Ralstonia solanacearum protobacteriophage with wide host spectrum and application thereof
By developing the prophage φGPN1 with a broad host spectrum, the problems of narrow host range and insufficient resources of existing lytic phages in the prevention and control of bacterial wilt have been solved, enabling effective control of multiple strains of bacterial wilt fungus and providing a wider host spectrum and control methods.
Patent Information
- Application Number
- CN202610435127.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-03
- Publication Date
- 2026-05-01
AI Technical Summary
Existing lytic bacteriophages have a narrow host range when controlling bacterial wilt, the pathogen is prone to developing resistance, bacteriophage resources are scarce, and it is difficult to quickly design effective formulations for complex bacterial wilt fungal communities in the field.
A mild prophage φGPN1 with a broad host spectrum was developed and named Ralstonia phage. It was deposited at the Guangdong Provincial Microbial Culture Collection Center for the preparation of a formulation for the control of soil-borne bacterial wilt disease, containing 1×10⁸ to 1×10¹² PFU/mL of prophage φGPN1.
It achieved widespread infection of multiple strains of Ralstonia solanacearum from different regions across the country, providing a broader host spectrum and offering candidate phage resources for future engineered phage preparation and phage therapy for treating bacterial wilt, thus enhancing the control effect.
Smart Images

Figure CN121950720A_ABST
Abstract
Description
A bacteriophage with a broad host spectrum and its applications Technical Field
[0001] This invention belongs to the field of microbiology and relates to a prophage of Ralstonia solanacearum, specifically to a prophage φGPN1 of Ralstonia solanacearum with a broad host spectrum and its applications. Background Technology
[0002] Soil-borne bacterial wilt caused by *Raylorhizium anisopliae* is a common bacterial disease affecting plants. *Raylorhizium anisopliae* can infect more than 200 plant species, including tobacco, eggplant, and tomato, causing devastating damage and seriously threatening the safe supply of agricultural products.
[0003] Bacteriophages, as a class of viruses that specifically infect bacteria, possess advantages such as specific infection and minimal environmental disturbance, and have become a novel biocontrol method. In the development of phage resources for bacterial wilt, current focus is mainly on lytic phages. These phages can directly lyse the host and rapidly suppress the number of pathogens, but they also have significant limitations, such as a narrow host range, often effective only against one or a few types of *Ralstonia solanacearum*, and the pathogens easily develop resistance. Although phage cocktails can compensate for this deficiency to some extent, they still face the challenge of "customization," meaning it is impossible to quickly design effective specific formulations for the complex *Ralstonia solanacearum* populations in the field. Phage therapy based on lytic phages faces the current shortage of phage resources. Another form of phage—temperate phages—is widely present in host bacteria, integrating into the host genome as prophages and capable of re-entering the lytic cycle under certain conditions to become lytic phages. This characteristic gives them the potential to supplement the phage resource pool. Compared to screening for lytic phages, targeting specific Ralstonia solanacearum can rapidly obtain its prophages, and it has the characteristics of high acquisition efficiency and wide host range. It is expected to become an important supplement to the Ralstonia solanacearum phage resource library and alleviate the current pressure of insufficient phage resources. Summary of the Invention
[0004] The purpose of this invention is to provide a mild prophage φGPN1 with a broad host lysis spectrum. This prophage φGPN1 can infect multiple strains of *Ralstonia solanacearum* isolated from different regions across China, exhibiting a wider host spectrum compared to lytic phages. This *Ralstonia solanacearum* prophage φGPN1 is groundbreaking in the control of bacterial wilt disease, and its broad host spectrum can provide alternative phages for future engineered phage preparation or phage therapy for treating bacterial wilt disease caused by *Ralstonia solanacearum*.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] The prophage φGPN1, classified as Ralstonia phage, was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 13, 2025, with accession number GDMCC NO:67287-B1.
[0007] Another object of the present invention is to provide the application of the aforementioned prophage φGPN1 in the control of soil-borne bacterial wilt.
[0008] Preferably, the application is the use of prophage φGPN1 in the preparation of formulations for the control of soil-borne bacterial wilt.
[0009] Another object of the present invention is to provide a prophage preparation for controlling soil-borne bacterial wilt, the prophage preparation comprising the aforementioned prophage φGPN1.
[0010] In the prophage preparation, the titer of prophage φGPN1 is 1×10⁻⁶. 8 ~1×10 12 PFU / mL.
[0011] Preferably, in the prophage preparation, the titer of prophage φGPN1 is 4 × 10⁻⁶. 11 PFU / mL.
