Construction method and application of H11 site humanized ACE2 gene overexpression golden hamster model

By injecting sgRNA targeting the H11 site and humanized ACE2 gene donor DNA into golden hamster embryos using CRISPR-Cas9 technology, an H11-K18-hACE2 model was constructed. This solved the difficulty of simulating the SARS-CoV-2 virus variant BA.5 in mouse models, and enabled efficient virus infection simulation and drug development.

CN122012614APending Publication Date: 2026-05-12NANJING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING MEDICAL UNIV
Filing Date
2026-01-09
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing mouse models are controversial in studying the lethality of the SARS-CoV-2 virus variant BA.5, and have low affinity for the human ACE2 receptor, making it difficult to effectively simulate the human infection mechanism.

Method used

By injecting H11-sgRNA, Cas9 mRNA or Cas9 protein and S7-gH11-PB-K18-hACE2 donor into two-cell embryos of golden hamsters under red light using CRISPR-Cas9 technology, a humanized ACE2 gene overexpression model at the H11 site was constructed to avoid early embryonic developmental arrest, and offspring were obtained through true pregnancy albino recipient embryo transfer.

Benefits of technology

The constructed H11-K18-hACE2 golden hamster model showed increased ACE2 protein expression levels in the lungs, brain, and kidneys, effectively mimicking SARS-CoV-2 infection and aiding in the study of viral infection mechanisms and drug development. The model also exhibited normal reproductive capacity and stable reproductive transmission rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012614A_ABST
    Figure CN122012614A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method and application of an H11 site humanized ACE2 gene overexpression golden hamster model, and belongs to the technical field of genetic engineering animal model construction. According to the method, hormone-induced superovulation female golden hamsters and male endosomes are fertilized to obtain two-cell stage embryos, an exogenic CRISPR-Cas9 gene modified sample is microinjected into a single two-cell stage embryo cleavage bulb, and after culture recovery, the sample is transferred into a real pregnancy replacement receptor body for development. And the construction method of the golden hamster model for overexpressing the ACE2 gene at the H11 site is further obtained. The golden hamster is used as a model background animal, the humanized ACE2 overexpressed golden hamster model is constructed at the H11 site, and the golden hamster model can be used for researching an ACE2 gene mechanism and SARS-CoV-2 infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of life sciences and biotechnology, specifically relating to a method for constructing and applying a golden hamster (H11-K18-hACE2) model with humanized ACE2 gene overexpression at the H11 locus. Background Technology

[0002] The rapid spread and mutation of SARS-CoV-2 have posed significant challenges to public health and medical resources. Utilizing animal models to evaluate new therapies and understand the replication and transmission potential of emerging viral variants is crucial. Mice, a commonly used model animal, have a low affinity for the SARS-CoV-2 spike protein due to their low ACE2 receptor, which presents a limitation in COVID-19-related research. Previous studies replicating the BA.5 mutation dynamics in mouse models yielded conflicting results and have been subject to some controversy, with two hypotheses emerging: one suggesting the potential lethality of BA.5, and the other suggesting its non-lethality. Compared to mice, golden hamsters exhibit high homology with humans at key binding sites between the ACE2 receptor and SARS-CoV-2, making them susceptible to SARS-CoV-2. Therefore, developing a novel golden hamster model is of great significance for research into the SARS-CoV-2 infection mechanism and drug development. Summary of the Invention

[0003] In response to the technical problems raised in the background art, the present invention provides a method for constructing and applying a golden hamster (H11-K18-hACE2) model in which the humanized ACE2 gene is overexpressed at the H11 locus.

[0004] This invention utilizes CRISPR-Cas9 technology, under a red-light chamber with a red filter, to construct a golden hamster model overexpressing the humanized ACE2 gene at the H11 locus by injecting H11-sgRNA, Cas9 mRNA (or Cas9 protein), and an S7-gH11-PB-K18-hACE2 donor into two-cell embryos, thus avoiding early embryonic developmental arrest. The constructed embryos were then used to simulate and study SARS-CoV-2 infection through the transfer of albino recipient embryos.

[0005] The objective of this invention is achieved through the following technical methods:

[0006] In a first aspect, the present invention claims protection for a method for constructing a golden hamster model with humanized ACE2 gene overexpression at the H11 site (H11-K18-hACE2), the method comprising: injecting H11-sgRNA targeting the H11 site, Cas9 functional elements and S7-gH11-PB-K18-hACE2 donor into a two-cell embryo of a golden hamster under a red light source, and then transplanting the embryo into a recipient to obtain a golden hamster model with humanized ACE2 gene overexpression at the H11 site;

[0007] The target sequence of the H11-sgRNA is shown in SEQ ID NO:1; the Cas9 functional element is Cas9 mRNA or Cas9 protein.

[0008] H11-sgRNA: GTGCATGATCCATACCAAATAGG (SEQ ID NO: 1).

[0009] Furthermore, the construction method includes the following steps:

[0010] (1) Design and prepare H11-sgRNA targeting the H11 site and donor DNA containing humanized ACE2 gene S7-gH11-PB-K18-hACE2 donor;

[0011] (2) Under a red light source, the H11-sgRNA, Cas9 functional element and S7-gH11-PB-K18-hACE2 donor were injected together into the cytoplasm or nucleus of two-cell embryos of golden hamsters.

[0012] (3) The injected embryos were transplanted into the recipient female mouse to obtain F0 generation hamsters, and PCR identification and sequencing were performed.

[0013] (4) Cross F0 generation hamsters with wild-type hamsters to obtain F1 generation hamsters, and perform PCR identification and sequencing;

[0014] (5) Cross F1 generation heterozygous hamsters to obtain F2 generation hamsters. After PCR identification and sequencing, stable homozygotes were obtained, which are the golden hamster model with humanized ACE2 gene overexpression at H11 site.

[0015] Furthermore, the method for preparing the H11-sgRNA targeting the H11 site is as follows: annealing oligonucleotide pairs specifically targeting the H11 site to form double-stranded DNA, ligating them into an enzyme-digested linearized CRISPR backbone vector to construct a recombinant plasmid, and then transcribing it in vitro to synthesize H11-sgRNA; the oligonucleotide pairs include gH11-sg1F with the nucleotide sequence shown in SEQ ID NO: 2 and gH11-sg1R with the nucleotide sequence shown in SEQ ID NO: 3.

