Rif and 50 μg / ml Kan) and cultured at 28°C for 2 days. Single colonies were picked and cultured in 5 ml of YEB liquid medium (containing 50 μg / ml Rif and 50 μg / ml Kan) in the dark at 28°C and 200 rpm for 1.5 days. 500 μl of bacterial culture was added to 50 ml of YEB liquid medium (containing 50 μg / ml Rif and 50 μg / ml Kan) and cultured until OD500 was reached. 600 =1.8~2.0; centrifuge at 4000 rpm for 10 min, resuspend in YEB; centrifuge again for 8 min, resuspend in MS salt medium (100 ml MS salt medium contains 0.433 g MS Salts Powder and 3 g sucrose) to the bacterial concentration OD. 600 = 1.5;

[0078] (3) Obtaining transgenic plants:

[0079] Plump seeds of the TB0249 strain, a susceptible material in the laboratory, were selected and sterilized in a clean bench: soaked in 75% alcohol for 2 min and rinsed 3 times with sterile water; soaked in saturated sodium phosphate for 20 min and rinsed 3 times with sterile water; soaked in 1% sodium hypochlorite for 10 min and rinsed 7 times with sterile water; and soaked in sterile water for 4–6 h. The seeds were then sown on 1 / 2 MS medium and germinated in a light incubator (cotyledons fully expanded in 6–8 days).

[0080] Cotyledons were cut off, soaked in MS liquid medium (containing 0.2 mg / L 2,4-D and 0.1 mg / L KT) for 1 h, blotted dry with sterile filter paper, and pre-cultured in A1 solid medium (MS + 1 mg / L IAA + 1.75 mg / L ZT) for 1 day;

[0081] The pre-cultured cotyledons were immersed in recombinant positive Agrobacterium tumefaciens bacterial suspension for 15 min, blotted dry with sterile filter paper, and returned to A1 solid medium for co-culture for 2 days (conditions: 26℃, 16 h light / 8 h dark, 600 μmol / L). -2 s -1 (Light); transfer to A2 resistant medium (MS + 1.0 mg / L IAA + 1.75 mg / L ZT + 75 mg / L Kan + 200 mg / L Tim), and culture under the same conditions. Change the medium every 3 weeks until callus formation, then transfer to A3 medium (MS + 1.0 mg / L IAA + 1.75 mg / L ZT + 50 mg / L Kan + 200 mg / L Tim) to induce shoot growth. Cut off the growing point and transfer to A4 medium (MS + 50 mg / L Kan + 200 mg / L Tim) for rooting;

[0082] Screening for T0 generation positive seedlings: After DNA testing positive, seedlings were transplanted into soil and harvested as usual. T1 generation seedlings were planted; individual seeds were disinfected and sown on 1 / 2 MS medium containing kanamycin. If all T1 generation seeds were resistant, they were homozygous and used for subsequent experiments.

[0083] After resistance screening and molecular identification, the T2 generation overexpression was finally obtained. TBR3 The expression level of the gene in the tomato transgenic line (TBR3-OE) was detected by quantitative real-time PCR. The results showed that the TBR3-OE transgenic line was significantly different from the control TB0249. TBR3 Gene expression levels were significantly increased. Figure 1 ).

[0084] 2. Overexpression TBR3 Resistance of transgenic tomato lines to ToBRFV was investigated.

[0085] ToBRFV (MT018320.1) was inoculated into control TB0249 and TBR3-OE transgenic tomatoes. Infectious Agrobacterium was injected into a true leaf, with 0.1 ml injected into each plant. After three months, the fruit was investigated for disease and the ToBRFV viral load was measured.

[0086] The results showed that TB0249 tomato fruits exhibited significant disease, with brown wrinkled spots on the fruit surface; while the fruits of TBR3-OE transgenic plants were healthy and disease-free. Figure 2 In TBR3-OE, ToBRFV load was almost undetectable; while in TB0249, ToBRFV load was relatively high. Figure 3 ).

[0087] Therefore, TBR3The gene played a significant role in the ToBRFV infection process of tomatoes, effectively enhancing the disease resistance of tomatoes. Overexpression TBR3 Genes can significantly improve the disease resistance of tomatoes.

[0088] Example 3: Development of molecular markers and detection primers associated with resistance to tomato brown wrinkled fruit virus disease

[0089] 1. With disease-resistant genes TBR3 Development of tightly linked InDel molecular markers:

[0090] Disease resistance gene based on map-based cloning in Example 1 TBR3 Two more disease-resistant genes were developed. TBR3 The tightly linked InDel molecular markers are named InDel- TBR3- 1. InDel- TBR3- 2.