[0012] Another objective of this invention is to provide a method for preparing the prophage preparation for controlling soil-borne bacterial wilt, comprising: using *Ralstonia solanacearum* as the host bacterium, selecting a single colony of *Ralstonia solanacearum* and culturing it in NA liquid medium until the logarithmic growth phase to obtain a *Ralstonia solanacearum* bacterial suspension in the logarithmic growth phase; inoculating the *Ralstonia solanacearum* bacterial suspension in the logarithmic growth phase with a storage solution of prophage φGPN1, shaking and culturing until the medium is clear to obtain a phage suspension of activated prophage φGPN1; adding the *Ralstonia solanacearum* bacterial suspension in the logarithmic growth phase and the phage suspension of activated prophage φGPN1 to the NA liquid medium, shaking and culturing until the medium is clear, centrifuging, filtering the supernatant through a 0.22 μm microporous membrane, concentrating, and diluting with sterile water to obtain the prophage preparation.
[0013] When preparing the activated prophage φGPN1 phage solution, the volume ratio of NA liquid culture medium to prophage φGPN1 storage solution was 200:1; the shaking culture temperature was 30℃ and the shaking speed was 170 rpm.
[0014] The volume ratio of the NA liquid culture medium, the YX1 bacterial suspension in the logarithmic growth phase, and the activated prophage φGPN1 phage suspension is 17:1:2; the shaking culture temperature is 30℃, and the shaking speed is 170 rpm.
[0015] The centrifugation temperature was 4℃ and the rotation speed was 10000 rpm.
[0016] The concentration was achieved using a 100 kd ultrafiltration tube.
[0017] The supernatant is concentrated to 1 / 20 to 1 / 10 of its volume; the volume of the supernatant is the total volume of NA liquid culture medium, YX1 bacterial suspension in logarithmic growth phase, and activated prophage φGPN1 phage fluid.
[0018] Another object of the present invention is to provide the application of the aforementioned prophage preparation in the control of soil-borne bacterial wilt.
[0019] The soil-borne bacterial wilt mentioned refers to bacterial wilt of tobacco, tomato, ginger, peanut, and potato caused by Ralstonia solanacearum.
[0020] The beneficial effects of this invention are as follows: The original bacteriophage φGPN1 of this invention can infect multiple strains of Ralstonia solanacearum isolated from different regions across the country. Compared with lytic bacteriophages, it has a wider host spectrum, providing a candidate bacteriophage for the future preparation of engineered bacteriophages or the use of bacteriophage therapy to treat bacterial wilt caused by Ralstonia solanacearum. Attached Figure Description
[0021] Figure 1 shows the genome map of the prophage host xiangxi4-1 (protein functions were annotated using Prokka software).
[0022] Figure 2 shows all predicted prophage sites (including the site where φGPN1 is located) of the prophage host xiangxi4-1.
[0023] Figure 3 shows a photograph of the plaque morphology of prophage φGPN1 on a plate.
[0024] Figure 4 shows the electron microscopy morphology of prophage φGPN1.
[0025] Figure 5 shows the genetic development tree of prophage φGPN1.
[0026] Figure 6 shows the genomic linear map of prophage φGPN1.
[0027] Figure 7 shows the infection spectrum of prophage φGPN1 against 88 strains of Ralstonia solanacearum; the area of the circle reflects the infection intensity, and the larger the area, the stronger the infection intensity.
[0028] Figure 8 shows the infection effect of prophage φGPN1 on four strains of Ralstonia solanacearum.
[0029] Biological Preservation Information:
[0030] The prophage φGPN1, classified as Ralstonia phage, was deposited on November 13, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, located at: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong, China, with accession number GDMCC NO:67287-B1. Detailed Implementation
[0031] The culture medium formula is as follows:
[0032] NA liquid culture medium: 10 g glucose, 5 g peptone, 3 g beef extract, 0.5 g yeast powder, 1000 mL deionized water, adjust pH to 7.2-7.4, autoclave at 115℃ for 30 min.
[0033] NA semi-solid medium: Add 10 g of agar powder to 1 L of NA liquid medium.
[0034] NA solid medium: Add 25 g of agar powder to 1 L of NA liquid medium.
[0035] M-SMSA solid medium: Add 50 mg TTC (triphenyltetrazolium chloride), 5 mg crystal violet, 50 mg polymyxin, 25 mg bacitracin, 5 mg chloramphenicol, 50 mg actinomycin, and 5 mg penicillin to 1000 mL NA solid medium.