[0016] gH11-sg1F: TAGGTGCATGATCCATACCAAAT (SEQ ID NO: 2)

[0017] gH11-sg1R:AAACATTTGGTATGGATCATGCA (SEQ ID NO: 3).

[0018] Furthermore, the CRISPR backbone vector is the PUC57-sgRNA-EGFP-CRISP9 plasmid; the construction method of the PUC57-sgRNA-EGFP-CRISP9 plasmid is as follows:

[0019] (1) Obtaining the PUC57 vector backbone: PUC57 was digested with NotI / XhoI to obtain a 2608bp fragment as the backbone PUC57-NX;

[0020] (2) Preparation of sgRNA-EGFP: The sgRNA-EGFP sequence shown in SEQ ID NO:10 was synthesized and then digested with NotI / XhoI enzymes to obtain the sgRNA-EGFP fragment;

[0021] (3) Obtaining the PUC57-sgRNA-EGFP-CRISP9 plasmid: Homologous recombination of PUC57-NX and sgRNA-EGFP fragments to construct the PUC57-sgRNA-EGFP-CRISP9 plasmid.

[0022] Furthermore, the specific process for preparing the H11-sgRNA targeting the H11 site includes the following steps:

[0023] (11) Linearization of CRISPR backbone vector: The PUC57-sgRNA-EGFP-CRISP9 plasmid was digested with BsaI restriction endonuclease, and the linearized vector backbone PUC57-CRISP9-B1 was obtained by separation and purification by agarose gel electrophoresis.

[0024] (12) Oligonucleotide pair annealing: Two complementary oligonucleotide pairs, gH11-sg1F and gH11-sg1R, are annealed under the action of T4 PNK kinase to form a double-stranded DNA fragment.

[0025] (13) Ligation and verification: The double-stranded DNA fragment formed by annealing was ligated with the linearized vector backbone PUC57-CRISP9-B1 using T4 ligase. After identification and sequencing verification, the correct recombinant plasmid PUC57-H11-sg1 was obtained.

[0026] (14) In vitro transcription synthesis of H11-sgRNA: The sgRNA expression cassette was amplified by PCR from the recombinant plasmid PUC57-H11-sg1 using U6-F1 and SG-T7R primers, and then purified and synthesized into H11-sgRNA by the T7 in vitro transcription system.

[0027] The nucleotide sequences of the U6-F1 and SG-T7R primers are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

[0028] U6-F1: TACGATACAAGGCTGTTAGAGAG (SEQ ID NO:4)

[0029] SG-T7R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5).

[0030] Furthermore, the annealing temperature program is as follows: 37°C for 30 minutes, 95°C for 5 minutes, -6°C / Min to 25°C.

[0031] Furthermore, the S7-gH11-PB-K18-hACE2 donor is donor DNA containing the humanized ACE2 gene, and the preparation method of the S7-gH11-PB-K18-hACE2 donor is as follows:

[0032] (1) Obtaining the vector backbone: pCA-mTmG was digested with restriction endonuclease KpnI / SacI to obtain the target vector fragment S7-KS1 of 2856 bp;

[0033] (2) Obtaining the homologous recombination fragments of H1Left and H2Right: The left and right homologous recombination arms H1Left and H2Right were amplified using primers gH11-H1F / gH11-H1R and gH11-H2F / gH11-H2R, respectively; the nucleotide sequences of the primers gH11-H1F, gH11-H1R, gH11-H2F, and gH11-H2R are shown in SEQ ID NO:11-14, respectively.

[0034] gH11-H1F: AGGGCGAATTGGGTGCATGATCCATACCAAATAGGAAGAGGCCTTGAG

[0035] TCCATCATTC (SEQ ID NO:11)

[0036] gH11-H1R: CTGCTCCATCACGCTTCGTATGGATCATGCACATCTT (SEQ ID NO: 12)

[0037] gH11-H2F: GCCCGTGCCTTTTCCAGGGTTTCAGGTTAAACTCT (SEQ ID NO: 13)

[0038] gH11-H2R: AACAAAAGCTGGCTGCATGATCCATACCAAATAGGTCTAGAGTTGC

[0039] TTTTTCAACGAAACATGG (SEQ ID NO:14).

[0040] (3) Obtaining the PB fragment: Synthesize the PB fragment as shown in SEQ ID NO:15;

[0041] (4) Obtaining the S7-gH11-PB-mcs plasmid: Homologous recombination was performed on four DNA fragments: S7-KS1, H1Left, H2Right and PB fragment, to construct the H11 multiple cloning site vector, named S7-gH11-PB-mcs plasmid.

[0042] (5) The S7-gH11-PB-mcs plasmid was digested with restriction endonucleases Not I / Sal I to obtain a 5756 bp target vector fragment as the vector backbone, named S7-gH11-PB-NS.

[0043] (6) Obtaining the K18-hACE2 fragment: The pK18-hACE2 plasmid was digested with HapI and SalI to obtain a 6823bp fragment of K18-hACE2;

[0044] (7) Obtaining the S7-gH11-PB-K18-hACE2 donor plasmid: Homologous recombination of the S7-gH11-PB-NS and K18-hACE2 fragments was performed to construct the S7-gH11-PB-K18-hACE2 donor plasmid.

[0045] Furthermore, the specific primer pairs for PCR identification include: gH11-TF1, gH11-TR1, hACE2-TF1, and hACE2-TR1; the nucleotide sequence of gH11-TF1 is shown in SEQ ID NO:6, the nucleotide sequence of gH11-TR1 is shown in SEQ ID NO:7, the nucleotide sequence of hACE2-TF1 is shown in SEQ ID NO:8, and the nucleotide sequence of hACE2-TR1 is shown in SEQ ID NO:9.

[0046] gH11-TF1: GCCAGCTCAGCCCTTTCTGTTTA (SEQ ID NO: 6)

[0047] gH11-TR1: CTGTCCTTGAACTTACTCTGTAGCC (SEQ ID NO:7)

[0048] hACE2-TF1: GGGTAGATGGCTATGACTACAGC (SEQ ID NO:8)

[0049] hACE2-TR1: CAGACTGCTTTCTGAACATTTCCT (SEQ ID NO:9).

[0050] In the technical solution of this invention, all golden hamsters are kept in SPF-grade and equivalent breeding environments.

[0051] In the technical solution of this invention, all experiments were conducted at room temperature (28.5℃) under red light.

