Notch1 regulation and control method based on Notch1 super enhancer

Abstract

The invention provides a Notch1 regulation and control method based on a Notch1 super enhancer, relates to the technical field of biomedicine, and has the technical key points that two Notch1 super enhancer sequences are found through research, and the Notch1 super enhancer sequences are named as Notch1-AB and Notch1-CD. According to the application, Notch1-AB and Notch1-CD super enhancers are found and defined as specific key elements for regulating Notch1 high expression in vascular endothelial cells for the first time, and the two regulation paths are cut off through inhibitor inhibition or a gene editing technology, so that efficient and stable down-regulation of Notch1 and target genes thereof is realized, tissue cross reaction caused by direct targeting of Notch1 receptors is avoided, and the Notch1 and target genes thereof can be efficiently and stably regulated. The treatment specificity and safety are obviously improved; the regulation and control mode can adapt to multiple scenes such as conventional treatment and precision medical treatment, vascular diseases and tumors such as atherosclerosis and diabetic retinopathy can be covered, and the application limitation of existing Notch targeted therapy is broken through.

Description

A Notch1 control method based on Notch1 super-enhancer Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for regulating Notch1 based on the Notch1 superenhancer. Background Technology

[0002] The Notch1 gene is a key member of the Notch signaling pathway and belongs to the highly conserved Notch receptor family (including Notch1-4). In vascular endothelial cells (such as HUVECs), the Notch1 gene plays a crucial role in maintaining vascular homeostasis and pathological processes by regulating cell differentiation, proliferation, and angiogenesis. Notch1 activation depends on ligand binding, triggering γ-secretase-mediated release of NICD (Notch1 intracellular domain), which in turn regulates the expression of downstream target genes (such as Hes1 and Hey1), affecting endothelial cell function. In vascular development and the tumor microenvironment, Notch1 maintains vascular stability by inhibiting endothelial cell migration and promoting vascular maturation; however, its abnormal activation or inhibition may lead to vascular malformations or pathological angiogenesis (such as tumor vascularization). Studies have shown that dysregulation of the Notch1 signaling pathway is closely related to vascular diseases such as atherosclerosis and diabetic retinopathy. By detecting Notch1 expression or activity in HUVECs, vascular function status can be assessed or disease risk can be predicted.

[0003] Targeting Notch1 regulation (such as Dll4 / Notch1 inhibitors) has emerged as a potential strategy for anti-angiogenic therapy, particularly in cancer treatment, where interfering with abnormal angiogenesis can enhance the efficacy of chemotherapy or immunotherapy. However, due to the widespread role of Notch1 in various tissues, its specific targeting still requires further optimization to avoid side effects. Summary of the Invention

[0004] The purpose of this invention is to address the lack of specific targeting optimization for Notch1 in the prior art.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The purpose of this invention is to address the lack of specific targeting optimization for Notch1 in the prior art.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A Notch1 superenhancer comprising any of the following fragments:

[0009] The Notch1-AB fragment or the Notch1-CD fragment, wherein the sequence of the Notch1-AB fragment is as shown in SEQ ID NO: 1, and the sequence of the Notch1-CD fragment is as shown in SEQ ID NO: 2;

[0010] Or a homologous fragment that has at least 90% homology with the Notch1-AB fragment or the Notch1-CD fragment and has the same super-enhancer function.

[0011] This application also provides the application of the aforementioned Notch1 super-enhancer in the regulation of Notch1, thereby achieving the regulation of Notch1 by controlling the expression of the Notch1 super-enhancer.

[0012] Preferably, the regulation of the Notch1 superenhancer is achieved by inhibiting its expression or cleaving the Notch1 superenhancer.

[0013] Preferably, the suppression of the Notch1 superenhancer is achieved using a superenhancer inhibitor.

[0014] Preferably, the inhibitor includes at least one of JQ1 or IBET.

[0015] Preferably, the removal of the Notch1 super-enhancer is achieved through gene editing technology.

[0016] This application also provides the application of Notch1 superenhancer in the preparation of drugs for treating Notch-related diseases, which achieves the regulation of Notch1 by regulating the expression of Notch1 superenhancer.

[0017] Preferably, the Notch-related diseases include vascular diseases and tumors.