[0036] Example 1
[0037] The inventors obtained a prophage φGPN1 from a strain of Ralstonia pseudosolanacearum (xiangxi4-1) isolated from the rhizosphere soil of tobacco infected with bacterial wilt in Xiangxi Tujia and Miao Autonomous Prefecture, Hunan Province. The invention was predicted by software to include an integrated lysogenic phage in the genome of the strain. The strain was then induced with mitomycin C.
[0038] I. Isolation and Identification of Ralstonia solanacearum (xiangxi4-1)
[0039] Take 1g of rhizosphere soil sample from tobacco infected with bacterial wilt and place it in a sterilized 50mL Erlenmeyer flask containing 9mL of deionized water (soil-to-water ratio 1:9). Incubate the flask in a shaker at 30℃ and 170rpm for 60min. Perform a 10-fold serial dilution of the soil suspension. Specifically: add 100μL of the soil suspension to a centrifuge tube containing 900μL of sterile water and vortex; add 100μL of the well-mixed suspension to a centrifuge tube containing 900μL of sterile water, and repeat this serial dilution process. Use a dilution gradient of 10... -2 10-3 10 -4 100 μL of soil solution was prepared for each of the following assays and spread onto M-SMSA selective medium for Ralstonia solanacearum. Three replicates were performed for each assay. The culture was incubated at 30 °C for 48 h. Single colonies were picked and streaked onto SMSA medium and incubated at 30 °C for 48 h. This process was repeated two to three times to obtain purified single colonies, designated as xiangxi4-1. Single colonies were then inoculated into NA liquid medium and incubated at 30 °C and 170 rpm for 24 h to obtain Ralstonia solanacearum in the logarithmic growth phase (OD500). 600 = 1.2). Take 600 μL of Ralstonia solanacearum in the logarithmic growth phase and put it into a 2 mL centrifuge tube. Mix it with 600 μL of 30% glycerol and store it in a -80 ℃ refrigerator.
[0040] The above single colonies were picked and cultured in NA liquid medium. After PCR of the bacterial culture (primer sequences Endo-F: ATGCATGCCGCTGGTCGCCGC, Endo-R: GCGTTGCCCGGCACGAACACC, Poussier S et al., 2000), they were sent to the company for sequencing. The egl sequence was compared with the NCBI database. The reference sequence with the highest score belonged to R. pseudosolanacearum, which is Ralstonia solanacearum xiangxi4-1.
[0041] II. Extraction of xiangxi4-1 genomic DNA
[0042] Ralstonia solanacearum xiangxi4-1, stored at -80℃, was inoculated into well plates containing 2 mL of NA liquid medium and cultured at 30℃ and 170 rpm for 36 h on a shaker. The culture was then streaked onto M-SMSA solid medium plates and incubated at 30℃ for 36 h. Single colonies were picked and cultured in NA liquid medium at 30℃ and 170 rpm for 24 h (reaching the logarithmic growth phase). The cells were then collected by centrifugation at 12000 rpm for 1 min, the supernatant was removed, and total DNA was extracted using a kit (Tiangen Bacterial Genome Extraction Kit). The xiangxi4-1 genome was sequenced, and the genome was plotted and functionally annotated using the online annotation website Proksee (Figure 1). Prophages on the xiangxi4-1 genome were predicted using the Phabox online annotation website and Vibrant software, and the predicted prophages, including the φGPN1 site, were labeled (Figure 2).
[0043] III. Isolation of prophage φGPN1
[0044] First, pick a single colony of xiangxi4-1 from M-SMSA solid medium and place it into a centrifuge tube (50 mL) containing 20 mL of NA liquid medium. Incubate at 30°C and 170 rpm with shaking until the logarithmic growth phase (OD50). 600 =0.5), to obtain xiangxi4-1 bacterial suspension; then, mitomycin C was added to the centrifuge tube to make the final concentration of mitomycin C in the culture system 1 μg / mL, and cultured at 30℃ and 170 rpm for 8 h with shaking; centrifuged at 4℃ and 10000 rpm for 10 min, the supernatant was filtered through a 0.22 μm microporous membrane to obtain 20 mL of crude prophage suspension, which was concentrated to 1-2 mL using a 100 kd ultrafiltration tube to obtain concentrated prophage suspension, which was diluted with sterile water to obtain serial dilutions (10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 ) of prophage solution.
