Application of purple acid phosphatase gene SgPAP27b of stylosanthes guianensis to improvement of acid aluminum stress resistance of plants
By overexpressing the SgPAP27b gene of Stylosanthes in Arabidopsis thaliana, the problem of insufficient tolerance of plants to aluminum stress was solved, and the growth and productivity of plants in acidic soils were improved, providing genetic resources and technical support for crop improvement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI
- Filing Date
- 2026-01-21
- Publication Date
- 2026-05-01
AI Technical Summary
There is a lack of effective genetic methods to enhance plant tolerance to aluminum stress, especially the problem of aluminum toxicity inhibiting crop growth in acidic soils, which affects agricultural productivity.
By overexpressing the purple acid phosphatase gene SgPAP27b in Arabidopsis thaliana, the expression level of the SgPAP27b gene in plants was increased using transgenic technology, thereby enhancing the plant's tolerance to aluminum acid stress.
It significantly improved the plant's tolerance to acid and aluminum stress, enhanced plant growth and productivity in acidic soils, and provided a scientific basis and technical support for crop improvement.
Smart Images

Figure CN121950870A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and more particularly to a purple acid phosphatase gene from *Styrax spp.* SgPAP27b Application in improving the plant's tolerance to aluminum stress. Background Technology
[0002] Acidic soils (pH < 5.5) are a major constraint on global agricultural development, primarily distributed in tropical and subtropical regions, accounting for over 50% of the world's potential arable land. These soils suffer from various nutrient stresses, with aluminum (Al) toxicity being particularly prominent, severely limiting crop growth and productivity. Aluminum is the third most abundant element in the Earth's crust and is extremely abundant in soils. Under acidic soil conditions, aluminum dissolves into its trivalent form (Al2+). 3+ This substance, known as aluminum acid stress, possesses extremely high phytotoxicity. 3+ It can rapidly inhibit root elongation by disrupting cellular processes such as cell division and elongation, ultimately impairing the plant's water and nutrient absorption functions and leading to a significant decrease in crop yield. The root tip transition zone is considered the main site for sensing aluminum acid and producing toxic effects; this region is affected by Al... 3+ Aluminum exposure triggers a series of signal responses. Therefore, elucidating the molecular mechanisms of aluminum tolerance is crucial for breeding crop varieties adapted to acidic soils. Against the backdrop of increasingly severe soil acidification, this research direction is of key significance for ensuring sustainable agricultural productivity.
[0003] The plasma membrane is Al 3+ The primary site of initial interaction with root cells. Due to Al 3+ Al has a high affinity for the phosphate groups on membrane phospholipids. 3+ It can rapidly damage the integrity and function of the plasma membrane. As an important mechanism for coping with aluminum stress, plants can reduce Al by reorganizing membrane lipid composition. 3+The binding sites of these genes mitigate toxicity, an adaptive strategy found in species such as maize, sorghum, rice, and wheat. At the biochemical level, typical phospholipases (such as nonspecific phospholipase C, phosphatidylinositol phospholipase C, phospholipase A, and phospholipase D) hydrolyze phospholipids during lipid remodeling. Furthermore, members of the purple acid phosphatase (PAP) family have also been reported to hydrolyze phospholipids; for example, soybean's GmPAP33 hydrolyzes phosphatidylcholine (PC) and phosphatidic acid (PA), releasing inorganic phosphate (Pi). Functional studies of plant PAP genes have primarily focused on their enhanced activation and utilization of organic phosphorus under low phosphorus stress. For instance, Arabidopsis thaliana's AtPAP12 / 26 is involved in the activation and utilization of exogenous glycerol 3-phosphate, adenosine diphosphate, and DNA. Additionally, soybean's GmPAP15a and alfalfa's MsPHY1 are involved in the activation and utilization of exogenous phytate phosphorus. However, there are currently no research reports on the involvement of the plant PAP gene in tolerance to aluminum acid stress.
