Engineered extracellular vesicle for treating central nervous system diseases as well as preparation method and application of engineered extracellular vesicle

Abstract

The invention relates to an engineered extracellular vesicle for treating central nervous system diseases as well as a preparation method and application of the engineered extracellular vesicle. Specifically, the invention provides the expression cassette which has a structure shown as a formula I, a carrier containing the expression cassette, a host cell and extracellular vesicles generated by utilizing the cell. The engineered extracellular vesicles provided by the invention are rich in therapeutic proteins and have excellent blood brain barrier permeability.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an engineered extracellular vesicle for treating central nervous system diseases, its preparation method, and its application. Background Technology

[0002] Many inherited metabolic disorders, such as lysosomal storage diseases (e.g., Gaucher disease, Fabry disease, Pompe disease, mucopolysaccharidoses, etc.) and certain amino acid metabolic disorders, are caused by defects or insufficient activity of specific enzymes, leading to abnormal accumulation of substrates in the body (especially in the central nervous system), and subsequently causing progressive neurological dysfunction. For example, mucopolysaccharidoses (MPS) is a group of inherited metabolic disorders caused by defects in lysosomal hydrolases, resulting in abnormal accumulation of glycosaminoglycans (GAGs) in various tissues and organs. The absence of activity in any of the approximately 12 lysosomal enzymes involved in GAG degradation can trigger a specific MPS subtype. Enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) are the standard clinical treatments for these diseases.

[0003] While traditional enzyme replacement therapy can partially alleviate physical symptoms, its recombinant enzyme preparations have difficulty effectively crossing the blood-brain barrier, are almost ineffective against central nervous system lesions, and require lifelong periodic administration, resulting in extremely high treatment costs. Hematopoietic stem cell transplantation (HSCT), although considered to offer some neuroprotective effects, faces risks such as graft-versus-host disease, severe infection, and a 20%-30% transplant-related mortality rate, with a 5-year survival rate of only about 60%. Furthermore, the treatment window for HSCT is extremely narrow, with the optimal intervention period typically before age 2 and the effective threshold generally not exceeding age 5, causing most patients to miss treatment opportunities. Summary of the Invention

[0004] The problem the invention aims to solve To address the shortcomings of existing technologies, this invention aims to provide a comprehensive solution that enhances the expression level of therapeutic enzymes while improving their sorting efficiency into extracellular vesicles and their ability to cross the blood-brain barrier, thereby promoting their entry into the brain and ultimately achieving high-activity enrichment of therapeutic enzymes at the lesion site to obtain better therapeutic effects.

[0005] Solution for solving the problem The first objective of this invention is to provide an expression box having a structure of Formula I from the 5' end to the 3' end: Z1-Z2-L1-Z3-L2-Z4-L3-Z5-Z6 (I) In Formula I, each "-" represents an independent bond or nucleotide linkage sequence; Z1 is the promoter; Z2 is the coding sequence for the first signal peptide; Z3 is the encoded sequence of TAT; Z4 is the coding sequence for an extracellular vesicle membrane protein; Z5 is the coding sequence for a therapeutic protein; Z6 is the coding sequence for a second signal peptide that is absent or targets extracellular vesicles; L1, L2, and L3 are each independently encoded sequences without any connectors; The therapeutic protein is selected from one or more of IDS enzyme, α-L-iduronase, heparin N-sulfatase, glucocerebrosidase, and α-galactosidase A.

[0006] Preferably, the therapeutic protein is an IDS enzyme, and the nucleotide sequence encoding the IDS enzyme is shown in SEQ ID NO. 1.

[0007] Preferably, the extracellular vesicle membrane protein is selected from LAMP2A and / or LAMP2B, with LAMP2A being more preferred.

[0008] Preferably, the nucleotide sequence encoding the TAT is shown in SEQ ID NO. 3.

[0009] Preferably, the promoter is an enhanced promoter, and the promoter is selected from at least one of CMV, CBH, EF1α, CAG, CAGG, CASI, desmin, TMCK, MCK, MHCK7, PGK and TTR; Preferably, the nucleotide sequence encoding the first signal peptide is shown in SEQ ID NO. 5; Preferably, the nucleotide sequence encoding the second signal peptide is shown in SEQ ID NO. 6.

[0010] A second objective of the present invention is to provide a carrier comprising the expression box described in any of the preceding claims.

[0011] Preferably, the carrier is a plasmid.

[0012] Preferably, the plasmid is a virus packaging system plasmid used to produce virus-like particles.

[0013] A third objective of the present invention is to provide a host cell containing a vector as described above, or an expression cassette as described above integrated into a chromosome.

[0014] A fourth objective of this invention is to provide an extracellular vesicle, wherein the extracellular vesicle is isolated from the host cell described above.

[0015] Preferably, the surface of the extracellular vesicles is modified with TAT peptide.

[0016] Preferably, the extracellular vesicle lumen is loaded with therapeutic proteins.

[0017] A fifth object of the present invention is to provide a pharmaceutical composition comprising the extracellular vesicles described above, and optionally, a pharmaceutically acceptable carrier.

[0018] A sixth object of the present invention is to provide the use of the above-described extracellular vesicles or the above-described pharmaceutical composition as an active ingredient in the preparation of a medicament for the prevention and / or treatment of central nervous system diseases.

[0019] Preferably, the central nervous system disease is lysosomal storage disease.

[0020] Preferably, the lysosomal storage disease is mucopolysaccharidosis type II (MPSII) with central nervous system symptoms.