[0091] InDel- TBR3- 1 is composed of the nucleotide sequence fragment shown in SEQ ID NO.3 and the nucleotide sequence fragment shown in SEQ ID NO.4; wherein the nucleotide sequence fragment shown in SEQ ID NO.3 is co-separated with the disease resistance gene, and the fragment size is 116 bp; the nucleotide sequence fragment shown in SEQ ID NO.4 is co-separated with the disease susceptibility gene, and the separated fragment size is 141 bp.

[0092] InDel- TBR3- 2 consists of the nucleotide sequence fragment shown in SEQ ID NO.5 and the nucleotide sequence fragment shown in SEQ ID NO.6; wherein the nucleotide sequence fragment shown in SEQ ID NO.5 is co-separated with the disease resistance gene, and the fragment size is 200 bp; the nucleotide sequence fragment shown in SEQ ID NO.6 is co-separated with the disease susceptibility gene, and the fragment size is 245 bp.

[0093] 2. Development of functional molecular markers related to resistance to tomato brown wrinkled fruit virus disease

[0094] According to the resistant materials TBR3 Genes and Disease-Sensitive Materials TBR3 Differences in homologous gene sequences led to the development of a... TBR3 Gene-specific functional molecular markers, named TBR3 -InDel.

[0095] TBR3-InDel consists of the nucleotide fragment shown in SEQ ID NO.7 and the nucleotide fragment shown in SEQ ID NO.8; wherein, the nucleotide fragment shown in SEQ ID NO.7 comes from resistant material, representing resistance to brown fruit wrinkling virus disease; the nucleotide fragment shown in SEQ ID NO.8 comes from susceptible material, representing lack of resistance to brown fruit wrinkling virus disease.

[0096] 3. Primer design for detecting molecular markers:

[0097] Based on the above InDel- TBR3- 1 and InDel- TBR3- 2. Further primer pairs for detecting the above molecular markers were designed, and the specific sequences are as follows:

[0098] InDel- TBR3- 1-F:5'-ACAATATAAAGACCTTGGCATGA-3'; (SEQ ID NO.9)

[0099] InDel- TBR3- 1-R:5'-TCTCCGAATTCCAGAAGATTC-3'. (SEQ ID NO.10)

[0100] InDel- TBR3- 2-F:5'-GGAAACAACCTCTCTACCCT-3'; (SEQ ID NO.11)

[0101] InDel- TBR3- 2-R:5'- ATGCCACTGTGTCAACCTAT -3'. (SEQ ID NO.12)

[0102] Based on functional molecular markers TBR3 -InDel, further primer pairs for detecting this molecular marker were designed, and their specific sequences are as follows:

[0103] TBR3 -InDel-F: 5'- TGCCAAAGCTCATGCACTTC -3'; (SEQ ID NO.13)

[0104] TBR3 -InDel-R: 5'- GGCTTCTATGGCAAGCTAAGG -3'. (SEQ ID NO.14)

[0105] Using the above molecular markers TBR3InDel analyzes the DNA of the tomato sample. If the PCR product shows a specific band of 82 bp with the nucleotide sequence fragment SEQ ID NO.7, it indicates that the sample contains the TBR3 gene of the resistant material genotype and is resistant to brown fruit wrinkling virus disease. If the PCR product only amplifies a single specific band of 108 bp with the nucleotide sequence fragment SEQ ID NO.8, it indicates that the sample contains the gene of the susceptible material genotype and does not possess resistance.

[0106] Example 4: Functional validation of molecular markers associated with resistance to tomato brown fruit wrinkling virus disease

[0107] Using TB0249 as the recurrent parent, the disease-resistant gene carried by BR1003 was transferred. TBR3 In the backcross and breeding of TB0249, each generation passed the disease resistance gene described in Example 3. TBR3 Screening for tightly linked InDel molecular markers carrying TBR3 The offspring plants of the gene. Through five generations of backcrossing, we obtained BC5, and after self-pollination, we obtained the BC5F1 population.

[0108] Using the BC5F1 population to target the molecular marker InDel- designed in Example 3 ​ 1. InDel- ​ 2 and ​ -InDel performs functional verification.

