A spatio-temporal specific promoter of rice endogenous OsSULTR1;3pro and application thereof

The application of the rice endogenous promoter OsSULTR1;3pro has solved the problems of scarce existing promoter resources and safety, and has enabled efficient, safe and precise regulation of gene expression in plant genetic engineering, thus promoting the development of transgenic plants.

CN122012604BActive Publication Date: 2026-06-19NATIONAL TECHNOLOGY INNOVATION CENTER FOR SALT-ALKALI TOLERANT RICE AT SANYA +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NATIONAL TECHNOLOGY INNOVATION CENTER FOR SALT-ALKALI TOLERANT RICE AT SANYA
Filing Date
2026-04-13
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

In current plant genetic engineering, there is a lack of spatiotemporally specific promoter resources, resulting in insufficient expression activity, lack of rigorous tissue specificity, and poor adaptability of promoters from heterologous species, making it difficult to achieve precise regulation of gene expression and ensure safety.

Method used

We discovered and validated the endogenous OsSULTR1;3pro promoter in rice, amplified it using specific primers, and constructed an expression cassette and recombinant vector. Using Agrobacterium-mediated transformation, we drove the efficient expression of exogenous genes in callus tissue and roots in plants such as rice, maize, and wheat, avoiding the introduction of exogenous gene fragments.

Benefits of technology

This technology enables the efficient expression of exogenous genes in specific tissues of plants such as rice, corn, and wheat, improving genetic transformation efficiency, reducing safety risks, enriching promoter resources for transgenic plants, and promoting commercial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012604B_ABST
    Figure CN122012604B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of agricultural biotechnology, specifically relating to a rice endogenous spatiotemporally specific promoter OsSULTR1;3pro and its applications. The nucleotide sequence of the promoter OsSULTR1;3pro is shown in SEQ ID NO.1. The OsSULTR1;3pro provided by this invention is a spatiotemporally specific expression regulatory element derived from rice itself, capable of efficiently and stably driving the expression of target genes in plant callus tissue, and simultaneously achieving targeted, efficient, and stable expression in root and stem tissues during the vegetative growth stage of plants. This promoter can effectively replace commonly used non-plant-derived promoters in existing plant genetic engineering, and has significant industrial application value in the field of plant genetic engineering. It can not only improve the targeting and stability of target gene expression in transgenic plants, but also significantly reduce the potential biosafety risks of transgenic plants caused by the introduction of exogenous DNA into the plant genome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to a spatiotemporally specific promoter OsSULTR1;3pro endogenous in rice and its applications. Background Technology

[0002] As core DNA cis-acting elements regulating gene transcription initiation, promoters are key regions where RNA polymerases specifically recognize, bind to, and initiate transcription. They contain conserved motifs essential for transcription initiation, are mostly located upstream of the transcription start site of structural genes, and do not participate in the transcription process themselves. Based on gene expression regulation patterns, promoters can be classified into three types: constitutive, inducible, and spatiotemporally specific. Among these, spatiotemporally specific promoters mediate precise gene expression in specific tissues, organs, or developmental stages. They are core elements for achieving precise gene expression regulation and avoiding the side effects of ectopic expression, possessing irreplaceable value in targeted trait improvement and metabolic pathway regulation, and are crucial for the precision development of plant genetic engineering.

[0003] While the application of space- and time-specific promoters in current plant genetic engineering is highly valuable, the availability of high-quality resources is relatively scarce. Many existing space- and time-specific promoters suffer from insufficient expression activity and lack of precise tissue specificity, making it difficult to meet the practical needs of precise regulation of target gene expression. Some space- and time-specific promoters derived from heterologous species also exhibit poor adaptability and unstable regulatory efficiency, further limiting their widespread application in plant transgenic operations. Therefore, discovering novel, highly efficient, specific, and widely adaptable plant-derived space- and time-specific promoters has become a core requirement for overcoming the bottlenecks in precise plant gene regulation and promoting the development of genetic engineering towards higher efficiency and precision. Summary of the Invention

[0004] The purpose of this invention is to discover and verify a safe and efficient spatiotemporally specific promoter derived from rice, so as to overcome the limitations of existing transgenic promoters in terms of safety and application effectiveness.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The first aspect of this invention provides a plant spatiotemporally specific promoter OsSULTR1;3pro, the nucleotide sequence of which is shown in SEQ ID NO.1. This promoter can be efficiently amplified using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3.