[0052] In the technical solution of this invention, all golden hamsters that provide embryos are induced to ovulate superovulate by intraperitoneal injection of pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) and then mated with male hamsters in a 1:1 cage.

[0053] In the technical solution of this invention, before and after the two-cell embryo transfer, the embryo culture medium is placed in an incubator, and the culture conditions are: temperature 37.5℃, carbon dioxide content 10%, oxygen concentration 5%, and nitrogen concentration 85%.

[0054] In the technical solution of this invention, humanized ACE2 is overexpressed in the intergenic region between Eif4enif1 and Drg1 at the H11 locus of golden hamsters.

[0055] As a specific implementation method, the method for constructing the golden hamster (H11-K18-hACE2) model with humanized ACE2 gene overexpression at the H11 site according to the present invention specifically includes the following steps:

[0056] (1) Design and prepare H11-sgRNA targeting the H11 site and donor DNA containing humanized ACE2 gene S7-gH11-PB-K18-hACE2 donor;

[0057] The target site of the gene to be knocked out in golden hamsters was identified, and sgRNA targeting the H11 integration site and oligonucleotide pairs specifically targeting the H11 site were designed. The target sequence of the sgRNA is shown in SEQ ID NO:1. The oligonucleotide pairs include H11-sg1F with the nucleotide sequence shown in SEQ ID NO:2 and gH11-sg1R with the nucleotide sequence shown in SEQ ID NO:3. The oligonucleotide pairs specifically targeting the H11 site were annealed to form double-stranded DNA, ligated into a CRISPR backbone vector that had been linearized by enzyme digestion to construct a recombinant plasmid, and then H11-sgRNA was synthesized via in vitro transcription.

[0058] The specific process for preparing the H11-sgRNA targeting the H11 site includes the following steps:

[0059] (11) Linearization of CRISPR backbone vector: The PUC57-CRISP9-sgRNA-GFP plasmid was digested with BsaI restriction endonuclease, and the linearized vector backbone PUC57-CRISP9-B1 was obtained by separation and purification by 10% agarose gel electrophoresis.

[0060] (12) Oligonucleotide pair annealing: Two complementary oligonucleotide pairs, gH11-sg1F and gH11-sg1R, were annealed under the action of T4 PNK kinase to form a double-stranded DNA fragment; 10 μl reaction system: 1 μl 100 μM gH11-sg1F, 1 μl 100 μM gH11-sg1R, in 10 U T4 PNK (NEB) reaction solution (total volume 10 μl); The annealing temperature program was: 37℃ for 30 minutes, 95℃ for 5 minutes, -6℃ / Min to 25℃.

[0061] (13) Ligation and verification: The double-stranded DNA fragment formed by annealing was ligated with the linearized vector backbone PUC57-CRISP9-B1 using T4 ligase. After identification and sequencing verification, the correct recombinant plasmid PUC57-H11-sg1 was obtained.

[0062] (14) In vitro transcription synthesis of H11-sgRNA: The sgRNA expression cassette was amplified by PCR from the recombinant plasmid PUC57-H11-sg1 using U6-F1 and SG-T7R primers, and then purified and synthesized into H11-sgRNA using the T7 in vitro transcription system.

[0063] The nucleotide sequences of the U6-F1 and SG-T7R primers are shown in SEQ ID NO:4-5.

[0064] (2) Donor preparation: Select 6-8 week old golden female mice. At 9:00 AM on the first day of estrus, inject pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) intraperitoneally to induce superovulation. At 6:00 PM on the fourth day, mate with male mice in a 1:1 ratio. At 9:00 AM on the second day, examine vaginal secretions under a microscope for sperm. The presence of sperm indicates mating.

[0065] (3) Recipient preparation: Eight-week-old golden female mice were selected and mated with male mice in a 1:1 ratio at 6 pm on the fourth day of estrus. At 9 am on the second day, the vaginal secretions were examined under a microscope for sperm. The presence of sperm indicated that the recipient was a 0.5-day true pregnancy recipient.

[0066] (4) Embryo Acquisition: Golden hamster fertilized eggs are sensitive to pH, temperature and light. All experiments were performed at room temperature (28.5℃) under red light. After mating, the female mice were anesthetized by intraperitoneal injection of 1.25% aphthylamine (1.8 ml / 100 g), and the donor female mice were euthanized by cervical dislocation. The oviduct was removed from the abdomen and placed in a culture droplet. Under a stereomicroscope, the ampulla of the oviduct was torn open with ophthalmic forceps to release the cell cluster. Two-cell embryos with uniform blastomeres were selected and transferred to embryo culture medium for temporary storage. The in vitro embryo acquisition process was completed within 30 minutes.

[0067] (5) Embryo injection: 20 ng / μl H11-sgRNA, 50 ng / μl S7-gH11-PB-K18-hACE2 donor and 50 ng / μl cas9 mRNA PN were injected into the cytoplasm of two-cell embryos through a micromanipulation system. After injection, the embryos were cultured in a three-gas incubator at 37.5℃, 10% carbon dioxide, 5% oxygen and 85% nitrogen.

[0068] (6) Embryo transfer: 1.25% aphrodisiac recipient female mice, after making an incision in the middle of the back skin, open the abdominal wall muscle layer between the abdominal ribs and iliac bone, use forceps to remove the fat pad and pull out one side of the ovary and fallopian tube, and aspirate 14-20 embryos for use. Under a stereomicroscope, use ophthalmic forceps to longitudinally tear the ampulla and fimbriae of the fallopian tube, and blow the embryo into the ampulla of the fallopian tube through the transfer tube.

[0069] (7) A method for constructing the H11-K18-hACE2 gene knock-in golden hamster model, comprising: constructing the H11-K18-hACE2 humanized knock-in golden hamster model by microinjection using H11-sgRNA, S7-gH11-PB-K18-hACE2 donor and cas9 mRNA. The H11-K18-hACE2 humanized ACE2 gene knock-in golden hamster model overexpresses humanized ACE2 in the intergenic region between Eif4enif1 and Drg1.