[0004] Stylosanthes ( Stylosanthes guianensis Originating in the acidic soils of South America, *Stylosanthes stylosanthes* has developed extremely strong tolerance to aluminum stress through long-term evolution. Identifying the key functional genes responsible for aluminum tolerance in *Stylosanthes stylosanthes* can be used to improve the tolerance of other plants to aluminum stress, which has significant theoretical and practical implications for breeding new crop varieties adapted to acidic soil cultivation. Summary of the Invention
[0005] This invention provides a PAP family gene identified in *Stylosanthes* that is upregulated by aluminum acid stress treatment, named... SgPAP27b Through heterologous overexpression in Arabidopsis SgPAP27b This significantly improved the tolerance of transgenic Arabidopsis to aluminum stress, indicating that the gene can be used to enhance the plant's tolerance to aluminum stress. Based on this, the present invention provides a purple acid phosphatase gene from *Styrax chinensis*. SgPAP27b Its application in improving the plant's tolerance to aluminum stress provides key gene resources and technical support for breeding new aluminum-tolerant crop varieties using genetic engineering.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows: A purple acid phosphatase gene from Stylosanthes styracifolium SgPAP27b Application in improving the plant's tolerance to aluminum stress, the SgPAP27b The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0007] Furthermore, the aforementioned SgPAP27b The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 2.
[0008] Furthermore, a method to improve the plant's tolerance to aluminum stress is to increase the concentration of certain nutrients in the plant. SgPAP27b Gene expression levels.
[0009] Furthermore, the improvement in the plant SgPAP27b The method for measuring gene expression is: constructing overexpression structures using transgenic technology. SgPAP27b A recombinant plant expression vector for the gene was generated, and then the recombinant plant expression vector was transferred into plants via Agrobacterium-mediated transformation, enabling the plants to acquire the gene. SgPAP27b The gene and the protein encoded by the gene possess the function of resistance to aluminum stress.
[0010] Furthermore, the plant in question is Arabidopsis thaliana.
[0011] The beneficial effects of this invention are: This invention discloses a *Stylosanthes* species that can improve the plant's tolerance to aluminum stress. SgPAP27b Genes, through overexpression SgPAP27b Transgenic plants can significantly improve their tolerance to aluminum stress. SgPAP27b Genes play an important role in improving the ability of plants to withstand aluminum stress and can be used as important genes for the transgenic improvement of crops. They provide scientific basis and technical support for the subsequent creation of new aluminum-resistant crop germplasm and have important practical significance for breeding new crop varieties adapted to acidic soil cultivation and ensuring the agricultural production benefits in acidic soil areas. Attached Figure Description
[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0013] Figure 1 for SgPAP27b Gene conserved domain prediction and phylogenetic analysis diagram, in which... Figure 1 A is SgPAP27b Results of gene conserved domain prediction analysis Figure 1 B represents the phylogenetic analysis results of PAP family genes in Stylosanthes, Arabidopsis, and soybean; Figure 2 Stylosanthes in aluminum acid treatment SgPAP27b Image showing the results of gene expression pattern analysis; Figure 3 For heterologous expression SgPAP27b Electrophoresis image of transgenic Arabidopsis thaliana identified by PCR; Figure 4 for SgPAP27b A bar chart of acid phosphatase activity in transgenic Arabidopsis thaliana; Figure 5 for SgPAP27b The figure shows the results of the analysis of the acid and aluminum stress tolerance of transgenic Arabidopsis thaliana. Figure 5 A represents heterologous expression. SgPAP27b Phenotypic diagram of transgenic Arabidopsis thaliana on culture medium under aluminum stress; Figure 5 B is a statistical graph of the taproot length of each line of transgenic Arabidopsis thaliana treated with aluminum acid stress; Figure 5 C is a statistical chart of the fresh weight of each line of transgenic Arabidopsis thaliana treated with aluminum acid stress; WT: wild-type Arabidopsis thaliana; OE1, OE2: heterologous expression. SgPAP27b Two independent transgenic Arabidopsis lines; asterisks in the figure indicate significant differences between WT and OE1 and OE2 (Student's t -test,** P <0.01); Figure 6 For heterologous expression SgPAP27b Differences in phosphorus metabolites between transgenic Arabidopsis and wild-type Arabidopsis, volcanic diagram, among which, Figure 6 A is a volcano diagram of phosphorus-containing metabolites between WT and OE1; Figure 6 B is a volcano diagram showing the difference in phosphorus-containing metabolites between WT and OE2; WT represents wild-type Arabidopsis thaliana; OE1 and OE2 represent heterologous expression. SgPAP27b Two independent transgenic Arabidopsis thaliana lines; Figure 7 For heterologous expression SgPAP27b A bar chart showing the phospholipid metabolism levels in transgenic Arabidopsis and wild-type Arabidopsis. Figure 7 A represents the relative total phospholipid level; Figure 7 B represents the relative levels of different phosphatidylinositol levels; WT: wild-type Arabidopsis thaliana; OE1 and OE2 represent heterologous expression. SgPAP27b Two independent transgenic Arabidopsis lines; asterisks in the figure indicate significant differences between WT and OE1 and OE2 (Student's t -test,* P <0.05,** P <0.01); Figure 8 For heterologous expression SgPAP27b A bar chart showing the glucose and lipid metabolism levels in transgenic Arabidopsis and wild-type Arabidopsis. Figure 8 A represents the relative level of digalactosidylcholinesterol (MGDG); Figure 8 B represents the relative digalactoylglycerol (DGMG) level; Figure 8 C represents the relative level of monogalactosylglycerol (MGMG); WT: wild-type Arabidopsis thaliana; OE1, OE2: heterologous expression. SgPAP27b Two independent transgenic Arabidopsis lines; asterisks in the figure indicate significant differences between WT and OE1 and OE2 (Student's t -test,* P <0.05,** P <0.01). Detailed Implementation
[0014] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0015] The *Stylosanthes stylosum* material used in the following embodiments ( Stylosanthes guianensis ) and Arabidopsis thaliana ( Arabidopsis thaliana All materials were obtained from the Grassland Research Center of the Institute of Tropical Crop Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences.