[0007] The second aspect of this invention provides biomaterials related to the plant spatiotemporally specific promoter OsSULTR1;3pro:

[0008] 1) An expression cassette containing the promoter OsSULTR1;3pro.

[0009] In this embodiment, the present inventors constructed an expression cassette OsSULTR1;3pro-GUS-nosT containing this promoter. The expression cassette also includes a functional gene and a terminator, with the nucleotide sequence shown in SEQ ID NO.4. The structures within the expression cassette are functionally linked to each other in the transcriptional direction.

[0010] 2) Recombinant vectors containing the promoter OsSULTR1;3pro or the expression cassettes described above.

[0011] In an embodiment, the present inventors inserted the above-mentioned promoter or expression cassette between the HindIII and NcoI double restriction sites of the 1305gusplus vector to construct the recombinant vector 1305gusplus-OsSULTR1;3pro-1229.

[0012] 3) Recombinant microorganisms containing the promoter OsSULTR1;3pro, the expression cassette, or the recombinant vector.

[0013] 4) Transgenic plant cell lines containing the promoter OsSULTR1;3pro, the expression cassette, or the recombinant vector.

[0014] The third aspect of this invention provides the plant spatiotemporally specific promoter OsSULTR1;3pro and any of the following applications of the aforementioned related biomaterials:

[0015] 1) Application in the preparation of transgenic plants;

[0016] 2) Application of driving the expression of exogenous genes in plant callus and / or tissues during the vegetative growth stage;

[0017] The exogenous gene is the GUS gene; the plants include rice, corn, and wheat;

[0018] When the plant is rice, the GUS gene is expressed in callus, roots and stems;

[0019] When the plant is maize, the GUS gene is expressed in callus, roots and stems.

[0020] When the plant is wheat, the GUS gene is expressed in callus, roots, and stems.

[0021] Furthermore, the application is to construct the OsSULTR1;3pro promoter into a vector and then introduce it into a plant to prepare a transgenic plant; or to introduce the biological material into a plant to prepare a transgenic plant.

[0022] Furthermore, the application is to introduce target DNA operatively linked to the aforementioned OsSULTR1;3pro promoter into plants.

[0023] Furthermore, after obtaining the transgenic plants, they are screened using marker genes.

[0024] As a preferred embodiment, the present invention provides a method for preparing transgenic rice, comprising:

[0025] The vector containing the OsSULTR1;3pro promoter was transformed into rice callus using Agrobacterium-mediated transformation.

[0026] Rice seedlings were obtained by resistance screening and differentiation of the rice callus tissue;

[0027] Transgenic rice was obtained by rooting the rice seedlings.

[0028] Furthermore, the rice callus tissue was prepared by the following method:

[0029] After the rice seeds are dehulled and disinfected, the mature embryos are inoculated into an induction medium to induce embryogenic callus tissue, and cultured in the dark at 28-30℃ for 30-50 days.

[0030] Furthermore, after transforming the plant spatiotemporally specific promoter OsSULTR1;3pro into rice callus, co-culture is also included, wherein the co-culture is carried out in the dark at 22~24℃ until bacterial cells appear on the surface of the callus.

[0031] Furthermore, the resistance screening involves inoculating co-cultured callus tissue into a screening medium supplemented with hygromycin, and incubating it in the dark at 28-30°C for 30-50 days to perform resistance screening.

[0032] Furthermore, the differentiation involves adding the resistance-selected callus tissue to a differentiation medium supplemented with hygromycin and culturing it under light at 28-30°C for 25-40 days.

[0033] Furthermore, the rooting culture involves inoculating rice seedlings onto a rooting medium supplemented with hygromycin and cultivating them under light at 30-32°C for 5-20 days.

[0034] Furthermore, after rooting culture, including PCR testing, plants that test positive are selected for planting.

[0035] The beneficial effects of this invention are:

[0036] (1) The present invention screened a plant spatiotemporally specific promoter OsSULTR1;3pro, which is derived from rice and can drive the gene to be expressed efficiently in the callus, root and stem of rice.

[0037] The promoter OsSULTR1;3pro provided by this invention can be combined with endogenous or exogenous plant selection marker genes to form a plant transgenic selection expression cassette or a plant genetic transformation selection vector, and other functional elements can be added for plant tissue culture or plant genetic transformation, providing an effective tool and method for screening plant genetic transformation.

[0038] (2) The primer pair provided by the present invention can efficiently amplify the OsSULTR1;3pro promoter of the target gene.

[0039] (3) The biomaterials provided by the present invention can improve the efficiency of vector construction and genetic transformation.