[0018] Preferably, the vascular diseases include atherosclerosis and diabetic retinopathy.

[0019] Compared with the prior art, this application has the following beneficial effects:

[0020] This invention, for the first time, clearly defines the sequence (SEQ ID NO: 1, 2) and function of the Notch1 super-enhancer, providing a specific target for novel drug development. Subsequently, inhibitors with higher affinity (such as optimized structures of JQ1 and IBET) can be developed based on this super-enhancer sequence, or nucleic acid drugs targeting this region (such as siRNA and CRISPR editing tools) can be designed to overcome the toxicity issues of existing Notch-targeting drugs and advance the development of drugs for anti-angiogenic diseases and tumors.

[0021] Furthermore, the Notch1-AB and Notch1-CD super-enhancers provided in this application are specific key elements for regulating the high expression of Notch1 in vascular endothelial cells. They only act on the upstream regulatory pathway of Notch1, avoiding tissue cross-reaction caused by direct targeting of Notch1 receptor, and significantly improving the specificity and safety of the treatment.

[0022] Secondly, by using validated inhibitors such as JQ1 and IBET to inhibit super-enhancer expression, the expression of Notch1 and its target genes (Hes1, Hey1, etc.) is reduced in a dose-dependent manner, making it suitable for conventional treatment scenarios such as systemic administration. Secondly, by precisely removing super-enhancer fragments using CRISPR / Cas9 gene editing technology, the abnormal activation of Notch1 is fundamentally blocked, making it suitable for precision medicine scenarios such as local lesions (e.g., tumor tissue, vascular lesions) or cell therapy. Both methods have been experimentally proven to significantly downregulate Notch1 mRNA and protein levels, with stable and reliable regulatory efficiency.

[0023] Furthermore, this application comprehensively demonstrated the regulatory role of the super-enhancer on Notch1 through multi-level experiments, including real-time quantitative PCR (gene level), Western blot (protein level), and CRISPR gene editing verification (functional verification after knockout), eliminating non-specific interference and providing a solid experimental foundation for the clinical translation of this technology. Attached Figure Description

[0024] Figure 1 is a schematic diagram of JQ1 and IBET negatively regulating Notch1 and its target genes in one embodiment of the present invention.

[0025] Figure 2 is a schematic diagram of JQ1 and IBET negatively regulating Notch1 protein in one embodiment of the present invention;

[0026] Figure 3 is a schematic diagram of the presence of a super enhancer in the Notch1 gene in one embodiment of the present invention; Figure 3(A) shows the acetylation site of the Notch1 gene, and Figure 3(B) shows the strategy diagram for knocking out the super enhancer Notch1.

[0027] Figure 4 is a schematic diagram of the removal of Notch1 super enhancers (sgNotch1-AB and sgNotch1-CD) in HUVECs according to an embodiment of the present invention;

[0028] Figure 5 is a schematic diagram of Notch1 superenhancer excision inhibiting Notch1 gene and protein expression in one embodiment of the present invention. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to specific embodiments.

[0030] This application provides a method for regulating Notch1 based on the Notch1 superenhancer, which regulates the expression level of the Notch1 receptor in cells by inhibiting or cleaving the Notch1 superenhancer.

[0031] In one embodiment, the super enhancer is two DNA sequences in the Notch1 gene, namely: hg19_dna range=chr9:139420000-139437000, with a sequence length of 17000bp.

[0032] The suppression of the Notch1 superenhancer is achieved by an inhibitor, which includes at least one of JQ1 and IBET.

[0033] The excision of the Notch1 super-enhancer was achieved using CRISPR gene editing technology.

[0034] The above content will be explained in conjunction with specific verification experiments:

[0035] Example 1: Validation of low expression of Notch1 and its target genes by JQ1 and IBET inhibitors

[0036] At the gene level, please refer to Figure 1. In this application, the copy number of Notch1 and its target genes in HUVECs was detected by real-time quantitative PCR technology. It was found that the expression of Notch1 and its target genes decreased in a dose-dependent manner after treatment with JQ1 and IBET inhibitors.