[0070] (8) Breeding and screening of the H11-K18-hACE2 humanized ACE2 gene knock-in golden hamster model, which includes: ① injecting donor DNA containing Cas9 mRNA or Cas9 protein, sgRNA and humanized ACE2 gene into golden hamster fertilized eggs and then transplanting them into surrogates to obtain F0 generation golden hamsters, and screening the positive golden hamsters among them as the F0 generation golden hamsters; ② screening the offspring obtained by crossing F0 generation golden hamsters with wild-type golden hamsters, and taking the positive golden hamsters among them as the F1 generation golden hamsters; ③ screening the offspring obtained by self-breeding of F1 generation golden hamsters, and taking the positive golden hamsters among them as the F2 generation golden hamsters; the screening methods for positive golden hamsters include PCR identification and gene sequencing. In one embodiment, the specific primer pairs used for PCR identification and gene sequencing include: gH11-TF1, gH11-TR1, hACE2-TF1, and hACE2-TR1; the nucleotide sequences of gH11-TF1, gH11-TR1, hACE2-TF1, and hACE2-TR1 are shown in SEQ ID NO:6-9. SEQ ID NO:6 / SEQ ID NO:7 is used to identify wild-type golden hamsters, and SEQ ID NO:8 / SEQ ID NO:9 is used to identify hACE2 insertion. Genotyping is shown in Table 1 below.

[0071] Table 1. Genotype Determination

[0072] Primers Product size Heterozygote homozygote wild type SEQ ID NO:6 / SEQ ID NO:7 431 + - + SEQ ID NO:8 / SEQ ID NO:9 400 + + -

[0073] This invention protects a modeling method for producing H11-K18-hACE2 gene-modified golden hamsters by genetically modifying fertilized eggs or two-cell embryos and then transplanting them into surrogate mother mice for development.

[0074] Secondly, the present invention seeks protection for the application of the golden hamster (H11-K18-hACE2) model with humanized ACE2 gene overexpression at the H11 site constructed by the above method in at least one of the following (1)-(5):

[0075] (1) To study the related functions and mechanisms of action of the ACE2 gene;

[0076] (2) To study the infection mechanism of SARS-CoV-2 virus;

[0077] (3) Evaluation of novel pathogenic strains of SARS-CoV-2;

[0078] (4) Screening for drugs to treat SARS-CoV-2 virus infection;

[0079] (5) Develop vaccines to prevent SARS-CoV-2 virus infection.

[0080] The offspring of H11-K18-hACE2 heterozygotes and homozygotes obtained using the method of this invention followed the expected Mendelian inheritance ratios, exhibiting normal health and reproductive capacity. Western blot analysis revealed increased ACE2 protein expression levels in the lungs, brain, and kidneys of the humanized golden hamster model compared to the wild type. This indicates that the humanized golden hamster model is suitable for studying various diseases and mechanisms of action related to these organs, such as viral infections, respiratory diseases, and neurological disorders. Therefore, the successful construction of the H11-K18-hACE2 gene-modified golden hamster model is confirmed.

[0081] The H11 locus is located between the Eif4enif1 and Drg1 genes. Because it lies between these two genes, exogenous genes can be expressed efficiently at this locus, offering higher safety than random insertions and exhibiting no gene silencing effect. Therefore, constructing a golden hamster model of humanized ACE2 gene overexpression at the H11 locus is of great significance for understanding the ACE2 gene mechanism, the SARS-CoV-2 infection mechanism, and drug development.

[0082] The advantages of the H11-K18-hACE2 gene-modified golden hamster model constructed in this invention are:

[0083] (1) The method for constructing the H11-K18-hACE2 gene-modified golden hamster model of the present invention is efficient and the modeling reproductive transmission rate is stable. The offspring of H11-K18-hACE2 gene-modified golden hamsters are obtained by transplanting gene-modified two-cell embryos through true pregnancy recipient transplantation, and the heterozygote fertility is normal.

[0084] (2) The H11-K18-hACE2 gene-modified golden hamster model of the present invention shows increased ACE2 protein expression levels in the lungs, brain, and kidneys. Therefore, the present invention provides an important method for constructing a golden hamster model to explore the use of humanized ACE2 gene-modified golden hamster models for studying various diseases and mechanisms of action related to these organs.

[0085] (3) The disease progression caused by H11-K18-hACE2 golden hamster SARS-CoV-2 infection constructed based on the present invention is very similar to that observed in human COVID-19 cases, which is helpful for the study of the mechanism and drugs of severe COVID-19 infection. Attached Figure Description

[0086] Figure 1 This is a schematic diagram illustrating the construction of the H11-K18-hACE2 gene-modified golden hamster model in an embodiment of the present invention.

[0087] The H11 locus in golden hamsters is located in the intergenic region between the Eif4enif1 and Drg1 genes. By injecting two-cell embryos with the CRISPR-Cas9 system, K18-hACE2 was inserted between the target sequences using H11 sgRNA and the H11-K18-hACE2 donor plasmid.

[0088] Figure 2 In the H11-K18-hACE2 gene-modified golden hamster model of this invention, the expression level of ACE2 protein in the lungs, brain and kidneys was increased.

[0089] Western blot analysis showed that, compared with the wild-type (WT) model, the humanized golden hamster model exhibited significantly increased ACE2 protein expression levels in the lungs, brain, and kidneys. This finding suggests that the model is more suitable for studying diseases and pathological states associated with these organs, such as viral infections, respiratory diseases, and neurological disorders. The increased expression levels in these tissues are expected to provide important evidence for a deeper understanding of the underlying mechanisms and the development of targeted therapeutic strategies.

[0090] Figure 3 This is a curve showing the weight change of a golden hamster model modified with the H11-K18-hACE2 gene after SARS-CoV-2 (BA.5) infection, as described in this embodiment of the invention.

[0091] After H11-K18-hACE2 gene-modified golden hamsters were intranasally inoculated with the BA.5 mutant strain, a significant decrease in body weight was observed as early as day 2 post-infection (dpi), with the lowest body weight observed on day 4.

[0092] Figure 4 This invention relates to the H11-K18-hACE2 gene-modified golden hamster model and its mortality rate after SARS-CoV-2 (BA.5) infection.

[0093] After H11-K18-hACE2 gene-modified golden hamsters were intranasally inoculated with the BA.5 mutant strain, 50% of the hamsters were infected.

[0094] The remaining animals died on day 4 (dpi), while the rest died on day 5. This result indicates that BA.5 still has a high lethality.

[0095] Figure 5 Pathological results of lung tissue from infected hamsters.