[0021] Preferably, the dosage form of the drug is tablet, granule, pill, capsule, emulsion, ointment, gel, suspension, solution, powder, transdermal patch, spray, suppository, or implant.

[0022] The effects of the invention The expression cassette and nucleic acid vector constructed in this invention can significantly increase the total expression of therapeutic enzymes (such as IDS enzymes) in cells, providing a recombinant material basis for subsequent efficient loading. At the same time, the second signal peptide (ExoSignal) targeting extracellular vesicles is introduced to guide the therapeutic enzyme (such as IDS enzyme) protein specifically into extracellular vesicles at the post-translational level, achieving efficient loading. Furthermore, by expressing the TAT-extracellular vesicle-specific membrane protein fusion protein, the TAT peptide is anchored to the surface of the extracellular vesicle membrane, greatly promoting the crossing of the blood-brain barrier by extracellular vesicles. Attached Figure Description

[0023] Figure 1 The images shown are the agarose gel electrophoresis results of Example 1 of this invention, where A is the gel electrophoresis identification of LAMP2A Signalfragment; B is the gel electrophoresis identification of LAMP2A Mature fragment; C is the gel electrophoresis identification of IDS-ExoSignal fragment; and NTC represents the template-free negative control. Figure 2This is a schematic diagram of the expression box structure constructed according to the present invention; Figure 3 This is a schematic diagram of the process for preparing engineered extracellular vesicles according to the present invention; Figure 4 A schematic diagram comparing the expression levels of IDS in wild-type and engineered HEK293T cells; Figure 5 This is a diagram showing the characterization and verification results of extracellular vesicles in this invention; Figure 6 A schematic diagram comparing the expression levels of IDS in wild-type and engineered HEK293T exosomes; Figure 7 This is a schematic diagram of the in vitro toxicity detection results of extracellular vesicles provided by the present invention; Figure 8 This is a schematic diagram illustrating the in vivo efficacy verification results of extracellular vesicles in a mouse model provided by the present invention. Figure 9 A schematic diagram showing the results of flow cytometry analysis of the uptake efficiency of different extracellular vesicles in brain-derived cells; Figure 10 A schematic diagram showing the blood-brain barrier penetration ability of extracellular vesicles in a transmembrane culture chamber model; Figure 11 A schematic diagram illustrating the brain delivery efficiency of engineered extracellular vesicles in mice provided by this invention. Figure 12 This is a schematic diagram showing the quantitative analysis results of IDS enzyme activity in the brain tissue of mice from different groups. Detailed Implementation

[0024] To make the technical solution and beneficial effects of the present invention more apparent and understandable, a detailed description is provided below by listing specific embodiments. The accompanying drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly show the details of the local features; unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application pertains.

[0025] Exosomes, as endogenous nanovesicles, possess excellent biocompatibility, low immunogenicity, and natural cross-barrier transport potential, making them highly promising drug delivery carriers. However, natural exosomes have limited targeting specificity to the central nervous system (CNS), and efficiently and stably loading large protein molecules (such as therapeutic enzymes) while maintaining their activity remains a technical challenge. Existing simple incubation methods have extremely low loading efficiency, while vigorous physical loading methods (such as intense ultrasound) easily damage exosome structure and enzyme activity. Therefore, developing a delivery system capable of targeting the CNS and achieving efficient loading and activity maintenance of therapeutic enzymes is of urgent need and significant importance for overcoming the therapeutic challenges of central nervous system enzyme metabolism diseases.

[0026] Through extensive and in-depth research and numerous experiments, the inventors have ultimately developed an engineered extracellular vesicle that significantly enhances enzyme loading, activity, and delivery efficiency into the brain. The carrier provided by this invention can actively sort target proteins (therapeutic proteins) into extracellular vesicles, enabling engineered extracellular vesicles to achieve enzyme activity dozens of times higher than wild-type extracellular vesicles with the same particle count, greatly improving treatment efficiency and reducing production and usage costs. In vitro and in vivo experiments have confirmed that the extracellular vesicles (TAT-IDS) provided by this invention can efficiently accumulate in brain tissue and deliver functional enzymes (such as IDS) to the central nervous system, providing a key solution for treating lysosomal storage diseases (such as MPS II) accompanied by central nervous system symptoms.

[0027] The vector constructed in this invention is essentially a universal engineering platform. Its modular architecture allows for rapid adaptation to different enzyme deficiency diseases by replacing specific therapeutic gene modules (such as IDS), demonstrating broad potential applications. Furthermore, by using extracellular vesicles as a vector, this invention significantly reduces the risk of immunogenicity in treatment, resulting in high safety. Based on these principles, this invention has been completed.

[0028] As used herein, the terms “iduronate sulfatase,” “iduronate-2-sulfatase,” or “IDS” refer to iduronate-2-sulfatase, an enzyme involved in the lysosomal degradation of glycosaminoglycans such as heparan sulfate and dermatin. IDS deficiency is associated with mucopolysaccharidosis II (also known as Hunter syndrome).

[0029] As used herein, the term "linker" or "connector" refers to a linker peptide having sufficient length and flexibility to ensure that the two proteins linked have sufficient spatial freedom to perform their functions. In some embodiments, the linker may be cleavable or non-cleavable. In some embodiments, the linker may be a cleavable linker (a cleavable linker peptide), which is a 2A linker (e.g., T2A), a 2A-like linker, or a functional equivalent thereof and combinations thereof. In some embodiments, the linker includes a parvovirus 2A-like linker, the CHYSEL sequence (P2A) of porcine cyclovir, Thoseaasigna virus (T2A), or combinations thereof, variants, and functional equivalents thereof. In a preferred embodiment, the linker is a P2A peptide.