[0045] Bacteriophages were isolated using the double-layer plate method: Previously preserved *Ralstonia solanacearum* YX1 was used as the host for the bacteriophages. YX1, stored at -80℃, was inoculated into wells of a plate containing 2 mL of NA liquid medium and incubated at 30℃ and 170 rpm for 36 h on a shaker. The culture was then streaked onto M-SMSA solid medium plates and incubated at 30℃ for 36 h. Single colonies were picked and incubated in NA liquid medium at 30℃ and 170 rpm for 24 h (at this point, the logarithmic growth phase had been reached). 250 μL of the logarithmic growth phase YX1 culture was mixed with 25 mL of NA semi-solid medium at a suitable temperature and immediately poured onto a solidified NA solid medium plate. After solidification, a double-layer plate of *Ralstonia solanacearum* was obtained. The plate was divided into sections, and 10 µL serially diluted (10⁻⁶) cells were inoculated onto each section. 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 The phage stock solution was cultured at 30°C for 24 h, and observations were performed for 10 hours. 8 The diluted area was recorded with a phage titer of 4 × 10⁻⁶. 11PFU / mL (Figure 3). Once plaques appeared, a single plaque of the highest dilution was picked and inoculated into the YX1 bacterial culture in the logarithmic growth phase. The culture was incubated at 30 °C with shaking at 170 rpm for 24 h to allow the phage to proliferate. The resulting co-culture was centrifuged at 10,000 rpm for 3 min, and the supernatant was collected and filtered through a 0.22 µm filter membrane. The filtrate was repeated 2–3 times using the double-layer plate method to obtain relatively pure prophage (denoted as φGPN1). The plaques formed on the plates were dissolved in SM buffer to obtain a large amount of pure prophage φGPN1 storage solution, which was stored at 4 °C for later use.
[0046] IV. Identification of prophage φGPN1
[0047] (I) Electron microscopic observation of prophage φGPN1
[0048] 1. Select the prophage φGPN1.
[0049] 2. Prepare a double-layer plate of Ralstonia solanacearum according to "III. Isolation of prophage φGPN1". Drop 150 μL of prophage solution (4×10⁻⁶) onto the plate. 11 (PFU / mL), and incubate in a 30 ℃ constant temperature incubator for 12-24 h until phage plaques appear, which are the prophage φGPN1.
[0050] 3. Add a small amount of sterile ddH2O (500-1000 μL) to the area where phage plaques appear, and let it stand for about 1 hour. During the standing period, gently shake the container several times to allow the phages to float from the agar to the water surface.
[0051] 4. Take an appropriate amount of phage suspension and perform negative staining with 2% phosphotungstic acid solution. After staining for about 90 seconds, remove it from the staining solution and air dry at room temperature.
[0052] 5. Use a transmission electron microscope to observe the morphology of bacteriophages.
[0053] As shown in Figure 4, the head of prophage φGPN1 has an icosahedral structure and possesses tail fibers. Based on the classification criteria of the International Committee on Taxonomy of Viruses, this phage belongs to the order Caudate Phages, family P2 subphages.
[0054] (II) Extraction of total DNA from prophage φGPN1
[0055] Genomic DNA of prophage φGPN was extracted using a kit (λ phage DNA extraction kit, Abigen) following the instructions. The purity and concentration of the genomic DNA were detected using a NanoDrop 2000 micro-volume spectrophotometer (NanoDrop, USA) and then sent to Shanghai Lingen Biotechnology Co., Ltd. for sequencing.
[0056] Sequencing results showed that the genome size of prophage φGPN1 was 39.463 kb with a GC content of 65%. BLAST analysis of the prophage φGPN1 genome sequence with selected standard phages was performed, and a phylogenetic tree was constructed (Figure 5). Prophage φGPN1 showed high homology with Ralstonia phage Y0009_3. The linear genome of prophage φGPN1 was plotted and its gene functions were annotated on the Phabox online annotation website. 26 functional ORFs were identified, including structural proteins and regulatory genes of the phage; the remaining proteins were hypothetical or unknown proteins (Figure 6).
[0057] The prophage φGPN1, classified as Ralstonia phage, was deposited on November 13, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, located at: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong, China, with accession number GDMCC NO:67287-B1.
[0058] Example 2
[0059] Preparation of prophage φGPN1 formulation
[0060] Referring to Example 1, "III. Isolation of Prophage φGPN1", the obtained phage φGPN1 storage solution was amplified to prepare the prophage φGPN1 solution. The specific method is as follows:
[0061] Pick a single colony of YX1 and place it in 2 mL of NA liquid medium. Incubate until the logarithmic growth phase (OD200). 600 =0.5), and a YX1 bacterial culture in the logarithmic growth phase was obtained; then, 10 μL of prophage φGPN1 storage solution was added to the YX1 bacterial culture in the logarithmic growth phase, and the culture was placed in a shaker at 30℃ and 170 rpm overnight. The culture medium was observed to be clear, and the activated prophage φGPN1 phage culture was obtained.