[0040] (4) The promoter OsSULTR1;3pro provided by this invention can also drive the gene to be expressed efficiently in the roots and stems of the transformed seedlings. In addition, the promoter OsSULTR1;3pro is an endogenous gene in plants, and no exogenous gene fragments such as bacteria are introduced during the transgenic process. This not only enriches the promoter resources for plant transgenics, but also effectively reduces the potential safety risks of transgenic plants caused by exogenous genes and public concerns about the safety of transgenic plants. It is conducive to the commercial application of transgenic plants and has good market value and social benefits. Attached Figure Description

[0041] Figure 1 The results of agarose gel electrophoresis provided in Example 2 of the present invention are shown; where a and b are the amplified fragment of promoter OsSULTR1;3pro-1229 and the digested fragment of vector 1305gusplus, respectively.

[0042] Figure 2 The vector spectrum of the 1305gusplus vector provided in Embodiment 2 of the present invention.

[0043] Figure 3 Electrophoresis image of the 1305gusplus-OsSULTR1;3pro-1229 vector provided in Example 2 of the present invention after digestion with HindIII and StUI;

[0044] Where M stands for Marker, ck1 is the undigested 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid, and 1-4 are the digested 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmids.

[0045] Figure 4The vector spectrum of the 1305gusplus-OsSULTR1;3pro-1229 vector provided in Embodiment 2 of the present invention.

[0046] Figure 5 The electrophoresis results of PCR detection of Agrobacterium after transformation provided in Example 3 of the present invention are shown; where M is the Marker, ck+ is the positive control of the 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid, and 1-4 are samples of Agrobacterium monoclonal bacterial culture transformed with the 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid.

[0047] Figure 6 A schematic diagram showing the results of screening callus tissue with hygromycin screening medium in Example 3 of the present invention;

[0048] Among them, WT is a schematic diagram of hygromycin screening of Zhonghua 11 callus, and 1305gusplus-OsSULTR1;3pro-1229 is a schematic diagram of hygromycin screening of 1305gusplus-OsSULTR1;3pro-1229 converted to Zhonghua 11 callus.

[0049] Figure 7 This is an electrophoresis diagram of PCR detection of transgenic sample plants provided in Example 3 of the present invention; wherein, M is the marker, H2O is the blank control, ck- is the genomic DNA of non-transgenic plants of Zhonghua 11, ck+ is the positive control of 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid, and 1-2 are the genomic DNA of transgenic plants obtained by screening.

[0050] Figure 8 GUS staining results of callus, roots and stems of the T0 generation transgenic line of the 1305gusplus-OsSULTR1;3pro-1229 plasmid provided in Experimental Example 1 of the present invention;

[0051] Among them, CK- represents the staining results of the negative control (Zhonghua 11) at each developmental stage, and 1305gusplus-OsSULTR1;3pro represents the staining results of the 1305gusplus-OsSULTR1;3pro-1229 transgenic line. Detailed Implementation

[0052] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0053] Unless otherwise specified, the experimental methods described in the following examples are conventional methods. Unless otherwise specified, the materials and reagents described in the following examples are commercially available.

[0054] Explanation of the sequence list:

[0055] SEQ ID NO.1 (nucleotide sequence of the OsSULTR1;3pro promoter):

[0056]

[0057] SEQ ID NO.2:1305-OsSULTR1;3pro-F

[0058] cctgcaggcatgcaagcttATATTGTTGCCACTAATTTT

[0059] SEQ ID NO.3: 1305-OsSULTR1;3pro-R

[0060] taccctcagatctaccatggATCTGATTACTGAATTAACT

[0061] SEQ ID NO.4: Transgenic expression cassette OsSULTR1;3pro-GUS-nosT

[0062]

[0063] SEQ ID NO.5:1305-OsSULTR1;3pro-test-F

[0064] CTTTCTGATGGTGTACAAGG

[0065] SEQ ID NO.6:1305-OsSULTR1;3pro-test-R

[0066] tttcccgtagtccagcttga

[0067] SEQ ID NO.7:Hn-F

[0068] ATTGCCGTCAACCAAGCTCT

[0069] SEQ ID NO.8:Hn-R

[0070] GACCTGCCTGAAACCGAACT

[0071] SEQ ID NO.9:GUS genetic clone

[0072]

[0073] SEQ ID NO.10: nosT terminator sequence

[0074] gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacg ttatttatgagatgggttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttatactagatc Example 1

[0075] In this embodiment, bioinformatics analysis of the upstream sequence of the OsSULTR1;3 gene was performed using promoter function prediction software such as PlantCARE and PlantPAN. The results showed that the sequence was enriched with various promoter-related core cis-regulatory elements (such as TATA-box, CAAT-box, etc.), suggesting that it possesses typical structural features of plant cell promoters. Simultaneously, PlantPAN analysis showed that the sequence from 1bp to 1229bp was rich in CpG islands, and CpG islands are also an important sequence feature of eukaryotic promoters. Therefore, this invention hypothesizes that this sequence region possesses promoter activity.