[0037] The steps are as follows:

[0038] 1. HUVECs cells were treated with JQ1 (0.2μm, 0.5μm and 1μm) and IBET (0.5μm, 1μm and 2μm), respectively, with an untreated group as a control;

[0039] 2. 48 h after drug administration, cells were collected and RNA was extracted;

[0040] 3. Real-time quantitative PCR was used to detect Notch1 expression in HUVECs cells, and a significant decrease in copy number was found.

[0041] The real-time quantitative PCR technology in the above steps

[0042] (1-1) Real-time quantitative PCR steps:

[0043] (1-1-1) RNA extraction:

[0044] 1. Collect HBL, SU-DHL-2, SMM159, RaJi, SU-DHL-10, B-16, and U266 cells;

[0045] 2. Add 1 mL of Trizol to each cell to lyse them;

[0046] 3. Add 0.2 mL of chloroform to each phase, and centrifuge at 12000 rpm for 15 minutes at 4°C to separate the two phases;

[0047] 4. Extract the aqueous phase, add an equal volume of isopropanol, and centrifuge at 12,000 rpm for 15 minutes at 4°C to precipitate RNA;

[0048] 5. Add 1 mL of 75% ethanol to wash the precipitated RNA, and centrifuge at 7000 rpm for 5 minutes at 4°C.

[0049] 6. After drying, add DEPC water to dissolve the RNA.

[0050] (1-1-2) Reverse transcription: The Revert Aid First Strand cDNA Synthesis Kit (Thermo) was used, and the system is as follows:

[0051] (1-1) Real-time quantitative PCR steps:

[0052] (1-1-1) RNA extraction:

[0053] 1. Collect HBL, SU-DHL-2, SMM159, RaJi, SU-DHL-10, B-16, and U266 cells;

[0054] 2. Add 1 mL of Trizol to each cell to lyse them;

[0055] 3. Add 0.2 mL of chloroform to each phase, and centrifuge at 12000 rpm for 15 minutes at 4°C to separate the two phases;

[0056] 4. Extract the aqueous phase, add an equal volume of isopropanol, and centrifuge at 12,000 rpm for 15 minutes at 4°C to precipitate RNA;

[0057] 5. Add 1 mL of 75% ethanol to wash the precipitated RNA, and centrifuge at 7000 rpm for 5 minutes at 4°C.

[0058] 6. After drying, add DEPC water to dissolve the RNA.

[0059] (1-1-2) Reverse transcription: The Revert Aid First Strand cDNA Synthesis Kit (Thermo) was used, and the system is as follows:

[0060]

[0061] (1-1-3) Real-time quantitative PCR experiment:

[0062]

[0063] Example 2: Verification of low Notch1 protein expression caused by JQ1 and IBET superenhancer inhibitors

[0064] Example 1 verified the gene level, while this example focuses on the protein level. Please refer to Figure 2. By detecting Notch1 protein expression in HUVECs using Western blot technology, it was found that Notch1 protein expression decreased in a dose-dependent manner after treatment with JQ1 and IBET inhibitors.

[0065] The steps are as follows:

[0066] 1. HUVECs cells were treated with JQ1 (0.2 μm, 0.5 μm and 1 μm) and IBET (0.5 μm, 1 μm and 2 μm), respectively, with an untreated group as a control;

[0067] 2. 48 hours after drug administration, cells were collected and proteins were extracted;

[0068] 3. The expression of Notch1 protein was detected by Western blot immunoblotting.

[0069] The Western blot immunoblotting technique includes the following experimental steps:

[0070] (2-3-1) Collect cells, lyse cells with appropriate RIPA lysis buffer to extract proteins, and determine protein concentration using a BCA kit;

[0071] (2-3-2) Electrophoresis: Prepare a 12% SDS-PAGE gel, keep the sample protein loading amount the same, and perform sample loading electrophoresis;

[0072] (2-3-3) Transfer: Transfer the protein onto the PVDF membrane for 60 min at a current of 300 mA;

[0073] (2-3-4) Blocking: Add 5% skim milk and block on a shaker for 60 min;

[0074] (2-3-5) Primary antibody incubation: Notch1 antibody (Cell Signaling Technology, 4380s), β-actin antibody (Servicebio, ZB15001-HRP) or β-tubuLin antibody (Servicebio, GB15140) were diluted at a ratio of 1:1000 and incubated overnight at 4°C;

[0075] (2-3-6) Secondary antibody incubation: After primary antibody recovery and washing, select secondary antibody according to the source of primary antibody, dilute at a ratio of 1:2000, and incubate at room temperature for 2 h;

[0076] (2-3-7) Development: After washing with secondary antibody, use the ECL kit to develop and detect proteins according to the instructions.