[0030] In some embodiments, the non-lytic linker may be a flexible linker (or flexible connector), for example, composed of Gly and Ser residues (“GS” connector). One of the most widely used examples of a flexible connector is (G4S). nThe sequence is denoted by n, where n is a positive integer. It can also be a linker peptide rich in G, S, and / or A, for example, it can be composed of glycine (G), serine (S), and alanine (A), with a preferred linker being (G4S). n Or (G4S) n A or a variant thereof, wherein n is a positive integer (e.g., 1, 2, 3, 4, 5, or 6), preferably n = 3; the (G4S) n Or (G4S) n Variants of A include: variants of the adapter sequence obtained by substituting amino acids with similar or comparable properties in the sequence, such as mutating one or more S to T respectively; or inserting 1 to 3 amino acids into the sequence.

[0031] As used herein, the term "extracellular vesicle" refers to a small vesicle-like structure released from a cell into the extracellular environment. Typically, extracellular vesicles range in diameter from 20 nm to 1000 nm and may contain a variety of macromolecular cargoes located within an internal space, displayed on the outer surface of the extracellular vesicle, and / or spanning the membrane. The cargo may include small molecules, nucleic acids, proteins, carbohydrates, lipids, and / or combinations thereof. For example, but not limited to, extracellular vesicles include apoptotic bodies, cell debris, vesicles derived from cells through direct or indirect manipulation (e.g., by continuous extrusion or treatment with an alkaline solution), vesicled organelles, and vesicles generated by living cells (e.g., by direct plasma membrane budding or late endosome fusion with the plasma membrane). Extracellular vesicles may originate from living or dead bodies, transplanted tissues or organs, and / or cultured cells. Extracellular vesicles include exosomes, microvesicles, membrane microparticles, exosomes, vesicles, and apoptotic bodies. Extracellular vesicles are generated through outward budding or fission; generation can be a natural process or a chemically induced or enhanced process.

[0032] As used herein, the term "exosome" refers to a cell-derived nanovesicle comprising a lipid bilayer surrounding its internal space, and which is generated by the cell via direct plasma membrane budding or fusion with the plasma membrane via late endosomes. The exosome comprises lipids or fatty acids and polypeptides, and optionally includes a therapeutically active payload, a receptor (e.g., a targeting moiety), a polynucleotide (e.g., nucleic acid, RNA, or DNA), a sugar (e.g., monosaccharide, polysaccharide, or glycan), or other molecules. The exosome may be derived from the producing cell and isolated from the producing cell based on its size, density, biochemical parameters, or a combination thereof. Exosomes are a type of extracellular vesicle.

[0033] As used herein, the term "engineered extracellular vesicle" refers to an extracellular vesicle whose membrane is modified, for example, an engineered extracellular vesicle whose surface is modified with a TAT peptide at a density higher than that of naturally occurring extracellular vesicles. According to embodiments of the invention, engineered extracellular vesicles can be produced by genetically engineered production cells or their progeny. For example, engineered extracellular vesicles can be produced by cells transformed or transfected with a foreign sequence or nucleic acid construct encoding a target gene fragment (active protein or TAT peptide). In some embodiments, the production cells can be cells transformed or transfected with a foreign sequence or nucleic acid construct encoding a target gene fragment (active protein or TAT peptide). In some embodiments, the foreign sequence or nucleic acid construct encoding a target gene fragment (active protein or TAT peptide) can be introduced into the production cells via different vectors. In some embodiments, the foreign sequence or nucleic acid construct encoding a target gene fragment (active protein or TAT peptide) can be introduced into the production cells via the same vector. In some embodiments, engineered extracellular vesicles according to embodiments of the invention have better properties than engineered extracellular vesicles known in the art. For example, engineered extracellular vesicles generated from cells incorporating exogenous sequences or nucleic acid constructs encoding the target gene fragment (active protein or TAT peptide) of the present invention are rich in more active proteins and have more TAT peptides on their surface compared to engineered extracellular vesicles known in the art (e.g., IDS extracellular vesicles generated using conventional extracellular vesicle proteins).

[0034] As used herein, the terms "productive cell" or "host cell" refer to cells used to generate extracellular vesicles or engineered extracellular vesicles. Productive cells include, but are not limited to, cells known to be effective at generating extracellular vesicles, such as HEK293 cells, Chinese hamster ovary (CHO) cells, HeLa cells, and mesenchymal stem cells (MSCs). These productive cells may be transformed or transfected by one or more vectors containing exogenous sequences or DNA constructs.

[0035] As used herein, the term "signal peptide" refers to a peptide sequence that guides the transport and localization of proteins within the cell, such as directing them to an organelle (e.g., the endoplasmic reticulum) and / or the cell surface. Signal peptides guide nascent proteins into the endoplasmic reticulum. This is necessary if the receptor is to be glycosylated and anchored in the cell membrane. Generally, signal peptides that are naturally attached to the largest component at the N-terminus are used.