[0016] Example: Example 1: Stylosanthes pubescens SgPAP27b Gene cloning and identification 1. Total RNA extraction from Stylosanthes kirilowii Whole seedlings of Stylosanthes were taken and ground into powder using liquid nitrogen as samples. Total RNA was then extracted from the Stylosanthes using a plant total RNA extraction kit (DP432, TIANGEN). The integrity of the RNA was checked by 1% agarose gel electrophoresis, following the instructions in the product manual. cDNA was then synthesized using the HiScript III RT SuperMix for qPCR reverse transcription kit (R323-01, Vazyme), following the instructions in the product manual.
[0017] 2. Amplification of Stylosanthes kirilowii SgPAP27b gene fragments design SgPAP27b Gene amplification primers ( SgPAP27b -OE-F: TACTCGAGGGGGATCcATGAAAGGAGGGAGTAGTGTTG (SEQ ID NO: 3); SgPAP27b -OE-R: ATTCGCTAGTGGATCcTCAAAGATCTTCTTCAGAAATCAACTTTTGTTCGGTTGCTAAAGTTTTTGTCTCACA (SEQ ID NO: 4). Using cDNA as a template, PCR was used to amplify the vector carrying the pCXSN adapter. SgPAP27b Full-length CDS sequence of the gene; The PCR reaction system consisted of: 20 μL of a high-fidelity single enzyme (Phanta Flash Super-Fidelity DNA Polymerase, P521-d1, Vazyme), 1 μL each of forward and reverse primers, 2 μL of cDNA template, and 16 μL of ddH2O. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 56℃ annealing for 30 seconds, and 72℃ extension for 30 seconds, for a total of 35 cycles; followed by a complete extension at 72℃ for 5 minutes; and storage at 4℃. PCR products were purified using a FastPure Gel DNA Extraction Mini Kit (DC301-01, Vazyme), and then sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing using the aforementioned amplification primers. SgPAP27b Gene, SgPAP27b The full-length CDS sequence of the gene is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2.
[0018] 3. Stylosanthes SgPAP27b Homologous identification and phylogenetic analysis of genes Using NCBI's CD-search tool SgPAP27b Conserved domains were predicted using the full-length CDS sequence of the gene. The results are as follows: Figure 1 A shows, SgPAP27b It contains two typical PAP family characteristic structural domains: the fn3-PAP structural domain at the N end and the MPP-PAP structural domain at the C end.
[0019] Phylogenetic analysis of the PAP family genes in *Stylosanthes*, soybean, and *Arabidopsis thaliana*. Results are as follows: Figure 1 B shows, SgPAP27b The PAP gene is highly evolutionarily conserved, similar to that in Arabidopsis thaliana. AtPAP27 and soybeans GmPAP27b The homology was highest, and they clustered together in a single branch (IIb). These results indicate that... SgPAP27b It is a typical plant PAP family gene.