[0062] Add 17 mL of NA liquid medium to a 50 mL sterile centrifuge tube, along with 1 mL of YX1 bacterial suspension in logarithmic growth phase and 2 mL of activated prophage φGPN1 phage solution. Incubate overnight at 30°C and 170 rpm with shaking until the medium is clear. Centrifuge at 4°C and 10,000 rpm for 10 min. Filter the supernatant through a 0.22 μm microporous membrane and concentrate to 1-2 mL using a 100 kDa ultrafiltration tube. Dilute with sterile water to obtain a titer of 4 × 10⁻⁶. 11 The PFU / mL prophage φGPN1 formulation should be stored in a refrigerator at 4°C.
[0063] Example 3
[0064] Host range determination of prophage φGPN1
[0065] Table 1. Information on some Ralstonia solanacearum fungi
[0066]
[0067] The lytic activity of prophage φGPN1 against different Ralstonia solanacearum strains was detected using the double-layer plate method. Eighty-eight Ralstonia solanacearum strains isolated from various locations were used as test bacteria. Double-layer plates were prepared according to the method described in Example 1, "III. Isolation of Prophage φGPN1". Gradient solutions of prophage φGPN1 were then spotted onto the plates containing the bacteria and incubated overnight at 30°C. Plaque formation was observed and photographed. The results of the double-layer plate method showed that prophage φGPN1 could lyse multiple Ralstonia solanacearum strains from different hosts (Table 1, Figure 8). This indicates that prophage φGPN1 has a broad lytic spectrum against Ralstonia solanacearum and possesses the function of regulating the abundance of Ralstonia solanacearum.
Claims
1. The prophage φGPN1, classified as Ralstonia phage, was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 13, 2025, with accession number GDMCC NO:67287-B1.
2. The application of the prophage φGPN1 as described in claim 1 in the prevention and control of soil-borne bacterial wilt.
3. The application according to claim 2, characterized in that: The application described is the use of prophage φGPN1 in the preparation of formulations for the control of soil-borne bacterial wilt.
4. The application according to claim 2, characterized in that: The soil-borne bacterial wilt mentioned refers to bacterial wilt of tobacco, tomato, ginger, peanut, and potato caused by Ralstonia solanacearum.
5. A prophage preparation for controlling soil-borne bacterial wilt, characterized in that: The prophage formulation contains the prophage φGPN1 as described in claim 1.
6. The prophage preparation according to claim 5, characterized in that: In the prophage preparation, the titer of prophage φGPN1 is 1×10⁻⁶. 8 ~1×10 12 PFU / mL.
7. The prophage preparation according to claim 6, characterized in that: In the prophage preparation, the titer of prophage φGPN1 is 4 × 10⁻⁶. 11 PFU / mL.
8. A method for preparing a prophage preparation for controlling soil-borne bacterial wilt as described in claim 5, characterized in that: include: Using Ralstonia solanacearum as the host bacterium, single colonies of Ralstonia solanacearum were picked and cultured in NA liquid medium until the logarithmic growth phase to obtain Ralstonia solanacearum in the logarithmic growth phase. The prophage φGPN1 storage solution was inoculated into the Ralstonia solanacearum bacterial culture in the logarithmic growth phase, and the culture was shaken until the culture medium was clear to obtain the phage fluid of activated prophage φGPN1. Add Ralstonia solanacearum in the logarithmic growth phase and activated prophage φGPN1 to NA liquid medium, shake and culture until the medium is clear, centrifuge, filter the supernatant through a 0.22 μm microporous membrane, concentrate, and dilute with sterile water to obtain the prophage preparation.
9. The application of the prophage preparation according to claim 5 in the prevention and control of soil-borne bacterial wilt.
10. The application according to claim 9, characterized in that: The soil-borne bacterial wilt mentioned refers to bacterial wilt of tobacco, tomato, ginger, peanut, and potato caused by Ralstonia solanacearum.
Citation Information
Patent Citations
Lysing bacteriophage and application thereof in prevention and control of tobacco soil-borne bacterial wilt
CN112831475A
Broad-spectrum ralstonia solanacearum bacteriophage PTY21 and application thereof
CN116622649A
Phage cocktail for preventing and controlling soil-borne bacterial wilt and application thereof
CN119776290A
Ralstonia solanacearum bacteriophage LC10 with effect of preventing and controlling tobacco bacterial wilt and application thereof
CN121136943A