[0036] In one aspect, the present invention provides an expression box having a structure of Formula I from the 5' end to the 3' end: Z1-Z2-L1-Z3-L2-Z4-L3-Z5-Z6 (I) In Formula I, each "-" represents an independent bond or nucleotide linkage sequence; Z1 is the promoter; Z2 is the coding sequence for the first signal peptide; Z3 is the encoded sequence of TAT; Z4 is the coding sequence for an extracellular vesicle membrane protein; Z5 is the coding sequence for a therapeutic protein; Z6 is the coding sequence for a second signal peptide that is absent or targets extracellular vesicles; and L1, L2, and L3 are each independently encoded sequences without any connectors. The therapeutic protein is selected from one or more of IDS enzyme, α-L-iduronase, heparin N-sulfatase, glucocerebrosidase, and α-galactosidase A.

[0037] In some embodiments, the therapeutic protein is an IDS enzyme, and the gene accession number of the IDS enzyme is CCDS14685.1.

[0038] In this application, the nucleotide sequence encoding the IDS enzyme is shown in SEQ ID NO. 1.

[0039] SEQ ID NO. 1: In some embodiments, the extracellular vesicle membrane protein is selected from LAMP2A and / or LAMP2B.

[0040] In some embodiments, the extracellular vesicle membrane protein is LAMP2A.

[0041] In this application, the nucleotide sequence encoding the LAMP2A is shown in SEQ ID NO. 2.

[0042] SEQ ID NO. 2: In some embodiments, the nucleotide sequence encoding the TAT is shown in SEQ ID NO. 3.

[0043] SEQ ID NO. 3: TACGGCCGGAAGAAGCGGAGACAGAGAAGAAGA In some implementations, the promoter is an enhanced promoter.

[0044] In some embodiments, the promoter is selected from at least one of CMV, CBH, EF1α, CAG, CAGG, CASI, desmin, TMCK, MCK, MHCK7, PGK, and TTR.

[0045] In some implementations, the promoter is selected from CMV.

[0046] In this application, the nucleotide sequence encoding the CMV promoter is shown in SEQ ID NO. 4.

[0047] SEQ ID NO.4: GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT In some embodiments, the nucleotide sequence encoding the first signal peptide is shown in SEQ ID NO. 5.

[0048] SEQ ID NO. 5: ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTCCTGGGAGCTGTGCGGTCTTATGCA In some embodiments, the nucleotide sequence encoding the second signal peptide is as shown in SEQ ID NO. 6.

[0049] SEQ ID NO. 6: GAAAGCTTTGTTAAAAAAGACCAAGCAGAACCACTACACCGAAAATTCGAACGACAA In some implementations, L1, L2, and L3 are each independently encoded sequences of connectors.

[0050] In some implementations, L1 and L2 are each independently non-decomposable connectors.

[0051] In some implementations, L3 is a detachable linker.

[0052] In some implementations, L3 is P2A.

[0053] In this application, the nucleotide sequence of L1 is shown in SEQ ID NO. 7.

[0054] SEQ ID NO.7: GGCAATAGCACAATGGGCAGCGGC In this application, the nucleotide sequence of L2 is shown in SEQ ID NO. 8.

[0055] SEQ ID NO.8: GGCAGCGGCTCTGGCAGCGGAGGATCTAGC In this application, the nucleotide sequence of L3 is shown in SEQ ID NO. 9.

[0056] SEQ ID NO.9: GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTTTCGCCACC In this application, the nucleotide sequence of the expression cassette is shown in SEQ ID NO. 10.

[0057] SEQ ID NO.10: Another aspect of the present invention provides a carrier comprising the expression cassette described in any of the preceding claims.

[0058] In this application, the carrier skeleton of the carrier is pLVX-Puro.

[0059] In a specific implementation, the sequence of the vector is shown in SEQ ID NO. 11.

[0060] SEQ ID NO.11: In some embodiments, the vector is a plasmid, preferably a virus packaging system plasmid used to produce virus-like particles.

[0061] As used herein, the terms "constructor" or "vector" generally refer to nucleic acids capable of transporting the coding sequence of the target protein to which they are attached. One type of vector is the "plasmid," which is a circular double-stranded DNA loop that can attach to additional DNA segments.

[0062] The coding sequence of the target protein can be incorporated into a vector. The vector can be used to replicate the nucleic acid in a compatible host cell. The vector can be recovered from the host cell. The vector can be an expression vector for expressing the target nucleic acid sequence in a compatible host cell. Appropriately, the coding sequence of the target protein is operatively linked to a control sequence (e.g., a promoter or enhancer) capable of providing expression of the coding sequence of the target protein in the host cell. The term "operatively linked" means that the described components are in a relationship that allows them to function in their intended manner. The regulatory sequence operatively linked to the coding sequence of the target protein is linked in such a way that expression of the target nucleic acid sequence is achieved under conditions compatible with the control sequence.

[0063] Vectors can be transformed or transfected into suitable host cells to provide protein expression. This process may include culturing host cells transformed with the expression vector under conditions that provide expression of the vector encoding the target nucleic acid sequence of the protein, and optionally recovering the expressed protein.

[0064] Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequence of the protein of the present invention and suitable transcription / translation control signals, preferably commercially available vectors: bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; the PL promoter of λ bacteriophage; eukaryotic promoters including the early CMV promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator; the insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors of DNA expression, typically about 10–300 bp in length, that act on promoters to enhance gene transcription. Examples include adenovirus enhancers. Furthermore, expression vectors preferably contain one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells.

[0065] The obtained transformants can be cultured using conventional methods to express the target protein of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.

[0066] Another aspect of the present invention provides a host cell containing a vector as described above, or an expression cassette as described in any of the above-described embodiments integrated into a chromosome.