[0020] Example 2: Stylosanthes pubescens SgPAP27b Gene expression pattern analysis in response to aluminum acid treatment Stylosanthes seeds were germinated on moist filter paper in the dark, and then transferred to a modified Magnavaca nutrient solution (1 mM KCl, 1 mM CaCl2, 0.077 mM Fe-EDTA(Na), 0.2 mM MgSO4, 0.5 mM Mg(NO3)2·6H2O, 1.5 mM NH4NO3, 11.8 × 10⁻⁶ ppm). -3 mM MnCl2·4H2O, 3.06×10 -3 mM ZnSO4·7H2O, 0.8×10 -3 mMCuSO4·5H2O, 33×10 -3 mM H3BO3, 1.07×10 -3 Pre-cultured in a nutrient solution of mM Na₂MoO₄·2H₂O, 0.155 mM MgCl₂·6H₂O, and 0.3 mM KH₂PO₄, with a pH of 5.8; seedlings pre-cultured for 7 days were then transferred to a modified Magnavaca nutrient solution containing 540 μM AlCl₃ (aluminum acid treatment) and a modified Magnavaca nutrient solution without AlCl₃ (control treatment), respectively. The pH of the nutrient solution for both the aluminum acid treatment and the control treatment was 4.0, and the KH₂PO₄ concentration was 45 × 10⁻⁶. -3 mM, samples of leaves and roots were collected after 7 days of treatment; Roots and leaves of *Stylos stylosus* treated with aluminum sulfate and the control were ground into powder using liquid nitrogen as samples. Total RNA was extracted from *Stylos stylosus* using a plant total RNA extraction kit (DP432, TIANGEN), and its integrity was assessed by 1% agarose gel electrophoresis, following the product instructions. cDNA synthesis was then performed using the HiScript III RT SuperMix for qPCR reverse transcription kit (R323-01, Vazyme), following the product instructions. The synthesized cDNA was used as a template to analyze the *Stylos stylosus* housekeeping gene. SgUBCE1 As an internal reference, design SgUBCE1 Quantitative PCR primers (SgUBCE1-RT-F: CAGATCAAGCTGCTGACGAA (SEQ ID NO: 5); SgUBCE1-RT-R: GAACAAGCGATCATCAGGTTT (SEQ ID NO: 6)) and SgPAP27bQuantitative PCR primers (SgPAP27b-RT-F: AGGGCACAATCATCATGTTTTAGG (SEQ ID NO: 7); SgPAP27b-RT-R: CTACCCAGCCAATGCCATCTG (SEQ ID NO: 8)); quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Q711, Vazyme) as the quantitative reagent. The instrument used was an Applied Biosystems QuantStudio™ 7 Flex System (Applied Biosystems, USA). Specific operating procedures were followed according to the reagent instructions. The results are as follows Figure 2 As shown ( Al: Control treatment; +Al: Aluminum acid treatment; Different letters in the figure indicate significant differences between groups (One-Way ANOVA). P <0.05), Guyana Columnar Grass SgPAP27b The gene was upregulated in both leaves and roots after aluminum treatment, with the upregulation being more pronounced in roots.
[0021] Example 3: Stylosanthes pubescens SgPAP27b Heterologous expression of genes in Arabidopsis 1. Construction of plant overexpression vectors Using restriction endonucleases Xcm The pCXSN vector was digested with enzymes in a 50 μL solution: 10 μL (5 μg) of pCXSN vector plasmid. Xcm I 2.5 μL, restriction enzyme buffer 5 μL, ddH2O 30 μL, incubate at 37℃ for 2 h; The purified PCR product and the digested vector were then combined using the ClonExpress II One Step Cloning Kit (C112-01, Vazyme) to cross-link the pCXSN vector with the cloned... SgPAP27b Gene fragment ligation was performed, and the ligation product was transformed into *E. coli* DH5α (DL1001, Vazyme) using the heat shock method and sequenced. After confirming that the sequencing was correct, the recombinant plasmid was extracted using the FastPure Plasmid MiniKit (DC201-01, Vazyme) to obtain the recombinant vector plasmid pCXSN- SgPAP27b ; The above recombinant vector plasmids were transformed into GV3101 Agrobacterium tumefaciens, and the transformed GV3101 Agrobacterium tumefaciens was stored at -80℃ for later use.
[0022] 2. Transformation of transgenic Arabidopsis thaliana The specific steps for transforming transgenic Arabidopsis thaliana are as follows: Take the above-transformed Agrobacterium tumefaciens culture (glycerol, OD) stored at -80℃. 600 = 1.0), applied to a solution containing 50 mg L -1 Kan (kanamycin, Kan) and 50 mg L -1 Rif (rif) was placed on LB agar plates, inverted, and incubated at 28°C for 2 days. Once colonies appeared, a single colony was picked and added to 5 mL of a solution containing 50 mg L. -1 Kan and 20 mg L - 1 Activate the Rif bacterial culture overnight at 28°C and 200 rpm in LB broth. Take 60 μl of the activated bacterial culture and dilute it to 10 mL containing 50 mg L. -1 Kan and 20 mg L -1 In Rif's LB liquid medium, cultured until OD 600 = 1.0, centrifuge at 5000 rpm for 10 min, discard the supernatant, and use the infiltration buffer (50 g L). -1 Sucrose + 2.2 g L -1 MS + 0.5 g L -1 MES + 10 μg L -1 6-BA + 200 μLL -1 Resuspend the bacterial cells to OD500 using SilwetL-77 (pH adjusted to 5.7 with KOH). 600 = 0.8-1.0, used for subsequent infection; Arabidopsis thaliana plants that have grown for 4 weeks and have bolted with inflorescences were selected. The inflorescences were immersed in the infection solution for 5 minutes. The entire Arabidopsis plant was then wrapped in plastic wrap and placed in the dark for 24 hours. After removing the plastic wrap, the plants were cultured at 22°C under 16 hours of light and 8 hours of darkness. The infection process was repeated after 1 week of culture, and the culture was continued for about three months. Seeds of the T0 generation transgenic Arabidopsis thaliana were then harvested.