[0096] Histopathological analysis was performed on the lung and brain tissues of BA.5H11-K18-hACE2 infected hamsters, with comparable samples from healthy rodents serving as negative controls. On day 3 post-infection (3 dpi), mild changes were observed in the lung tissue of H11-K18-hACE2 hamsters, including multifocal lesions, partial alveolar wall thickening with a small amount of fibrin exudation. By day 5-6 (5-6 dpi), the H11-K18-hACE2 hamsters exhibited fibrosis, partial obstruction of terminal bronchioles, and alveolar cell lysis and necrosis, ultimately leading to death. Detailed Implementation

[0097] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make equivalent changes to the disclosed technical content to create equivalent embodiments. Any modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the present invention fall within the protection scope of the present invention.

[0098] Example 1: Construction of PUC57-sgRNA-EGFP-CRISP9 plasmid

[0099] (1) Obtaining the PUC57 vector backbone: PUC57 was digested with NotI / XhoI enzymes and a 2608bp fragment was obtained by agarose electrophoresis, which was used as the backbone PUC57-NX.

[0100] (2) Preparation of sgRNA-EGFP: The sgRNA-EGFP sequence was synthesized (as shown in SEQ ID NO:10, Nanjing GenScript), and then digested with NotI / XhoI enzymes and obtained by agarose electrophoresis.

[0101] (3) Obtaining the PUC57-sgRNA-EGFP-CRISP9 plasmid: Using the Novizan Recombinant Recombination Kit (ClonExpress Ultra One Step Cloning Kit, C115-01), homologous recombination was performed using the PUC57-NX and sgRNA-EGFP fragments according to the instructions to construct the PUC57-sgRNA-EGFP-CRISP9 plasmid. M13 / M13R PCR identification and sequencing verification were performed.

[0102] M13R: CAGGAAACAGCTATGACC; M13F: TGTAAAACGACGGCCAGT.

[0103] Example 2: Design and preparation of donor DNA containing the humanized ACE2 gene S7-gH11-PB-K18-hACE2donor

[0104] Homologous recombination arms were constructed using the double sgRNA method:

[0105] (1) Obtaining the vector backbone: pCA-mTmG (addgene:Plasmid#26123) was digested with restriction endonuclease KpnI / SacI to produce two fragments of 2856 bp and 5716 bp. The target vector fragment S7-KS1 with a size of approximately 2856 bp was separated and purified by gel electrophoresis for later use.

[0106] (2) Obtaining the homologous recombination fragments H1Left and H2Right: Homologous arm primers were designed based on the golden hamster genome sequence, and sgRNA was added to both sides of the primers to obtain high homologous recombination efficiency during injection.

[0107] The left and right homologous recombination arms (H1Left, H2Right) were amplified using primers gH11-H1F / gH11-H1R and gH11-H2F / gH11-H2R, respectively. The products were purified by gel excision and used as templates for the homologous recombination arms. The nucleotide sequences of the primers gH11-H1F, gH11-H1R, gH11-H2F, and gH11-H2R are shown in SEQ ID NO:11-14, respectively.

[0108] gH11-H1F: AGGGCGAATTGGGTGCATGATCCATACCAAATAGGAAGAGGCCTTGAG

[0109] TCCATCATTC (SEQ ID NO:11)

[0110] gH11-H1R: CTGCTCCATCACGCTTCGTATGGATCATGCACATCTT (SEQ ID NO: 12)

[0111] gH11-H2F: GCCCGTGCCTTTTCCAGGGTTTCAGGTTAAACTCT (SEQ ID NO: 13)

[0112] gH11-H2R: AACAAAAGCTGGCTGCATGATCCATACCAAATAGGTCTAGAGTTGC

[0113] TTTTTCAACGAAACATGG (SEQ ID NO:14).

[0114] (3) Obtaining the PB fragment: The PB fragment shown in SEQ ID NO:15, with a size of 746 bp, was directly synthesized at Nanjing Genscript Biotech Co., Ltd. This sequence contains the PiggyBAC transposon sequences PB3 and PB5. The DNA sequence can be directly inserted into the genomic sequence using the PiggyBAC transposase. NotI / SalI restriction sites were added between PB3 and PB5.

[0115] (4) Obtaining the S7-gH11-PB-mcs plasmid: Using the Novozymes recombinant recombinant kit (ClonExpress UltraOne Step Cloning Kit, C115-01), according to the instructions, homologous recombination was performed using the vector fragments S7-KS1, H1Left, H2Right and PB4 to construct the H11 multiple cloning site vector, named S7-gH11-PB-mcs plasmid.

[0116] The recombinant product was transformed into DH5α competent Escherichia coli cells, and screening was performed using Amp+ (ampicillin resistance). Only colonies that were successfully transformed with the plasmid were able to grow.

[0117] Positive clone identification: Single colonies were picked and cultured. After plasmid extraction, PCR amplification was performed using universal primers gH11-H1F / gH11-H1R (SEQ ID NO:11 and SEQ ID NO:12). Sequencing was performed using gH11-TF1, gH11-TR1, and M13F / M13R to verify the correctness of the inserted sequence.

[0118] gH11-TF1: GCCAGCTCAGCCCTTTCTGTTTA (SEQ ID NO: 6)

[0119] gH11-TR1: CTGTCCTTGAACTTACTCTGTAGCC (SEQ ID NO:7).

[0120] (5) The S7-gH11-PB-mcs plasmid was digested with restriction endonucleases Not I / Sal I. The single fragment was purified by gel electrophoresis and used as the vector backbone, named S7-gH11-PB-NS.

[0121] (6) Obtaining the K18-hACE2 fragment: The pK18-hACE2 (addgene Plasmid #149449) plasmid was digested with HapI and SalI, with sizes of 2706bp and 6823bp. The fragment of approximately 6823bp was separated and purified by gel electrophoresis to obtain K18-hACE2.

[0122] (7) Obtaining the S7-gH11-PB-K18-hACE2 donor plasmid: Using the Novozymes recombinant kit (ClonExpress Ultra One Step Cloning Kit, C115-01), according to the instructions, homologous recombination of the S7-gH11-PB-NS and K18-hACE2 fragments was performed to construct the S7-gH11-PB-K18-hACE2 donor plasmid.

[0123] The recombinant product was transformed into DH5α competent Escherichia coli cells, and screening was performed using Amp+ (ampicillin resistance). Only colonies that were successfully transformed with the plasmid were able to grow.