[0067] In this invention, non-limiting examples of the host cell may include HEK293 cells, Chinese hamster ovary (CHO) cells, mesenchymal stem cells (MSCs), and cells derived from HEK293 cells, CHO cells, or MSCs. Furthermore, non-limiting examples of the host cell may include mast cells, immune cells, natural killer cells, dendritic cells, macrophages, T lymphocytes, B lymphocytes, epithelial cells, human cardiac progenitor cells, adipose-derived stem cells, umbilical cord blood mesenchymal stem cells, and bone marrow mesenchymal stem cells.

[0068] The host cells containing the above-mentioned carrier provided by the present invention can significantly promote the sorting and enrichment of therapeutic enzyme proteins into extracellular vesicles, and culturing the host cells can yield functionalized extracellular vesicles with high enzyme activity.

[0069] Another aspect of the present invention provides an extracellular vesicle isolated from the host cell described above.

[0070] In some embodiments, the surface of the extracellular vesicles is modified with a TAT peptide.

[0071] In some embodiments, the extracellular vesicle lumen is loaded with therapeutic proteins.

[0072] In some embodiments, the therapeutic protein is selected from one or more of IDS enzyme, α-L-iduronase, heparin N-sulfatase, glucocerebrosidase, and α-galactosidase A.

[0073] In some embodiments, the therapeutic protein is an IDS enzyme.

[0074] In some embodiments, the extracellular vesicles are exosomes.

[0075] In this invention, the extracellular vesicles can effectively penetrate the blood-brain barrier. For example, the extracellular vesicles of this invention can enter brain-derived cells (including but not limited to penetrating the mouse blood-brain barrier and entering mouse brain cells). At the same time, the extracellular vesicles of this invention can maintain high enzyme activity in brain tissue.

[0076] Another aspect of the present invention provides a method for preparing engineered extracellular vesicles, the flowchart of which is shown below. Figure 3 As shown.

[0077] In some embodiments, a method for preparing engineered extracellular vesicles includes the following steps: Culture the host cell as described in any of the preceding items and isolate the extracellular vesicles secreted by the host cell from the culture medium.

[0078] In some embodiments, the culture conditions are those known in the art, including appropriate culture medium, temperature, and carbon dioxide concentration. The type of host cell is not particularly limited and may be animal cells (e.g., monkey cells, mouse cells) or human cells, examples of which include, but are not limited to, HEK293F cells, HEK293T cells, Vero cells, CHO cells, HeLa cells, HuH7 cells, HEK-293 cells, and macrophages.

[0079] In some embodiments, the culture medium is preferably a culture supernatant.

[0080] In some embodiments, the culture medium is a serum-free, high-glucose DMEM medium.

[0081] As used herein, the terms “isolation” or “purification” and “extraction” are used interchangeably to refer to the state of preparation of desired extracellular vesicles (e.g., multiple known or unknown quantities and / or concentrations) that has undergone one or more purification processes, such as selection or enrichment of the desired extracellular vesicle preparation. In some embodiments, as used herein, isolation or purification is the process of removing or partially removing extracellular vesicles from a sample containing production cells. In some embodiments, the isolated extracellular vesicle composition is enriched compared to the starting material from which the composition was obtained (e.g., a production cell preparation).

[0082] The extracellular vesicles can be separated by any method capable of separating them from the culture medium. For example, the extracellular vesicles can be separated by centrifugation, ultracentrifugation, filtration through a filter, ultrafiltration, gel filtration chromatography, ion exchange chromatography, precipitation, immunoprecipitation, pre-flow electrophoresis, capillary electrophoresis, or a combination thereof. The separation method may include washing to remove impurities and concentration processes. The extracellular vesicles can be produced by the methods described below for separating the extracellular vesicles. The extracellular vesicles can be produced by ultrafiltration of the microbial culture medium using an ultrafine filter having a cutoff value of 10 kD or higher, for example, 50 kD or higher, 100 kD or higher, 300 kD or higher, or 500 kD or higher. The extracellular vesicles are separated by using a filter with a cutoff value of 100,000 × 100 kD. g The above-described ultracentrifugation is used to separate the microbial culture medium into precipitates. The separation can also be performed using known kits. The separation can also be achieved by producing extracellular vesicles according to the methods described in the examples below.

[0083] Another aspect of the present invention provides a pharmaceutical composition comprising the extracellular vesicles described above, and optionally, a pharmaceutically acceptable carrier.

[0084] As used herein, "pharmaceutical composition" refers to a formulation of the engineered cells of the present invention and a medium generally accepted in the art for delivering a bioactive ingredient (the engineered immune cells provided by the present invention) to a mammal (e.g., a human). This medium includes pharmaceutically acceptable carriers. The purpose of the pharmaceutical composition is to facilitate drug administration to the organism, thereby promoting the absorption of the active ingredient and the exertion of its bioactivity.

[0085] As used herein, the term "pharmaceutically acceptable carrier" includes, but is not limited to, any adjuvant, carrier, excipient, gliding agent, sweetener, diluent, preservative, dye / coloring agent, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier that is permitted by the relevant governmental regulatory authority to be acceptable for human or animal use.

[0086] Another aspect of the invention provides the use of comprising the above-described extracellular vesicles or the above-described pharmaceutical composition as an active ingredient in the preparation of a medicament for the prevention and / or treatment of central nervous system diseases.

[0087] In some embodiments, the central nervous system disease is lysosomal storage disease.