[0023] 3. Screening and identification of transgenic Arabidopsis thaliana After harvesting transgenic Arabidopsis thaliana T0 generation seeds and drying them in a 37℃ incubator for 5 days, they were rinsed 5 times repeatedly with ddH2O in a clean bench, then rinsed 3 times with 75% ethanol solution, disinfected with 3% sodium hypochlorite solution for 1 min, and immediately washed 6 times with ddH2O. The disinfected transgenic Arabidopsis thaliana T0 generation seeds were then evenly spread on MS solid medium (containing 30 mg L... -1In the culture dish of hygromycin B, place the culture dish in a 4℃ refrigerator to vernalize in the dark for 2 days, then transfer it to a 22℃ incubator with 16 hours of light and 8 hours of darkness for about 12 days. Transfer the healthy Arabidopsis seedlings to a seedling box containing vermiculite: nutrient soil = 1:1 (v / v) for further cultivation. Leaves from transgenic Arabidopsis thaliana plants grown for approximately 3 weeks were collected, ground with liquid nitrogen, and 0.1 g of the sample was weighed and placed in a 1.5 mL centrifuge tube. 1 mL of CTAB lysis buffer (containing 2% β-mercaptoethanol) was added, and the mixture was heated at 65°C for 2 h (15 min / time, mixing thoroughly). Then, 500 µL of chloroform was added, the mixture was shaken at room temperature for 1 min, allowed to stand for 5 min, and then centrifuged at 12000 rpm for 10 min. The upper aqueous phase was transferred to a new 1.5 mL centrifuge tube, and the same volume of isopropanol was added and mixed thoroughly. The tube was placed at -80°C for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was removed, retaining only the precipitate. 1 mL of 75% ethanol was added, the mixture was mixed, and the tube was centrifuged at 10000 rpm for 5 min. The precipitate was retained, briefly centrifuged, and the remaining liquid was removed. 30 µL of RNase-free ddH2O was added, and the mixture was pipetted to obtain the DNA sample. design SgPAP27b The detection primers (SgPAP27b-F: ATGAAAGGAGGGAGTAGTGTTGGT (SEQ ID NO: 9); SgPAP27b-R: TCAGGTTGCTAAAGTTTTTGTCTC (SEQ ID NO: 10)) and the AtEF-1α internal reference gene detection primers (AtEF-1α-F: GTCGATTTCTGGAAAGTCGACC (SEQ ID NO: 11); AtEF-1α-R: AATTGTCAATGGTGATACCACGC (SEQ ID NO: 12)) were used. The target gene was detected by PCR using extracted transgenic Arabidopsis leaf DNA as a template. The PCR reaction system was the same as in Example 1. Positive seedlings of transgenic Arabidopsis thaliana were selected based on PCR results and cultured until seed harvesting was possible. Individual plants were then harvested to obtain T1 generation seeds. The same identification process was then performed on the T1 generation seeds, and individual plants were harvested to obtain T2 generation seeds. Subsequently, the T2 generation seeds were sown in a solution containing 30 mg / L... -1 On MS solid medium containing hygromycin B, transgenic lines with a resistance ratio of 3:1 were selected and planted to harvest T3 generation seeds, which are homozygous transgenic Arabidopsis thaliana, for subsequent analysis of aluminum tolerance.
[0024] PCR identification results as follows Figure 3 As shown (WT: wild-type Arabidopsis thaliana; OE1, OE2: two independent types) SgPAP27b Overexpression transgenic lines; AtEF-1α (Arabidopsis thaliana internal reference gene), heterologous overexpression compared to WT. SgPAP27b Specific bands were amplified in the transgenic Arabidopsis thaliana lines OE1 and OE2, indicating that these lines each carry the gene. SgPAP27b Gene fragments. Arabidopsis housekeeping genes were amplified in both WT and heterologous overexpression lines. AtEF-1α The specific fragments indicate that the sample is reliable.