[0076] In this embodiment, the upstream sequence of the OsSULTR1;3 gene, 1229 bp, was further extracted for promoter activity identification. Finally, the sequence shown in SEQ ID NO.1 was determined as the promoter sequence and named OsSULTR1;3pro. The OsSULTR1;3pro promoter can drive the gene to be expressed efficiently in rice callus, roots and stems.

[0077] The promoter OsSULTR1;3pro can be amplified using the following primers:

[0078] The amplification primer sequences for the promoter shown in SEQ ID NO.1 are as follows:

[0079] SEQ ID NO.2:

[0080] 5'-cctgcaggcatgcaagcttATATTGTTGCCACTAATTTT-3';

[0081] SEQ ID NO.3:

[0082] 5'-taccctcagatctaccatggATCTGATTACTGAATTAACT-3'. Example 2

[0083] In this embodiment, the promoter OsSULTR1;3pro is constructed into the expression cassette and vector. The specific process is as follows:

[0084] 1. Preparation of plant transgenic expression cassettes containing the promoter OsSULTR1;3pro

[0085] The method for constructing the plant transgenic expression cassette OsSULTR1;3pro-GUS-nosT (sequence as shown in SEQ ID NO.4) of the present invention is as follows:

[0086] Primers 1305-OsSULTR1;3pro-F / 1305-OsSULTR1;3pro-R were designed to amplify the promoter OsSULTR1;3pro-1229 fragment from the rice genome. Primer 1305-OsSULTR1;3pro-F has a 22-nucleotide repeat at its 5' end with the corresponding ligation site in the vector; primer 1305-OsSULTR1;3pro-R has a 20-nucleotide repeat at its 5' end with the corresponding ligation site in the vector, facilitating subsequent recombination and ligation using the ClonExpress II One Step Cloning Kit.

[0087] The primer sequences are as follows:

[0088] 1305-OsSULTR1;3pro-F:5'-cctgcaggcatgcaagcttATATTGTTGCCACTAATTTT-3' (SEQ ID NO.2);

[0089] 1305-OsSULTR1;3pro-R: 5'-taccctcagatctaccatggATCTGATTACTGAATTAACT-3' (SEQ ID NO. 3).

[0090] The PCR amplification reaction system is as follows:

[0091] Table 1 PCR amplification reaction system

[0092]

[0093] The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, 33 cycles; 72℃ extension for 5 min, 4℃ to finish.

[0094] The PCR product amplified by primers 1305-OsSULTR1;3pro-F and 1305-OsSULTR1;3pro-R was the OsSULTR1;3pro-1229 fragment, which was recovered as a 1229bp product by 1.0% agarose gel electrophoresis (results are shown below). Figure 1 (as shown in Figure a).

[0095] 2. Construction of plant genetic transformation vectors

[0096] Using the ClonExpress II One Step Cloning Kit method, the amplification product from step 1 above was inserted into the 1305 gusplus vector (vector pattern shown in [link]). Figure 2 The specific method is as follows: (The HindIII and NcoI double restriction sites are intersected.)

[0097] (1) The vector plasmid 1305gusplus was double-digested with HindIII+NcoI. After agarose gel electrophoresis, a band of about 11 kb was recovered using EZNA® Gel Extraction kit (Omega, the same below) to obtain the linear fragment of 1305gusplus.

[0098] The HindIII+NcoI double enzyme digestion reaction system is as follows:

[0099] Table 2 Enzyme digestion reaction system

[0100]

[0101] Enzyme digestion results as follows Figure 1 As shown.

[0102] (2) The ClonExpress II One Step Cloning Kit was used to ligate the OsSULTR1;3pro-1229 fragment into the 1305 gusplus vector. The ligation system is as follows:

[0103] Table 3 Connection System

[0104]

[0105] Connection procedure: 37℃, 30min.