[0088] In some embodiments, the lysosomal storage disease is mucopolysaccharidosis type II (MPS II) with central nervous system symptoms.

[0089] In some embodiments, the dosage form of the drug is a tablet, granule, pill, capsule, emulsion, ointment, gel, suspension, solution, powder, transdermal patch, spray, suppository, or implant.

[0090] In this invention, the drug can be administered to an individual via intravenous injection or nebulized inhalation.

[0091] Dosage can be varied based on factors such as the patient's weight, age, sex, health status, daily diet, administration time, administration method, excretion rate, and disease severity. The daily dose refers to the amount of active ingredient sufficient to treat the alleviated disease state when administered to an individual requiring treatment. For an adult weighing 70 kg, the dosage is approximately 0.01 mg / day to 1000 mg / day, or approximately 0.01 mg / day to approximately 500 mg / day, and can be divided into doses once or several times daily at predetermined intervals.

[0092] Another aspect of the present invention provides a method for treating a disease by administering a safe and effective amount of any of the above-described extracellular vesicles or the above-described pharmaceutical composition to a subject requiring treatment.

[0093] In some implementations, the disease is a central nervous system disease.

[0094] In some embodiments, the central nervous system disease is lysosomal storage disease.

[0095] In some embodiments, the lysosomal storage disease is mucopolysaccharidosis type II (MPS II) with central nervous system symptoms.

[0096] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0097] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0098] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sam Brook et al., *MOLECULAR CLONING: A LABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; *theseries METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATINSTRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (P.M. Wassarman and A.P. Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (P. B. Becker, ed.) Humana Press, Totowa, 1999, etc.

[0099] In addition to the specific methods, equipment, and materials used in the embodiments, based on the knowledge of those skilled in the art and the description of this invention, any prior art methods, equipment, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention can be used to implement this invention. Unless otherwise stated, parts and percentages are parts by weight and weight percentages.

[0100] The raw materials and reagents used in this invention are all common reagents in the art. Unless otherwise specified, they can be purchased commercially or synthesized according to known methods. Of course, it is not excluded that they can be synthesized according to methods disclosed in the prior art.

[0101] Example 1: Construction of expression vector The signal peptide coding sequence of LAMP2A and its homologous arm (with the sequence shown in SEQ ID NO. 5, 113 bp), the nucleic acid coding sequence of the mature domain of LAMP2A and its homologous arm (with the sequence shown in SEQ ID NO. 2, 1168 bp), and IDS and its homologous arm (with the sequence shown in SEQ ID NO. 1) were amplified from cDNA of HEK293T cells by PCR. Then, the nucleic acid coding sequences of P2A and its homologous arm (specifically, the sequence shown in SEQ ID NO. 9) and ExoSignal and its homologous arm (with the sequence shown in SEQ ID NO. 6) tags were added before and after IDS, respectively, to obtain the IDS-ExoSignal fragment. The size of each fragment was verified by agarose gel electrophoresis, and the electrophoresis images of each fragment are shown below. Figure 1 As shown.

[0102] Ligation of the LAMP2A signal fragment and TAT-fragment was performed using overlap PCR. The aforementioned gene fragments were then homologously recombinated with the pLVX-Puro vector. Single-clone colonies were obtained and subjected to colony PCR. Single-clone colonies with a molecular weight of approximately 3635 bp were selected for sequencing. Sequencing results showed that we successfully constructed lentiviral overexpression vectors of pLVX-IDS-ExoSignal and pLVX-TAT-IDS-ExoSignal. The vector maps are shown below. Figure 2 As shown, A is the pLVX-TAT-IDS-ExoSignal expression vector map, and B is the pLVX-IDS-ExoSignal expression vector map.

[0103] Example 2 Construction of engineered cells To obtain engineered cells, HEK293T cells were transduced using the TAT-IDS lentivirus (pLVX-TAT-IDS-ExoSignal expression vector) carrying a dual engineered editing system prepared in Example 1, and a single engineered editing system containing only the IDS expression unit (i.e., IDS lentivirus, pLVX-IDS-ExoSignal expression vector). After screening, the cells were expanded and cultured. The expression levels of IDS in wild-type HEK293T cells, IDS-engineered cells, and TAT-IDS-engineered cells were then detected by qPCR. The results showed that the mRNA levels of IDS in both engineered cell types were significantly higher than those in wild-type cells. Figure 4 Furthermore, the mRNA level in TAT-IDS engineered cells was further increased compared to that in IDS engineered cells.

[0104] Example 3: Preparation and Identification of Engineered Exosomes Wild-type and engineered HEK293T cells in logarithmic growth phase were cultured in serum-free high-glucose DMEM for 48 hours. The supernatant was collected from each cell, and exosomes were purified using an exosome extraction kit or ultracentrifugation to obtain the corresponding exosome samples. The extracted exosomes were characterized by Western blot. The results (…) Figure 5 The expression of exosome-specific markers Alix, TSG101, CD63, and CD81 was successfully detected, while the negative control Calnexin was not detected, confirming the purity of the exosomes. Western blot results also confirmed the successful expression of LAMP2A and IDS proteins in the engineered exosomes. Further qPCR analysis of the samples showed that the mRNA level of IDS in both engineered exosomes was significantly higher than that in wild-type exosomes. Figure 6 Furthermore, the mRNA level in TAT-IDS exosomes (TAT-IDS Exosignal-sEVs) was further increased compared to that in IDS exosomes (IDS Exosignal-sEVs). The presence of IDS mRNA in exosomes can enhance and prolong the therapeutic effect.