[0124] Positive clone identification: Single colonies were picked and cultured. After plasmid extraction, PCR amplification was performed using hACE2-TF / hACE2-TF primers for verification. Sequencing with gH11-TF1 and gH11-TR1 was used to verify the correctness of the inserted sequence. The correct plasmid was used for microinjection homologous targeting.

[0125] hACE2-TF1: GGGTAGATGGCTATGACTACAGC (SEQ ID NO:8)

[0126] hACE2-TR1: CAGACTGCTTTCTGAACATTTCCT (SEQ ID NO:9).

[0127] Example 3: Design and preparation of H11-sgRNA targeting the H11 site

[0128] The H11 site (NW_024429190.1, 12979687-12885774) is located between the Eif4enif1 and Drg1 genes. Because it is situated between these two genes, exogenous genes expressed at this site are highly efficient, offering greater safety than random insertion and exhibiting no gene silencing effect. By injecting a two-cell embryo into a CRISPR-Cas9 system, using H11-sgRNA and the H11-K18-hACE2 donor plasmid, K18-hACE2 is inserted between the target sequences (e.g., ...). Figure 1 (As shown).

[0129] The genomic target sequence recognized by H11-sgRNA was selected, as shown in SEQ ID NO:1. Oligonucleotide pairs (H11-sg1F and gH11-sg1R) specifically targeting the H11 site were designed to prepare H11-sgRNA.

[0130] H11-sgRNA target sequence: GTGCATGATCCATACCAAATAGG (SEQ ID NO:1).

[0131] gH11-sg1F: TAGGTGCATGATCCATACCAAAT (SEQ ID NO: 2)

[0132] gH11-sg1R:AAACATTTGGTATGGATCATGCA (SEQ ID NO: 3).

[0133] The following steps were used to prepare H11-sgRNA targeting the H11 site:

[0134] (11) Linearization of CRISPR backbone vector: The PUC57-sgRNA-EGFP-CRISP9 plasmid constructed in Example 1 was digested with BsaI restriction endonuclease, and the linearized vector backbone PUC57-CRISP9-B1 was obtained by separation and purification by 1% agarose gel electrophoresis.

[0135] (12) Oligonucleotide pair annealing: Two complementary oligonucleotide pairs, gH11-sg1F and gH11-sg1R, are annealed under the action of T4 PNK kinase to form a double-stranded DNA fragment.

[0136] Reaction system: 1 μl of 100 μM gH11-sg1F and 1 μl of 100 μM gH11-sg1R in 10 U T4 PNK(NEB) reaction solution (total volume 10 μl). Annealing temperature program: 37℃ for 30 min, 95℃ for 5 min, -6℃ / min to 25℃.

[0137] (13) Ligation and verification: 1 μl of the annealed double-stranded DNA fragment was ligated with 50 ng of the linearized vector backbone PUC57-CRISP9-B1 using T4 ligase. After identification and sequencing verification, the correct recombinant plasmid PUC57-H11-sg1 was obtained.

[0138] (14) In vitro transcription synthesis of H11-sgRNA: The sgRNA expression cassette was amplified by PCR from the recombinant plasmid PUC57-H11-sg1 using U6-F1 and SG-T7R primers. The reaction mixture consisted of 10 pmol U6-F1, 10 pmol SG-T7R, 25 μl 2×taq enzyme buffer, 0.5 U Tag enzyme, and water to a final volume of 50 μl. The PCR product was purified by gel extraction.

[0139] The purified product was used to synthesize H11-sgRNA using the HiScribe T7 in vitro transcription kit (NEB, E2040S);

[0140] U6-F1: TACGATACAAGGCTGTTAGAGAG (SEQ ID NO:4)

[0141] SG-T7R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5).

[0142] Example 4: Construction of a golden hamster model with humanized ACE2 gene overexpression at the H11 locus (H11-K18-hACE2)

[0143] The specific steps for constructing the method are as follows:

[0144] (1) The donor DNA S7-gH11-PB-K18-hACE2donor of the humanized ACE2 gene prepared in Example 2; and the H11-sgRNA targeting the H11 site prepared in Example 3.

[0145] (2) Donor preparation: Select 6-8 week old golden female mice. At 9:00 AM on the first day of estrus, inject pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) intraperitoneally to induce superovulation. At 6:00 PM on the fourth day, mate with male mice in a 1:1 ratio. At 9:00 AM on the second day, examine vaginal secretions under a microscope for sperm. The presence of sperm indicates mating.

[0146] (3) Recipient preparation: Eight-week-old golden female mice were selected and mated with male mice in a 1:1 ratio at 6 pm on the fourth day of estrus. At 9 am on the second day, the vaginal secretions were examined under a microscope for sperm. The presence of sperm indicated that the recipient was a 0.5-day true pregnancy recipient.

[0147] (4) Embryo Acquisition: Golden hamster fertilized eggs are sensitive to pH, temperature and light. All experiments were performed at room temperature of 28.5 degrees Celsius under red light. After mating, the female mice were anesthetized by intraperitoneal injection of 1.25% aphthylamine (1.8 ml / 100 g), and the donor female mice were euthanized by cervical dislocation. The oviduct was removed from the abdomen and placed in a culture droplet. Under a stereomicroscope, the ampulla of the oviduct was torn open with ophthalmic forceps to release the cell cluster. Two-cell embryos with uniform blastomeres were selected for use. The in vitro operation was completed within 30 minutes.

[0148] (5) Embryo injection: 20 ng / μl H11-sgRNA, 50 ng / μl S7-gH11-PB-K18-hACE2 donor and 50 ng / μl cas9 mRNA PN were injected into the cytoplasm of two-cell embryos through a micromanipulation system. After injection, the embryos were cultured in a three-gas incubator at 37.5℃, 10% carbon dioxide, 5% oxygen and 85% nitrogen.

[0149] (6) Embryo transfer: 1.25% aphrodisiac recipient female mice were anesthetized. After making an incision in the middle of the back skin, the abdominal wall muscle layer was opened between the abdominal ribs and iliac bone. The fat pad was removed by forceps and one ovary and fallopian tube were pulled out. 14-20 embryos were aspirated for use. Under a stereomicroscope, ophthalmic forceps were used to longitudinally tear the ampulla and fimbriae of the fallopian tube. The embryo was blown into the ampulla of the fallopian tube through the transfer tube.