[0109] DNA was extracted from selected individual plants in the BC5F1 population. The extraction method was detailed in the instructions for the Complete Biotech Universal Plant Genomic DNA Extraction Kit. The InDel- molecular marker described in Example 3 was used for detection. ​ 1. InDel- ​ 2 and ​ PCR amplification was performed using primer pairs for InDel, and the PCR amplification products were then analyzed by gel electrophoresis.

[0110] Molecular marker InDel- ​ The identification results of 1 are as follows ​ As shown, resistance to disease is determined based on electrophoretic bands: if the amplified product corresponds to a 116 bp band, it is determined to be resistant to tomato brown fruit wrinkle virus (R); if it corresponds to a 141 bp band, it is determined to be susceptible to tomato brown fruit wrinkle virus (S); plants with heterozygous bands are also resistant (R).

[0111] Molecular marker InDel- ​ The identification results of 2 are as follows ​As shown, resistance to disease is determined based on electrophoretic bands: if the amplified product corresponds to a 200 bp band, it is determined to be resistant to tomato brown fruit wrinkle virus (R); if it corresponds to a 245 bp band, it is determined to be susceptible to tomato brown fruit wrinkle virus (S); plants with heterozygous bands are also resistant (R).

[0112] Molecular markers ​ -InDel's identification results are as follows ​ As shown, resistance to the disease is determined based on the electrophoretic bands: if the amplified product corresponds to an 82bp band, it is determined to be resistant to tomato brown fruit wrinkle virus (R); if it corresponds to a 108bp band, it is determined to be susceptible to tomato brown fruit wrinkle virus (S); plants with heterozygous bands are also resistant (R).

[0113] The results showed that the molecular marker InDel- ​ 1. InDel- ​ 2 and ​ The results of the identification were consistent with those of InDel.

[0114] Then, plants identified as resistant and susceptible by molecular markers were selected and inoculated with ToBRFV when they had one true leaf, maintaining a consistent infection load. Ten days after infection, the leaf disease incidence of each individual plant was observed, and the viral load was measured.

[0115] Disease incidence on individual plant leaves as follows ​ As shown: Plants identified by molecular markers as susceptible to the disease will exhibit curling and wrinkling symptoms on their leaves after inoculation with the virus. ​ (A); while plants identified as resistant by molecular markers showed normal leaf appearance (A). ​ (B)

[0116] The results of viral load measurement are as follows ​ As shown: In plants identified by molecular markers as susceptible to the disease, a large amount of virus accumulation can be detected. ​ (A); while plants identified as resistant by molecular markers showed very little virus accumulation ( ). ​ (B)

[0117] The above results indicate that the molecular markers of the present invention are accurate and reliable in detecting resistance to tomato brown wrinkled fruit virus.

[0118] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A molecular marker associated with resistance to tomato brown wrinkled fruit virus disease, characterized in that, The molecular marker is InDel- TBR3- 1. InDel- TBR3- 2 and TBR3 -At least one of InDel; The InDel- TBR3- 1 is composed of the nucleotide fragment shown in SEQ ID NO.3 and the nucleotide fragment shown in SEQ ID NO.4; the InDel- TBR3- 2 is composed of the nucleotide fragment shown in SEQ ID NO. 5 and the nucleotide fragment shown in SEQ ID NO. 6; TBR3 -InDel consists of the nucleotide fragment shown in SEQ ID NO.7 and the nucleotide fragment shown in SEQ ID NO.

8.

2. The use of the molecular marker of claim 1 as a target in at least one of the following (1)-(3): (1) Identification of disease resistance genes TBR3 ; (2) Identification of plant materials resistant to tomato brown wrinkled fruit virus disease; (3) Cultivate plant varieties resistant to tomato brown wrinkled fruit virus disease; The disease-resistant gene TBR3 It is the nucleic acid molecule shown in SEQ ID NO.1; The plant in question is a tomato.

3. The application according to claim 2, characterized in that, Identification of disease resistance genes using primer pairs that detect molecular markers TBR3 Or plant materials resistant to tomato brown wrinkled fruit virus disease; The primer pairs for detecting molecular markers are selected from at least one set of primer pair A, primer pair B, and primer pair C; The nucleotide sequences of primer pair A are shown in SEQ ID NO. 9 and SEQ ID NO. 10, and are used to detect InDel- TBR3- 1; The nucleotide sequences of primer pair B are shown in SEQ ID NO.11 and SEQ ID NO.12, and are used to detect InDel- TBR3- 2; The nucleotide sequences of primer pair C are shown in SEQ ID NO.13 and SEQ ID NO.14, and are used for detection. TBR3 -InDel.

Images