[0105] Example 4: Biosafety Testing of Exosomes CCK-8 assay for cell proliferation: To assess the biosafety of the obtained exosomes, the CCK-8 assay was used to detect the effect of different exosome samples on the proliferative activity of two types of human brain-related cells. The experiment was conducted in three groups: blank exosomes secreted by wild-type HEK293T cells (Blank-sEVs), single-engineered IDS exosomes with high IDS expression only (IDSExosignal-sEVs), and dual-engineered TAT-IDS exosomes with both high IDS expression and TAT modification (TAT-IDSExosignal-sEVs). Human brain microvascular endothelial cells (HCMEC / D3) and human glioma cells (U87MG) were cultured and treated with different concentrations (0 μg, 10 μg, 50 μg, 100 μg) of exosomes. The CCK-8 results showed (…). Figure 7 At each concentration, none of the three exosomes produced significant cytotoxicity in either cell type, indicating that the engineered exosomes have good biosafety under the experimental conditions.

[0106] Example 5: In vivo efficacy verification of TAT-IDS exosomes In vitro enzyme activity assay of exosomes: To quantitatively assess the functional activity of IDS enzymes in engineered exosomes, we employed a fluorescence detection method based on a two-step substrate-catalyzed enzyme reaction. In this reaction system, the substrate 4-MU-α-IdoA-2-sulfate undergoes desulfation catalyzed by the IDS enzyme in the sample in the first step, generating the intermediate 4-MU-α-iduronide; in the second step, this intermediate is hydrolyzed by exogenously added IDUA enzyme, generating the fluorescent final product 4-methylumbelliferone (4-MU). The activity of the IDS enzyme in the first step can be quantitatively reflected by detecting the fluorescence intensity at an excitation wavelength of 360 nm and an emission wavelength of 440 nm. Using this detection method, we compared the enzyme activities of engineered exosomes and wild-type exosomes. The results showed that, with the same total protein content, the IDS enzyme activity of TAT-IDS exosomes was 4 times that of wild-type HEK293T blank exosomes; and with the same number of exosome particles, the enzyme activity of TAT-IDS exosomes was 34 times that of blank exosomes. This result strongly confirms that transfection of host cells with the vector constructed in this application can significantly promote the sorting and enrichment of IDS enzyme proteins into vesicles, thereby successfully obtaining functionalized exosomes with high enzyme activity.

[0107] In vivo efficacy validation of exosomes in a mouse model: To evaluate the therapeutic potential of engineered exosomes in vivo, we used Ids gene knockout transgenic mice (IKO) as the MPS II disease model. The model mice were randomly divided into groups, and the experimental group (MPS II + TAT-IDS sEVs) received TAT-IDS exosomes via tail vein injection at a dose of 200 μg every 3 days for a total of 4 injections. Wild-type C57BL / 6J mice (WT) were used as normal controls, and Ids gene knockout mice were injected with blank exosomes (MPS II + Blank sEVs) as disease model controls. The efficacy was assessed by measuring the urinary GAG content of each group of mice after treatment. Results are as follows: Figure 8 As shown, compared with the WT group, the urinary GAG level in the MPS II + Blank sEVs control group was significantly increased, consistent with the disease phenotype; while the urinary GAG level in the MPS II + TAT-IDS sEVs group treated with TAT-IDS ExoSignal exosomes was significantly reduced, eventually returning to levels similar to the WT group. This result confirms that intravenously injected TAT-IDS exosomes can effectively deliver IDS enzymes in vivo and exert a functional therapeutic effect.

[0108] Example 6: Assessment of the ability of TAT-IDS exosomes to cross the blood-brain barrier in vitro In vitro cellular uptake assay: To assess the cellular uptake efficiency of exosomes, different exosomes labeled with fluorescent dyes (Blank-sEVs, IDS ExoSignal-sEVs, and TAT-IDS ExoSignal-sEVs) were co-incubated with human brain microvascular endothelial cells HCMEC / D3 and human glioma cells U87MG for 2 hours. Intracellular fluorescence intensity was detected by flow cytometry, and the proportion of fluorescently positive cells was used to quantitatively characterize the exosome uptake capacity. Results showed ( Figure 9 After co-incubation with HCMEC / D3 cells, the proportion of fluorescently positive cells in the TAT-IDS exosome group was 25.77%, significantly higher than that in the blank exosome group (4.66%) and the IDS exosome group (6.30%). Figure 9 (A); After co-incubation with U87MG cells, the positive rate of the TAT-IDS exosome group was 19.15%, which was significantly higher than that of the blank exosome group (3.08%) and the IDS exosome group (4.64%). Figure 9 (B) This demonstrates that the exosomes engineered using the vector described in this application have significantly enhanced uptake capacity by monolayer cells.

[0109] To further simulate the process of exosomes penetrating the blood-brain barrier, we constructed a transmembrane culture chamber model. Exosomes with different fluorescent labels were added to the upper chamber (HCMEC / D3 cells), and after culture for a certain period, the proportion of exosomes penetrating into the lower chamber (U87MG cells) was measured. Results ( Figure 10 The results showed that the TAT-IDS exosome group had a penetration rate of up to 30.57% into the lower ventricle, which was significantly higher than that of the blank exosome group (15.43%) and the IDS exosome group (16.78%). This confirms that the exosomes engineered with the vector described in this application exhibit significantly enhanced penetration efficiency in the in vitro blood-brain barrier model.