[0150] (7) The identification primers are a combination of genome identification primers and humanized ACE2 identification primers; F0 generation positive heterozygous golden hamsters are selected by sequencing and mated with wild-type golden hamsters to obtain F1 generation golden hamsters. F2 generation golden hamsters are obtained by hybridization among F1 generation heterozygous golden hamsters. The obtained F2 generation golden hamsters are identified by PCR and sequenced to obtain homozygotes. Sequencing results show that hACE2 accurately inserts into the H11 integration site, and the promoter is K18. The short-chain screening and identification primer pairs include:

[0151] gH11-TF1: GCCAGCTCAGCCCTTTCTGTTTA (SEQ ID NO: 6)

[0152] gH11-TR1: CTGTCCTTGAACTTACTCTGTAGCC (SEQ ID NO:7)

[0153] hACE2-TF1: GGGTAGATGGCTATGACTACAGC (SEQ ID NO:8)

[0154] hACE2-TR1: CAGACTGCTTTCTGAACATTTCCT (SEQ ID NO:9).

[0155] (8) Comparative experiment: The experiment was divided into basic phenotype and SARS-CoV-2 infection.

[0156] ① Fertility of H11-K18-hACE2 was tested by mating male and female golden hamsters with wild-type (WT) hamsters to confirm normal fertility.

[0157] ② Western blot analysis showed that H11-K18-hACE2 golden hamsters exhibited increased ACE2 protein expression levels in the lungs, brain, and kidneys, with GAPDH used as a loading control.

[0158] like Figure 2 As shown in the figure, Western blot analysis revealed significantly increased ACE2 protein expression levels in the lungs, brain, and kidneys of the humanized golden hamster model compared to the wild-type (WT) model. This finding suggests that the model is more suitable for studying diseases and pathological states associated with these organs, such as viral infections, respiratory diseases, and neurological disorders. The increased expression levels in these tissues are expected to provide important evidence for a deeper understanding of the underlying mechanisms and the development of targeted therapeutic strategies.

[0159] ③ Intranasally inoculate H11-K18-hACE2 golden hamsters with 50 μl of BA.5 or PBS (simulated) containing 10⁴ PFU. Monitor body weight and survival rate daily for 6 days (n=4). Results showed that all H11-K18-hACE2 golden hamsters infected with BA.5 died on days 4-5.

[0160] like Figure 3 As shown, after H11-K18-hACE2 gene-modified golden hamsters were intranasally inoculated with the BA.5 mutant strain, a significant decrease in body weight was observed on day 2 post-infection (dpi), with the lowest body weight on day 4.

[0161] like Figure 4 As shown, after intranasal inoculation of H11-K18-hACE2-modified golden hamsters with the BA.5 mutant strain, 50% of the hamsters died on day 4 post-infection (dpi), and the rest died on day 5. This result indicates that BA.5 still has a high lethality.

[0162] like Figure 5As shown, histopathological analysis was performed on the lung and brain tissues of BA.5H11-K18-hACE2 infected hamsters, with comparable samples from healthy rodents serving as negative controls. On day 3 post-infection (3 dpi), mild changes were observed in the lung tissue of H11-K18-hACE2 hamsters, including multifocal lesions, partial alveolar wall thickening with a small amount of fibrin exudation. By day 5-6 (5-6 dpi), the H11-K18-hACE2 hamsters exhibited fibrosis, partial obstruction of terminal bronchioles, and alveolar cell lysis and necrosis, ultimately leading to death.

[0163] (9) In summary, this strain can be used for virus infection research.

[0164] sequence list

[0165] H11-sgRNA target sequence: GTGCATGATCCATACCAAATAGG (SEQ ID NO:1)

[0166] gH11-sg1F: TAGGTGCATGATCCATACCAAAT (SEQ ID NO: 2)

[0167] gH11-sg1R: AAACATTTGGTATGGATCATGCA (SEQ ID NO: 3) U6-F1: TACGATACAAGGCTGTTAGAGAG (SEQ ID NO: 4)

[0168] SG-T7R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5). gH11-TF1: GCCAGCTCAGCCCTTTCTGTTTA (SEQ ID NO: 6)

[0169] gH11-TR1: CTGTCCTTGAACTTACTCTGTAGCC (SEQ ID NO:7)

[0170] hACE2-TF1: GGGTAGATGGCTATGACTACAGC (SEQ ID NO:8)

[0171] hACE2-TR1: CAGACTGCTTTCTGAACATTTCCT (SEQ ID NO:9).

[0172]

[0173] gH11-H1F: AGGGCGAATTGGGTGCATGATCCATACCAAATAGGAAGAGGCCTTGAGTCC

[0174] ATCATTC (SEQ ID NO:11)

[0175] gH11-H1R: CTGCTCCATCACGCTTCGTATGGATCATGCACATCTT (SEQ ID NO:12)

[0176] gH11-H2F: GCCCGTGCCTTTTCCAGGGTTTCAGGTTAAACTCT (SEQ ID NO:13)

[0177] gH11-H2R: AACAAAAGCTGGCGTGCATGATCCATACCAAATAGGTCTAGAGTTGCTTTT

[0178] TCAACGAAACATGG (SEQ ID NO:14)

[0179] PB sequence:

[0180] AGCGTGATGGAGCAGATGAAGATTTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATGTGTTTTATCGGTCTGTATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGTTTATTTATTTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACTTTTATGAGGGACAGCCCCAGGGATGTAATTACGTCCCgcggccgcAATATCgtcgacgGGCTGTCCCTGATATCTATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGAGCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAATCTAGCTGCATCAGGATCATATCGTCGGGTCTTTTTTCCGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGTGCCTTTtCC(SEQ IDNO:15)。

Claims

1. A method for constructing a golden hamster model with humanized ACE2 gene overexpression at the H11 locus, characterized in that, The method includes: injecting H11-sgRNA targeting the H11 site, a Cas9 functional element, and an S7-gH11-PB-K18-hACE2 donor into two-cell embryos of golden hamsters under a red light source, followed by embryo transfer to a recipient to obtain a golden hamster model with humanized ACE2 gene overexpression at the H11 site; the target sequence of the H11-sgRNA is shown in SEQ ID NO:1; the Cas9 functional element is Cas9 mRNA or Cas9 protein.