[0025] 4. Acid phosphatase activity assay To verify SgPAP27b To determine whether the PAP protein encoded by the gene possesses acid phosphatase biological activity, the acid phosphatase activity of transgenic Arabidopsis thaliana was measured.
[0026] Weigh out 0.1 g of the above Arabidopsis thaliana samples (heterologous expression). SgPAP27b The transgenic Arabidopsis thaliana was placed in a mortar and ground thoroughly with 1.2 mL of pre-cooled 50 mM sodium acetate buffer (pH adjusted to 5.6 with glacial acetic acid). The sample mixture was then poured into a 1.5 mL centrifuge tube and centrifuged at 14,000 rpm for 20 min at 4°C. The supernatant was collected in a new 1.5 mL centrifuge tube.
[0027] Using bovine serum albumin as a standard, the content of soluble protein in the supernatant was determined by the Coomassie brilliant blue method. 2 mM solutions were prepared using 50 mM sodium acetate buffer (pH=5.6) as the solvent. p NPP (p-nitrophenyl phosphate) substrate buffer. Pipette 0.2 mL of the plant sample supernatant into a centrifuge tube, add 0.6 mL of NPP substrate buffer. p Mix the NPP substrate buffer thoroughly and use it as the experimental group. Pipette 0.8 mL... p NPP substrate was added to centrifuge tubes as a blank control. 0 mM, 0.05 mM, 0.10 mM, 0.15 mM, 0.20 mM, and 0.25 mM solutions of p-nitrophenol were prepared using ddH2O. p NP) solution, take 0.2 mL of each of different concentrations. p Pour the NP solution into a centrifuge tube and add 0.6 mL of [unspecified ingredient]. pThe NPP substrate was thoroughly mixed and used as the standard curve. The experimental group / blank group / standard curve group were placed at 37°C and reacted for 15 min. After the reaction, 0.8 mL of 0.5 M sodium hydroxide solution was added to terminate the enzyme activity reaction. 200 µL of the terminated reaction solution was added to each microplate, and the OD value at 405 nm was measured using an Infinite M200 Pro multi-sensor microplate reader (TECAN, Switzerland). A standard curve was plotted with the OD value of the standard curve group as the x-axis and the concentration of p-nitrophenol as the y-axis. Then, the NPP substrate was calculated based on the standard curve. p NPP is released after hydrolysis p The NP content was used to calculate the acid phosphatase activity according to formula (1). The enzyme activity unit is U mg. -1 Protein, where 1 U is defined as the release of 1 μmol per minute. p NP.
[0028] (1) The results are as follows Figure 4 As shown (WT: wild-type Arabidopsis thaliana; OE1, OE2: heterologous expression) SgPAP27b Two independent transgenic Arabidopsis lines; asterisks in the figure indicate significant differences between WT and OE1 and OE2 (Student's t -test,** P <0.01), the average acid phosphatase activity of WT was 0.72 U mg. 1 The average acid phosphatase activity of OE1 is 1.80 U mg. 1 Compared to WT, it increased by 1.50 times; the average acid phosphatase activity of OE2 was 1.70 U mg. -1 This represents a 1.37-fold increase compared to WT. These results indicate that heterologous expression... SgPAP27b The ability to increase acid phosphatase activity in transgenic Arabidopsis thaliana indicates that... SgPAP27b The encoded protein has acid phosphatase activity.
[0029] Example 4 Heterologous Expression SgPAP27b Effects of genes on the tolerance of transgenic Arabidopsis to aluminum stress 1. Heterologous expression SgPAP27b Analysis of the aluminum tolerance of transgenic Arabidopsis thaliana T3 generation seeds of wild-type Arabidopsis thaliana and the transgenic Arabidopsis thaliana line cultivated in Example 3 were vernalized at 4℃, and then spread out on 1 / 6 strength MS medium containing 250 μM AlCl3 and cultured at 22 ± 1℃, 16 h light / 8 h dark. The specific culture medium formulation was: macroelements: 316.67 mg L. 1 KNO3, 550 mg / L 1 NH4NO3, 123.33 mg / L 1 MgSO4·7H2O, 73.33 mg / L 1 CaCl2·2H2O; Trace elements: 0.14 mg / L 1 KI, 1.03 mg / L 1 H3BO3, 3.72 mg / L 1 MnSO4·4H2O, 1.43 mg / L 1 ZnSO4·7H2O, 0.04 mg / L 1 Na₂MoO₄·2H₂O, 0.004 mg / L 1 CuSO4·5H2O, 0.004 mg / L 1 CoCl2; Iron salt: 6.22 mg / L 1 Fe-EDTA; Inorganic phosphorus source: 28.33 mg / L 1 KH2PO4; Vitamin: 1.67 mg / L 1 VB1, 0.17 mg / L 1 VB5, 0.17 mg / L 1 VB6, containing 1% (w / v) sucrose, was used to adjust the pH to 4.3 and solidified using 1% (w / v) agar. Heterologous expression was obtained after 10 days of culture. SgPAP27b Transgenic Arabidopsis thaliana was photographed phenotypically, its fresh weight was measured, and its taproot length was measured.
