Construction method and application of Ace2 gene modified golden hamster model
By injecting Cas9 protein and sgRNA into golden hamster embryos using CRISPR-Cas9 technology, an Ace2-deficient model was constructed, which solved the problem of inconsistency between mouse models and human infection, and achieved a stable Ace2 gene-modified golden hamster model suitable for SARS-CoV-2 research.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING MEDICAL UNIV
- Filing Date
- 2026-01-09
- Publication Date
- 2026-05-12
AI Technical Summary
Existing mouse models cannot effectively simulate human SARS-CoV-2 infection due to differences in key amino acid sites of the ACE2 receptor, resulting in inconsistencies between research results and human clinical findings. Humanized gene transfer is required, which is costly and complex.
Ace2-deficient golden hamster model was constructed by injecting Cas9 protein and sgRNA targeting exon 2 of Ace2 into two-cell embryos under red light using CRISPR-Cas9 technology. Offspring were obtained by transplantation of true-pregnancy albino recipient embryos to avoid early developmental arrest and establish a stable Ace2 gene-modified golden hamster model.
We have achieved an efficient and stable Ace2 gene-modified golden hamster model, which is suitable for SARS-CoV-2 infection research, provides a more consistent human infection model, and reduces research costs and operational difficulties.
Smart Images
Figure CN122012615A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering animal model construction technology, specifically relating to a method for constructing an Ace2 gene-modified golden hamster model and its application. Background Technology
[0002] SARS-CoV-2, with its high infectivity and morbidity, has become a priority in related medical research. Ideal animal models play a crucial role in various aspects, including research on the pathogenesis of SARS-CoV-2, vaccine testing, and evaluation of therapeutic drugs. Similar to SARS-CoV, SARS-CoV-2 enters host cells by attaching to angiotensin-converting enzyme 2 (ACE2). However, the mouse homologous receptor ACE2 (mACE2) cannot mediate viral invasion due to differences in key amino acid sites, requiring humanized gene transfer for infection. This results in an infection phenotype that is not entirely consistent with human clinical manifestations. Golden hamster ACE2 is highly homologous to the human SARS-CoV-2 infection target and can be directly infected by SARS-CoV-2. Combined with the advantages of golden hamsters—ease of operation, easy breeding, and low cost—they are considered one of the best small animal models for research on SARS-CoV-2 and its variants. Therefore, establishing an Ace2 gene-modified golden hamster model has profound significance in the research and application of SARS-CoV-2. Summary of the Invention
[0003] In view of the technical problems raised in the background art, the purpose of this invention is to provide a method for establishing an Ace2 gene-modified golden hamster model and its application.
[0004] This invention utilizes CRISPR-Cas9 technology, under a red-light chamber with a microscope equipped with a red filter, to inject Cas9 protein and sgRNAs targeting exon 2 of Ace2 into two-cell embryos to generate Ace2-deficient golden hamsters, thus avoiding early embryonic developmental arrest. The resulting embryos were then used to construct a SARS-CoV-2 infection model through the transfer of albino recipient embryos.
[0005] The objective of this invention is achieved through the following technical methods:
[0006] In a first aspect, the present invention claims protection for a method for constructing an Ace2 gene-modified golden hamster model, the method comprising: injecting a Cas9 functional element and an sgRNA targeting exon 2 of the Ace2 gene into a two-cell embryo under a red light source, transplanting the embryo into a recipient, thereby obtaining an Ace2 gene-modified golden hamster model.
[0007] Furthermore, this construction method identifies the target site of the gene to be knocked out in golden hamsters and designs an sgRNA that targets the Ace2 gene in golden hamsters. The nucleotide sequence of the sgRNA is shown in SEQ ID NO:1.
[0008] gAce2-Sg1 (sgRNA): TACCATCAAGCGTCAACTGCAGG (SEQ ID NO: 1).