[0077] Example 3: The excision process of the Notch1 super-enhancer and the verification after excision:

[0078] This application also verified the low expression of Notch1 after the excision of the Notch1 superenhancer. Specifically, this involved the following two steps:

[0079] Firstly, database analysis revealed two highly acetylated DNA sequences (chr9:139420000-139437000) in the Notch1 gene sequence. Since super-enhancer regions are usually accompanied by a large number of histone H3K27Ac modifications (acetylation modifications), which is one of the core characteristics of super-enhancers, this application speculates that this sequence may contain super-enhancers and names them Notch1-AB and Notch1-CD.

[0080] Therefore, sgRNAs were designed upstream and downstream of the two DNA sequences respectively:

[0081] sgNotch1-AB (GCAGGGACAGTGCGGGGAAT, GTGCCCACCCCACACCTGGAA),

[0082] sgNotch1-CD (GCCAGGGGCTGGGGCAGTCA, GCAGAGGACTTTGGGAGGGT),

[0083] Using the empty vector group SgControl as a control, three Crispr / Cas9 plasmids were constructed.

[0084] (3-1) Construction of sgRNA-CRISPR plasmid

[0085] (3-1-1)

[0086] 1. Enzyme digestion vector

[0087]

[0088] 2. Agarose gel electrophoresis;

[0089] 3. Rubber cutting and recycling.

[0090] (3-1-2) sgRNA primer annealing

[0091]

[0092] (3-1-3) Connection

[0093]

[0094] (3-2) Construction of stable cell lines

[0095] (3-2-1) Seeding: Seed SMM159 cells in six-well plates one day before transfection, maintaining a cell density of about 30%-50%;

[0096] (3-2-2) Transfection:

[0097] 1. Add 1 μg of sgNotch1-AB and 1 μg of sgNotch1-CD CRISPR / Cas9 plasmids to 50 μL of Opti-mem serum-free transfection medium, respectively. Similarly, add 1 μg of sgControl plasmid to 50 μL of Opti-mem serum-free transfection medium.

[0098] 2. Add 2 μL of Lipo2000 to 50 μL of Opti-mem serum-free transfection medium;

[0099] 3. After standing at room temperature for 5 minutes, mix the diluted plasmid with Lipo2000 and let stand for 20 minutes, then add it evenly dropwise into a six-well plate.

[0100] (3-2-3) Drug screening: 72 h after transfection, add puromycin at a concentration of 1 μg / mL, and continue to add the drug until all normal control cells die. Then stop the drug and replace the culture medium with complete culture medium to continue culturing the cells.

[0101] Verification process after Notch1 super-enhancer excision

[0102] A. Genotyping:

[0103] A1: DNA extraction: Collect cells, digest with trypsin, centrifuge, add 50 μL buffer L and 1 μL Proteaseplus (Bimike.com), incubate at 55℃ for 30 min, then at 95℃ for 5 min;

[0104] A2: PCR Amplification:

[0105]

[0106] At the gene level, please refer to Figure 5A. Through real-time quantitative PCR experiments, RNA was extracted from stable cells of sgControl, sgNotch1-AB and sgNotch1-CD (experimental steps are the same as above), and Notch1 gene expression was detected. It was found that the copy number of Notch1 in the sgNotch1-AB and sgNotch1-CD groups was significantly lower than that in the sgControl group.

[0107] At the protein level, please refer to Figure 5B. Through Western blot experiments, proteins were extracted from stable cells of sgControl, sgNotch1-AB, and sgNotch1-CD (experimental steps are the same as above), and the expression level of Notch1 protein was detected. It was found that the Notch1 protein abundance in the sgNotch1-AB and sgNotch1-CD groups was significantly lower than that in the sgControl group.