2. The construction method according to claim 1, characterized in that, The method includes the following steps: (1) Design and prepare H11-sgRNA targeting the H11 site and donor DNA containing humanized ACE2 gene S7-gH11-PB-K18-hACE2 donor; (2) Under a red light source, the H11-sgRNA, Cas9 functional element and S7-gH11-PB-K18-hACE2donor were injected into the cytoplasm or nucleus of two-cell embryos of golden hamsters. (3) The injected embryos were transplanted into the recipient female mouse to obtain F0 generation hamsters, and PCR identification and sequencing were performed. (4) Cross F0 generation hamsters with wild-type hamsters to obtain F1 generation hamsters, and perform PCR identification and sequencing; (5) Cross F1 generation heterozygous hamsters to obtain F2 generation hamsters. After PCR identification and sequencing, stable homozygotes were obtained, which are the golden hamster model with humanized ACE2 gene overexpression at H11 site.

3. The construction method according to claim 1 or 2, characterized in that, The method for preparing the H11-sgRNA targeting the H11 site is as follows: annealing oligonucleotide pairs specifically targeting the H11 site to form double-stranded DNA, ligating them into an enzyme-digested linearized CRISPR backbone vector to construct a recombinant plasmid, and then transcribing the plasmid in vitro to synthesize H11-sgRNA; the oligonucleotide pairs include gH11-sg1F with nucleotide sequences as shown in SEQ ID NO: 2 and gH11-sg1R with nucleotide sequences as shown in SEQ ID NO:

3.

4. The construction method according to claim 3, characterized in that, The CRISPR backbone vector is the PUC57-sgRNA-EGFP-CRISP9 plasmid; the construction method of the PUC57-sgRNA-EGFP-CRISP9 plasmid is as follows: (1) Obtaining the PUC57 vector backbone: PUC57 was digested with NotI / XhoI to obtain a 2608bp fragment as the backbone PUC57-NX; (2) Preparation of sgRNA-EGFP: The sgRNA-EGFP sequence shown in SEQ ID NO:10 was synthesized and then the sgRNA-EGFP fragment was obtained by digestion with NotI / XhoI enzyme; (3) Obtaining the PUC57-sgRNA-EGFP-CRISP9 plasmid: Homologous recombination of PUC57-NX and sgRNA-EGFP fragments to construct the PUC57-sgRNA-EGFP-CRISP9 plasmid.

5. The construction method according to claim 3 or 4, characterized in that, The specific process for preparing the H11-sgRNA targeting the H11 site includes the following steps: (11) Linearization of CRISPR backbone vector: The PUC57-sgRNA-EGFP-CRISP9 plasmid was digested with BsaI restriction endonuclease, and the linearized vector backbone PUC57-CRISP9-B1 was obtained by separation and purification by agarose gel electrophoresis. (12) Oligonucleotide pair annealing: Two complementary oligonucleotide pairs, gH11-sg1F and gH11-sg1R, are annealed under the action of T4 PNK kinase to form a double-stranded DNA fragment. (13) Ligation and verification: The double-stranded DNA fragment formed by annealing was ligated with the linearized vector backbone PUC57-CRISP9-B1 using T4 ligase. After identification and sequencing verification, the correct recombinant plasmid PUC57-H11-sg1 was obtained. (14) In vitro transcription synthesis of H11-sgRNA: The sgRNA expression cassette was amplified by PCR from the recombinant plasmid PUC57-H11-sg1 using U6-F1 and SG-T7R primers, and then purified and synthesized into H11-sgRNA by the T7 in vitro transcription system. The nucleotide sequences of the U6-F1 and SG-T7R primers are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

6. The construction method according to claim 5, characterized in that, The annealing temperature program is as follows: 37°C for 30 minutes, 95°C for 5 minutes, -6°C / Min to 25°C.

7. The construction method according to claim 1 or 2, characterized in that, The S7-gH11-PB-K18-hACE2 donor is donor DNA containing the humanized ACE2 gene. The preparation method of the S7-gH11-PB-K18-hACE2 donor is as follows: (1) Obtaining the vector backbone: pCA-mTmG was digested with restriction endonuclease KpnI / SacI to obtain the target vector fragment S7-KS1 of 2856 bp; (2) Obtaining the homologous recombination fragments of H1Left and H2Right: The left and right homologous recombination arms H1Left and H2Right were amplified using primers gH11-H1F / gH11-H1R and gH11-H2F / gH11-H2R, respectively; the nucleotide sequences of the primers gH11-H1F, gH11-H1R, gH11-H2F, and gH11-H2R are shown in SEQ ID NO:11-14, respectively. (3) Obtaining the PB fragment: Synthesize the PB fragment as shown in SEQ ID NO:15; (4) Obtaining the S7-gH11-PB-mcs plasmid: Homologous recombination was performed on four DNA fragments: S7-KS1, H1Left, H2Right and PB fragment, to construct the H11 multiple cloning site vector, named S7-gH11-PB-mcs plasmid. (5) The S7-gH11-PB-mcs plasmid was digested with restriction endonucleases Not I / Sal I to obtain a 5756 bp target vector fragment as the vector backbone, named S7-gH11-PB-NS. (6) Obtaining the K18-hACE2 fragment: The pK18-hACE2 plasmid was digested with HapI and SalI to obtain a 6823bp fragment of K18-hACE2; (7) Obtaining the S7-gH11-PB-K18-hACE2 donor plasmid: Homologous recombination of the S7-gH11-PB-NS and K18-hACE2 fragments was performed to construct the S7-gH11-PB-K18-hACE2 donor plasmid.

8. The construction method according to claim 2, characterized in that, The specific primer pairs for PCR identification include: gH11-TF1, gH11-TR1, hACE2-TF1, and hACE2-TR1; the nucleotide sequence of gH11-TF1 is shown in SEQ ID NO:6, the nucleotide sequence of gH11-TR1 is shown in SEQ ID NO:7, the nucleotide sequence of hACE2-TF1 is shown in SEQ ID NO:8, and the nucleotide sequence of hACE2-TR1 is shown in SEQ ID NO:

9.

9. The application of the golden hamster (H11-K18-hACE2) model with humanized ACE2 gene overexpression at the H11 site constructed by any of the methods described in claims 1-8 in at least one of the following (1)-(5): (1) To study the related functions and mechanisms of action of the ACE2 gene; (2) To study the infection mechanism of SARS-CoV-2 virus; (3) Evaluation of novel pathogenic strains of SARS-CoV-2; (4) Screening for drugs to treat SARS-CoV-2 virus infection; (5) Develop vaccines to prevent SARS-CoV-2 virus infection.