[0030] The results are as follows Figure 5 As shown, combined with Figure 5 A, Figure 5 B and Figure 5As shown in Figure C, under aluminum acid stress treatment, the average fresh weight of WT was 1.40 mg, and the average fresh weight of OE1 was 2.70 mg, an increase of 93.08% compared to WT; the average fresh weight of OE2 was 2.76 mg, an increase of 97.85% compared to WT. The average taproot length of WT was 1.97 cm, the average taproot length of OE1 was 3.17 cm, an increase of 61.14% compared to WT; and the average taproot length of OE2 was 2.93 cm, an increase of 48.90% compared to WT. These results indicate that heterologous expression... SgPAP27b It can enhance the resistance of transgenic Arabidopsis thaliana to acid and aluminum stress.
[0031] 2. Heterologous expression SgPAP27b Effects of genes on metabolites in transgenic Arabidopsis thaliana To explore heterologous expression SgPAP27b Metabolic differences between transgenic and wild-type Arabidopsis thaliana under aluminum acid stress were investigated. Untargeted metabolomics analysis was performed on wild-type Arabidopsis thaliana (WT) and transgenic Arabidopsis thaliana (OE1, OE2) treated with 250 µM AlCl3 for 10 days. This analysis was performed using ultra-high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS / MS). 20 mg of lyophilized powder samples of AlCl3-treated transgenic and wild-type Arabidopsis thaliana were added to 1 mL of methanol:acetonitrile:water solution containing a deuterated internal standard, and extracted by bead milling and sonication. Proteins were precipitated at -40°C for 1 hour, centrifuged at 12000 rpm for 15 minutes at 4°C, and 400 µL of the supernatant was dried and reconstituted for UHPLC-MS / MS analysis. Quality control samples were prepared by mixing all reconstituted samples in equal volumes.
[0032] Polar metabolites were separated using a Waters ACQUITY UPLC BEH Amide column via a Vanquish UHPLC system. The mobile phase consisted of an aqueous solution containing 25 mM ammonium acetate and 25 mM ammonium hydroxide, and acetonitrile. Nonpolar metabolites were separated using a Phenomenex Kinetex C18 column. Mobile phase A was an aqueous solution containing 0.01% acetic acid, and mobile phase B was a mixture of isopropanol and acetonitrile. Column temperatures were controlled at 30°C (polar metabolites) and 25°C (nonpolar metabolites), respectively, with an autosampler temperature of 4°C and an injection volume of 2 µL.
[0033] Mass spectrometry data were acquired using an Orbitrap Exploris 120 mass spectrometer in information-dependent acquisition mode, with electrospray ionization source conditions controlled via Xcalibur software. Raw data were processed using an internal workflow based on R language, integrating XCMS for characteristic peak detection, alignment, and integration. Metabolite identification was performed using the BiotreeDB v3.0 database. After relative standard deviation filtering, missing value imputation, and standardization, principal component analysis and orthogonal partial least squares discriminant analysis were performed using SIMCA software. The screening criteria for differentially expressed metabolites were: VIP ≥ 1.0, |log2fold change| ≥ 1.0. P <0.05 (Student's t -test). Three biological replicates were set up for each treatment.
[0034] The results are as follows Figure 6 As shown, non-targeted metabolomics analysis identified 50 phosphorus-containing metabolites. (Comparison) Figure 6 A and Figure 6 B shows that, compared with WT, the levels of glycerophosphate choline (GPC) in both overexpression lines OE1 and OE2 were significantly reduced, indicating that... SgPAP27b It participated in the hydrolysis process of GPC.