[0009] Furthermore, the process for preparing the sgRNA is as follows: a double-stranded DNA fragment is formed by annealing primers gAce2-Sg1F and gAce2-Sg1R; the double-stranded DNA fragment is inserted into the BsaI-linearized PUC57-CRISP9 vector; after transformation and screening, an sgRNA expression plasmid is obtained; using the verified sgRNA expression plasmid as a template, high-concentration sgRNA is synthesized and purified by in vitro transcription; the nucleotide sequence of gAce2-Sg1F is shown in SEQ ID NO:2, and the nucleotide sequence of gAce2-Sg1R is shown in SEQ ID NO:3.
[0010] gAce2-Sg1F:TAGGTACCATCAAGCGTCAACTGC (SEQ ID NO: 2);
[0011] gAce2-Sg1R: AAACGCAGTTGACGCTTGATGGTA (SEQ ID NO: 3).
[0012] Furthermore, the PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid, and the construction method of the PUC57-CRISP9-sgRNA-GFP plasmid includes: digesting the PUC57 plasmid with Not I and Xho I restriction endonucleases to obtain a 2608 bp fragment as the PUC57-CRISP9 vector backbone; inserting the U6-T7-GFP-tracrRNA sequence as shown in SEQ ID NO:9 into the PUC57-CRISP9 vector backbone to construct the PUC57-CRISP9-sgRNA-GFP plasmid.
[0013] Furthermore, the construction method specifically includes the following steps:
[0014] (1) Under red light, active sgRNA and Cas9 functional elements were co-injected into the cytoplasm or nucleus of two-cell embryos of golden hamsters, and the injected embryos were transplanted into recipient mother mice for gestation to obtain F0 generation hamsters, and PCR identification and sequencing were performed.
[0015] (2) F0 generation hamsters were crossed with wild-type hamsters to obtain F1 generation hamsters, and PCR identification and sequencing were performed;
[0016] (3) Cross F1 generation heterozygous hamsters to obtain F2 generation hamsters. After PCR identification and sequencing, stable homozygotes were obtained, which are the Ace2 gene-modified golden hamster animal models.
[0017] Furthermore, the aforementioned Cas9 functional elements are Cas9 mRNA or Cas9 protein.
[0018] Furthermore, the specific primer pairs for the aforementioned PCR identification include: Ace2-TOF, Ace2-TOR, Ace2-TIF, and Ace2-TIR; the nucleotide sequence of Ace2-TOF is shown in SEQ ID NO:4, the nucleotide sequence of Ace2-TOR is shown in SEQ ID NO:5, the nucleotide sequence of Ace2-TIF is shown in SEQ ID NO:6, and the nucleotide sequence of Ace2-TIR is shown in SEQ ID NO:7.
[0019] Ace2-TOF: GCCACGCAGGAAGTAGTAGAT (SEQ ID NO:4)
[0020] Ace2-TOR: CAGGTAAGGAACTCATCCATGTAAG (SEQ ID NO:5)
[0021] Ace2-TIF: GGAAGTAGTAGATGTTTCACCA (SEQ ID NO: 6)
[0022] Ace2-TIR:CTCATCCATGTAAGCTGTAAGTATG (SEQ ID NO:7).
[0023] In the technical solution of this invention, all golden hamsters are kept in SPF-grade and equivalent breeding environments.
[0024] In the technical solution of this invention, all experiments were conducted at room temperature (28.5℃) under red light.
[0025] In the technical solution of this invention, all golden hamsters that provide embryos are induced to ovulate superovulate by intraperitoneal injection of pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) and then mated with male hamsters in a 1:1 cage.
[0026] In the technical solution of this invention, before and after the two-cell embryo transfer, the embryo is placed in an incubator in HEMC-11 culture medium. The culture conditions are: temperature 37.5℃, carbon dioxide content 10%, oxygen concentration 5%, and nitrogen concentration 85%.
[0027] In the technical solution of this invention, the target site of sgRNA is located at exon 2 of Ace2 or upstream and downstream sites of exon 2. The Cas9 protein translated from Cas9 mRNA in vivo or the Cas9 protein in the injected sample binds to the target site under the guidance of sgRNA, thereby causing DNA double-strand breaks and generating non-homologous recombination repair.