[0108] This application identified two Notch1 superenhancer sequences, named Notch1-AB and Notch1-CD. In vascular endothelial cells, inhibition or excision of Notch1-AB and CD using superenhancer inhibitors or gene editing technologies significantly reduced Notch1 expression. Dysregulation of the Notch1 signaling pathway is closely related to vascular diseases such as atherosclerosis and diabetic retinopathy. Therefore, detecting the mutation status of Notch1 superenhancers or Notch1 protein / gene expression (e.g., IHC, WB, or gene sequencing) can accurately predict the prognosis of patients with related diseases. In terms of treatment, γ-secretase inhibitors or monoclonal antibodies targeting Notch1 are under development, but the toxicity challenges arising from its extensive physiological functions need to be overcome.

[0109] To verify the existence of superenhancers in HUVECs cells, this invention first confirmed through JQ1 and IBET that superenhancer inhibitors can suppress the expression of Notch1 and its target genes (as shown in Figure 1). Simultaneously, JQ1 and IBET can suppress Notch1 protein expression (as shown in Figure 2). This indicates that the high expression of Notch1 in vascular endothelial cells may be related to superenhancers.

[0110] The presence of abundant H3K27Ac modifications in DNA-encapsulated histones is an important criterion for superenhancers. Analysis of H3K27Ac modifications in the database revealed the potential existence of two superenhancers (Notch1-AB and Notch1-CD) within the Notch1 gene (as shown in Figure 3). Figure 3(A) shows the acetylation sites of the Notch1 gene, and Figure 3(B) shows a strategy diagram for knocking out the Notch1 superenhancer.

[0111] Using CRISPR-CAS9 technology, the Notch1 super-enhancer was excised in HUVECs cells, and genotyping confirmed successful Notch1 super-enhancer knockout (as shown in Figure 4). After knockout of the Notch1 super-enhancer, Notch1 mRNA and protein expression were significantly downregulated (as shown in Figure 5).

[0112] The results of this application indicate that the Notch1 superenhancer is a key DNA sequence that induces high expression of Notch1 in vascular endothelial cells. This key DNA sequence is closely related to Notch1 expression, and detecting the state and DNA sequence of the Notch1 superenhancer can reflect the expression status of Notch1.

Claims

1. A Notch1 super-enhancer, characterized in that: The Notch1 super-enhancer comprises any of the following fragments: a Notch1-AB fragment or a Notch1-CD fragment, wherein the sequence of the Notch1-AB fragment is as shown in SEQ ID NO: 1, and the sequence of the Notch1-CD fragment is as shown in SEQ ID NO: 2; or a homologous fragment having at least 90% homology with the Notch1-AB fragment or the Notch1-CD fragment and having the same super-enhancer function.

2. The application of the Notch1 super-enhancer as described in claim 1 in the regulation of Notch1, characterized in that: Notch1 can be regulated by controlling the expression of the Notch1 superenhancer.

3. The application of the Notch1 super-enhancer in the regulation of Notch1 according to claim 2, characterized in that: The regulation of the Notch1 superenhancer is achieved by inhibiting its expression or removing the Notch1 superenhancer.

4. The application of the Notch1 super-enhancer in the regulation of Notch1 according to claim 3, characterized in that: Suppressing the Notch1 superenhancer is achieved using a superenhancer inhibitor.

5. The application of the Notch1 super-enhancer in the regulation of Notch1 according to claim 4, characterized in that: The inhibitor includes at least one of JQ1 or IBET.

6. The application of the Notch1 super-enhancer in the regulation of Notch1 according to claim 3, characterized in that: The removal of the Notch1 superenhancer was achieved through gene editing technology.

7. The application of Notch1 super-enhancer in the preparation of drugs for treating Notch-related diseases, characterized in that: Notch1 can be regulated by controlling the expression of Notch1 superenhancer.

8. The application of the Notch1 super-enhancer according to claim 7 in the preparation of drugs for treating Notch-related diseases, characterized in that: The Notch-related diseases include vascular diseases and tumors.

9. The application of the Notch1 super-enhancer according to claim 8 in the preparation of drugs for treating Notch-related diseases, characterized in that: The vascular diseases mentioned include atherosclerosis and diabetic retinopathy.

Images