[0035] 3. Heterologous expression SgPAP27b Effects of genes on lipids in transgenic Arabidopsis thaliana Approximately 25 mg of Arabidopsis thaliana seedlings were collected and added to 800 μL of extraction buffer and 10 μL of SPLASH internal standard solution. The mixture was homogenized using a tissue homogenizer and steel beads. After sonication at 4°C for 10 min, incubation at -20°C for 1 h, and centrifugation at 25,000 rpm for 15 min at 4°C, 600 μL of the supernatant was collected and freeze-dried. The residue was reconstituted with 200 μL of isopropanol:acetonitrile:water (2:2:1, v / v / v), vortexed for 1 min, sonicated at 4°C for 10 min, and centrifuged again. The final extract was analyzed by LC-MS. Quality control samples were prepared by mixing 20 μL of each sample to monitor analytical repeatability and stability.
[0036] LC-MS analysis was performed using a Waters 2D ultra-high performance liquid chromatography system coupled with a Q Exactive high-resolution mass spectrometer, configured with an ACQUITY UPLC CSH C18 column. Mobile phase A was an acetonitrile / water solution containing 10 mM ammonium formate and 0.1% formic acid, and mobile phase B was an isopropanol / acetonitrile solution containing 10 mM ammonium formate and 0.1% formic acid. A 15-minute gradient wash cycle was used at a flow rate of 0.35 mL / min and a column temperature of 55 °C. MS and MS² scans were performed in positive and negative electrospray ionization modes according to the manufacturer's instructions. Quality control samples were inserted for analysis every 10 injections.
[0037] Data were processed using LipidSearch and MetaX software. Feature peaks with a detection rate of less than 50% in the quality control samples or less than 20% in the experimental samples were removed. Missing values were filled using the K-nearest neighbor algorithm, and batch effects were corrected using the robust LOESS signal correction method based on quality control. Lipid molecules with a coefficient of variation greater than 30% in the quality control samples were excluded. To calculate the relative abundance change of lipids in the treatment group relative to the control group, the mass spectrometry signal intensity of each lipid in the control group was normalized to 100%, and the relative abundance in the treatment group was calculated according to formula (2). The sum of the mass spectrometry signal intensities of each lipid molecule in the same lipid category represents the total level of that category.
[0038] (2) The results are as follows Figure 7 As shown, we compared the differences in lipid metabolism between WT and OE1 and OE2 under aluminum acid stress using lipidomics analysis. Figure 7 As shown in Figure A, among the seven major phospholipids, the total phosphatidylinositol (PI) levels in the two overexpression lines OE1 and OE2 were significantly lower than those in the wild type, with OE1 showing a 23.1% decrease and OE2 a 20.9% decrease, while no significant changes were observed in other phospholipid categories. Specifically, compared to the wild type, the PI (16:1-18:3) in OE1 decreased by 32.6%, and the PI (16:1-18:3) in OE2 decreased by 29.3%; the PI (17:0-18:3) in OE1 decreased by 37.2%, and the PI (17:0-18:3) in OE2 decreased by 16.7%. Figure 7 B).
[0039] Heterologous expression SgPAP27b Results of glucose and lipid metabolism levels in transgenic Arabidopsis and wild-type Arabidopsis are as follows: Figure 8 As shown, Figure 8 C showed that, compared with the wild type, the DGMG (16:0) level in OE1 increased by 53.5%, and the DGMG (16:0) level in OE2 increased by 35.0%; the DGMG (18:2) level in OE1 increased by 71.0%, and the DGMG (18:2) level in OE2 increased by 48.7%; no significant changes were observed in MGDG and MGMG levels. Figure 8 A and Figure 8 B). These results indicate that SgPAP27b It participates in the membrane lipid remodeling process and plays an important role in enhancing aluminum tolerance.
[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A purple acid phosphatase gene from Stylosanthes stylosum. SgPAP27b Its application in improving the plant's tolerance to aluminum stress is characterized by... The SgPAP27b The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, The SgPAP27b The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO:
2.
3. The application according to claim 1, characterized in that, The method to improve the plant's tolerance to aluminum stress is to increase the levels of certain nutrients in the plant. SgPAP27b Gene expression levels.
4. The application according to claim 3, characterized in that, The improvement in plants SgPAP27b The method for measuring gene expression is: constructing overexpression structures using transgenic technology. SgPAP27b A recombinant plant expression vector for the gene was generated, and then the recombinant plant expression vector was transferred into plants via Agrobacterium-mediated transformation, enabling the plants to acquire the gene. SgPAP27b The gene and the protein encoded by the gene possess the function of resistance to aluminum stress.
5. The application according to claim 4, characterized in that, The plant in question is Arabidopsis thaliana.