[0110] Example 7: Assessment of the in vivo blood-brain barrier crossing ability of TAT-IDS exosomes To verify the in vivo brain delivery efficiency of engineered exosomes, three fluorescently labeled exosomes (Blank-sEVs, IDS ExoSignal-sEVs, and TAT-IDS ExoSignal-sEVs) were injected into nude mice via the tail vein. After a certain time interval following injection, brain tissue from each group of nude mice was collected for fluorescence imaging analysis. Results ( Figure 11 The results showed that only the TAT-IDS exosome group had a significant fluorescent signal in the brain of nude mice, with a significantly higher intensity than the other two groups. In contrast, the blank and IDS exosome groups showed almost no fluorescence in the brain tissue of nude mice, indicating that the exosomes engineered by the vector in this application can be enriched in the brain.

[0111] To further quantify the IDS enzyme activity in brain tissue homogenates, we employed a fluorescence detection method based on a two-step enzyme-catalyzed reaction. In this reaction system, the substrate 4-MU-α-IdoA-2-sulfate undergoes desulfation catalyzed by the IDS enzyme in the sample in the first step, generating the intermediate 4-MU-α-iduronide; in the second step, this intermediate is hydrolyzed by exogenously added IDS enzyme, generating the fluorescent final product 4-methylumbelliferone (4-MU). The activity of the IDS enzyme in the first step of the reaction can be quantitatively reflected by detecting the fluorescence intensity at an excitation wavelength of 360 nm and an emission wavelength of 440 nm. Results ( Figure 12 The results showed that the enzyme activity in the brain tissue of the TAT-IDS exosome group reached 2612.1 nmol / hr / mg Pro, significantly higher than that of the blank exosome group (1990.7 nmol / hr / mg Pro) and the IDS exosome group (1963.4 nmol / hr / mg Pro). This data functionally confirms that TAT-IDS exosomes can not only effectively cross the blood-brain barrier but also maintain high enzyme activity in brain tissue, providing crucial evidence for its treatment of central nervous system symptoms related to lysosomal storage diseases.

[0112] It should be understood that the above embodiments are exemplary and are not intended to encompass all possible implementations included in the claims. Various modifications and changes can be made to the above embodiments without departing from the scope of this disclosure. Similarly, the various technical features of the above embodiments can be arbitrarily combined to form other embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments only illustrate several implementations of the present invention and do not limit the scope of protection of this patent.

Claims

1. An expression box, characterized in that, The expression box has a structure of Formula I from the 5' end to the 3' end: Z1-Z2-L1-Z3-L2-Z4-L3-Z5-Z6 (I) In Formula I, each "-" represents an independent bond or nucleotide linkage sequence; Z1 is the promoter; Z2 is the coding sequence for the first signal peptide; Z3 is the encoded sequence of TAT; Z4 is the coding sequence for an extracellular vesicle membrane protein; Z5 is the coding sequence for a therapeutic protein; Z6 is the coding sequence for a second signal peptide that is absent or targets extracellular vesicles; L1, L2, and L3 are each independently encoded sequences without any connectors; The therapeutic protein is selected from one or more of IDS enzyme, α-L-iduronase, heparin N-sulfatase, glucocerebrosidase, and α-galactosidase A.

2. The expression box according to claim 1, characterized in that, The therapeutic protein is an IDS enzyme, and the nucleotide sequence encoding the IDS enzyme is shown in SEQ ID NO. 1; Preferably, the extracellular vesicle membrane protein is selected from LAMP2A and / or LAMP2B, with LAMP2A being more preferred; Preferably, the nucleotide sequence encoding the TAT is shown in SEQ ID NO.

3.

3. The expression box according to claim 1, characterized in that, The promoter is an enhanced promoter, and the promoter is selected from at least one of CMV, CBH, EF1α, CAG, CAGG, CASI, desmin, TMCK, MCK, MHCK7, PGK and TTR; Preferably, the nucleotide sequence encoding the first signal peptide is shown in SEQ ID NO. 5; Preferably, the nucleotide sequence encoding the second signal peptide is shown in SEQ ID NO.

6.

4. A carrier, characterized in that, The carrier comprises the expression box as described in any one of claims 1 to 3.

5. The carrier according to claim 4, characterized in that, The vector is a plasmid, preferably a virus packaging system plasmid used to produce virus-like particles.

6. A host cell, characterized in that, The host cell contains the vector as described in claim 4, or the chromosome integrates the expression cassette as described in any one of claims 1 to 3.

7. An extracellular vesicle, characterized in that, The extracellular vesicles are isolated from the host cell described in claim 6.

8. The extracellular vesicle according to claim 7, characterized in that, The surface of the extracellular vesicles is modified with TAT peptide; Preferably, the extracellular vesicle lumen is loaded with therapeutic proteins.

9. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the extracellular vesicles of claim 7 or 8, and optionally, a pharmaceutically acceptable carrier.

10. Use of the extracellular vesicles of claim 7 or 8 or the pharmaceutical composition of claim 9 as an active ingredient in the preparation of a medicament for the prevention and / or treatment of central nervous system diseases; Preferably, the central nervous system disease is lysosomal storage disease; Preferably, the lysosomal storage disease is mucopolysaccharidosis type II (MPS II) with central nervous system symptoms. Preferably, the dosage form of the drug is tablet, granule, pill, capsule, emulsion, ointment, gel, suspension, solution, powder, transdermal patch, spray, suppository, or implant.

Images