[0106] (3) Transformation: Take 5 μl of the ligation product from step (2), add it to 50 μl of competent E. coli cells, mix gently, incubate on ice for 30 min; heat shock at 42℃ for 90 s; incubate in an ice-water bath for 3 min; add 900 μl of LB medium, shake at 37℃ and 220 rpm for 20 min, centrifuge at 2000 rpm for 1 min, discard 850 μl of supernatant, mix the remaining cells with the medium, and spread on LB plates containing kanamycin. Incubate at 37℃ for about 14 h, pick single colonies, and perform colony PCR verification using specific primers (1305-OsSULTR1;3pro-test-F and 1305-OsSULTR1;3pro-test-R). Select positive colonies, shake at 37℃ and 220 rpm overnight, extract plasmids using a high-purity plasmid mini-prep kit (Zhongke Ruitai), and confirm the enzyme digestion results (see results below). Figure 3 As shown, M represents the marker, CK1 is the undigested 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid, and 1 is the digested 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid (a fragment of approximately 1229 bp can be extracted). The strain was preserved and sent for sequencing. The resulting vector was named 1305gusplus-OsSULTR1;3pro-1229, and the vector diagram is shown below. Figure 4 .

[0107] Primer sequences:

[0108] 1305-OsSULTR1;3pro-test-F: 5'-CTTTCTGATCGTGTACAAGG-3' (SEQ ID NO.5);

[0109] 1305-OsSULTR1;3pro-test-R: 5'-tttcccgtagtccagcttga-3' (SEQ ID NO. 6). Example 3

[0110] In this embodiment, the OsSULTR1;3pro promoter is transformed into plants to prepare the corresponding transgenic plants. The specific process is as follows:

[0111] 1. Agrobacterium transformation and identification

[0112] Take Agrobacterium EHA105 competent cells stored at -80℃, add 1 μl of the sequenced correctly sequenced 1305gusplus-OsSULTR1;3pro-1229 plasmid obtained in Example 2, and transform by electroporation at 2.5 KV. Spread on YEP culture plates containing kanamycin, rifampin, and streptomycin, and incubate at 28℃ for about 48 hours. Pick single colonies and shake overnight. Verify the bacterial culture using specific primers (1305-OsSULTR1;3pro-test-F / 1305-OsSULTR1;3pro-test-R) (results are shown in Figure 1). Figure 5 As shown, M is the marker, ck+ is the positive control of the 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid, and 1-4 are samples of Agrobacterium monoclonal bacterial suspension transformed with the 1305gusplus-OsSULTR1;3pro-1229 recombinant plasmid (the amplified band size is 600 bp, which is correct). The target fragment of about 600 bp can be amplified. Positive clones (engineered Agrobacterium) are selected, and the bacterial suspension is shaken for 36-48 h and then preserved for infection.

[0113] 2. Agrobacterium-mediated genetic transformation

[0114] (1) Induction: After disinfecting with sodium hypochlorite, the seeds of Zhonghua 11 were placed on induction medium (N6 + 2,4-D 3mg / L + CH 0.6g / L + Pro 0.5g / L + sucrose 30g / L + Phytagel 3 g / L) and cultured in the dark at room temperature at 28℃ for 30-40 days. The induced callus was then subcultured for 30-40 days.

[0115] (2) Screening: The engineered Agrobacterium obtained in step 1 was transformed into the callus obtained in (1) by Agrobacterium-mediated genetic transformation. After co-culturing for 3 days, the callus was washed 5-6 times and transferred to a selection medium containing 50 mg / L hygromycin. The callus was then incubated in the dark at 30°C for 30-50 days. The results are as follows: Figure 6 As shown, callus infected with Agrobacterium 1305gusplus-OsSULTR1;3pro-1229 can be screened to obtain resistant callus;

[0116] (3) Differentiation: The resistant callus obtained by screening was transferred to a differentiation medium containing 50 mg / L hygromycin and positive seedlings were obtained after 25-30 days of differentiation;

[0117] (4) Rooting: Positive seedlings obtained after differentiation were transferred to a rooting medium containing 50 mg / L hygromycin. After 7-15 days of rooting, positive transgenic plants were finally obtained.

[0118] (5) Hardening off and transplanting: Open the bottle cap of the transformed strain with vigorous root growth, add sterile water to cover the culture medium 1-2 cm thick, place it at room temperature to contact with air for hardening off for 2-3 days, and then transplant it to the greenhouse for cultivation.

[0119] 3. Identification of transgenic lines

[0120] To identify whether the lines obtained in step 2 are transgenic lines, this embodiment performs PCR verification on some positive transgenic plants obtained through screening culture, differentiation culture and rooting culture.

[0121] First, extract DNA from the sample. The DNA extraction steps are as follows: Take a rice leaf about 1 cm long and place it in a 2 ml centrifuge tube; add 800 μl of 1.5×CTAB to a mortar and grind the leaf into a homogenate and pour it back into the centrifuge tube; incubate at 65℃ for 20-30 min, inverting and mixing once every 5 min; centrifuge at 12000 rpm for 10 min; transfer 400 μl of supernatant to a new centrifuge tube, add 2 volumes of ice-cold anhydrous ethanol, and incubate at -20℃ for 20 min; centrifuge at 12000 rpm for 10 min; discard the supernatant, add 500 μl of 75% ethanol, invert and rinse, centrifuge at 8000 rpm for 5 min; discard the supernatant, place in a clean bench to air dry or air dry naturally, and add 100 μl of lddH2O to dissolve the DNA.

[0122] The genomic DNA samples of the transgenic line were amplified by PCR using hygromycin primers (Hn-F / Hn-R). This primer pair could not amplify the fragment using the endogenous rice genome as a template, but the fragment size obtained by amplification using transgenic seedlings was 543 bp.

[0123] The primer sequences are as follows:

[0124] Hn-F: 5'-ATTGCCGTCAACCAAGCTCT-3' (SEQ ID NO.7);

[0125] Hn-R: 5'-GACCTGCCTGAAACCGAACT-3' (SEQ ID NO. 8).

[0126] Genomic DNA of Zhonghua 11 was used as a negative control, and water was used as a blank control. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s; 72℃ extension for 5 min; 30-35 cycles; 72℃ further extension for 10 min; 16℃ final temperature.

[0127] The PCR reaction system is as follows:

[0128] Table 4 PCR reaction system

[0129]

[0130] The PCR products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 7 As shown, the results indicate that the transgenic sample contained a 543 bp transgenic band, the same size as the vector control; while the blank control and negative control, Flower 11, could not amplify any bands.

[0131] Experimental Example 1

[0132] This experimental example further analyzes the transgenic lines obtained in Example 3, as follows:

[0133] 1. GUS staining analysis of plant tissues

[0134] Staining analysis was performed using a GUS staining kit (Zhongke Ruitai, catalog number: RTU4032). Rice callus, roots, and stems were all stained. The results are as follows: Figure 8 As shown, Figure 8 The OsSULTR1;3pro-1229 promoter showed high expression of the GUS gene, and the nucleotide sequence of the GUS gene is shown in SEQ ID NO.9.

[0135] 2. Tissue expression analysis in maize

[0136] Using a method similar to that used for rice in Example 3, transgenic maize plants were obtained, and maize callus, roots, and stems were all stained. This demonstrates that the OsSULTR1;3pro-1229 promoter can also drive stable expression of the GUS gene in maize callus, roots, and stems, making it a highly efficient, space- and time-specific promoter.

[0137] 3. Tissue expression analysis in wheat

[0138] Using a method similar to that used for rice in Example 3, transgenic wheat plants were obtained. GUS staining of various tissues revealed that wheat callus, roots, and stems all showed staining. This indicates that the OsSULTR1;3pro-1229 promoter can also drive stable expression of the GUS gene in wheat callus, roots, and stems, making it a highly efficient, space- and time-specific promoter.

[0139] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Use of a promoter OsSULTR1;3pro, characterized in that, The application is to drive the specific expression of an exogenous gene in rice callus, roots and stems; the exogenous gene is the GUS gene; the nucleotide sequence of the promoter OsSULTR1;3pro is shown in SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The promoter OsSULTR1;3pro was amplified using the primer pair shown in SEQ ID NO. 2-3.

3. Use of a biological material related to the promoter OsSULTRl;3pro as described in claim 1, characterized in that, The application is to drive the specific expression of an exogenous gene in rice callus, roots, and stems during the vegetative growth stage; the exogenous gene is the GUS gene. The biomaterial is any one of the following A1) to A3): A1) An expression cassette containing the promoter OsSULTR1;3pro; A2) A recombinant vector containing the promoter OsSULTR1;3pro, or a recombinant vector containing the expression cassette of A1); A3) Recombinant microorganisms containing the promoter OsSULTR1;3pro, or recombinant microorganisms containing the expression cassette of A1), or recombinant microorganisms containing the recombinant vector of A2).