[0028] As a specific embodiment of the present invention, the method for constructing the Ace2 gene-modified golden hamster model of the present invention specifically includes the following steps:
[0029] (1) Structure of Ace2 gene and design of target site for sgRNA: The target site of the gene to be knocked out in golden hamster was determined, and sgRNA targeting the Ace2 gene in golden hamster was designed. The nucleotide sequence of the sgRNA is shown in SEQ ID NO:1.
[0030] Preparation of the sgRNA: A double-stranded DNA fragment was formed by annealing primers gAce2-Sg1F and gAce2-Sg1R. This double-stranded DNA fragment encodes an sgRNA targeting the Ace2 gene (SEQ ID NO:1). The double-stranded DNA fragment was inserted into a PUC57-CRISP9 vector linearized with BsaI. After transformation and screening, an sgRNA expression plasmid was obtained. Using the verified sgRNA expression plasmid as a template, a high concentration of sgRNA was synthesized and purified by in vitro transcription. The nucleotide sequences of gAce2-Sg1F and gAce2-Sg1R are as described in SEQ ID NO:2-3. The PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid. The construction method of the PUC57-CRISP9-sgRNA-GFP plasmid includes: digesting the PUC57 plasmid with Not I and Xho I restriction endonucleases to obtain a 2608 bp fragment as the PUC57-CRISP9 vector backbone; inserting the U6-T7-GFP-tracrRNA sequence as shown in SEQ ID NO:9 into the PUC57-CRISP9 vector backbone to construct the PUC57-CRISP9-sgRNA-GFP plasmid.
[0031] (2) Donor preparation: Select 6-8 week old golden female mice. At 9:00 AM on the first day of estrus, inject pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) intraperitoneally to induce superovulation. At 6:00 PM on the fourth day, mate with male mice in a 1:1 ratio. At 9:00 AM on the second day, examine vaginal secretions under a microscope for sperm. The presence of sperm indicates mating.
[0032] (3) Recipient preparation: Eight-week-old golden female mice were selected and mated with male mice in a 1:1 ratio at 6 pm on the fourth day of estrus. At 9 am on the second day, the vaginal secretions were examined under a microscope for sperm. The presence of sperm indicated that the recipient was a 0.5-day true pregnancy recipient.
[0033] (4) Embryo Acquisition: Hamster fertilized eggs are sensitive to pH, temperature and light. All experiments were performed at room temperature of 28.5℃ under red light. The donor female mice were anesthetized by intraperitoneal injection of 1.25% aphthine (1.8 ml / 100 g), and then euthanized by cervical dislocation. The fallopian tubes were excised from the abdomen and placed in culture droplets. Under a stereomicroscope, the ampulla of the fallopian tube was torn open with ophthalmic forceps to release the cell cluster. Two-cell embryos with uniform blastomeres were selected and transferred to HEMC-11 culture medium for temporary storage. The in vitro embryo acquisition process was completed within 30 minutes.
[0034] (5) Embryo injection: 20 ng / μl sgRNA and 50 ng / μl cas9 mRNA were injected into the cytoplasm of two-cell embryos through a micromanipulator. After injection, the embryos were cultured in a three-gas incubator with a temperature of 37.5℃, a carbon dioxide content of 10%, an oxygen concentration of 5%, and a nitrogen concentration of 85%.
[0035] (6) Embryo transfer: 1.25% aphrodisiac recipient female mice, after making an incision in the middle of the back skin, open the abdominal wall muscle layer between the abdominal ribs and iliac bone, use forceps to remove the fat pad and pull out one side of the ovary and fallopian tube, and aspirate 14-20 embryos for use. Under a stereomicroscope, use ophthalmic forceps to longitudinally tear the ampulla and fimbriae of the fallopian tube, and blow the embryo into the ampulla of the fallopian tube through the transfer tube.
[0036] (7) A method for constructing an Ace2 gene knockout mutant golden hamster model, comprising: constructing an Ace2 gene knockout mutant golden hamster model by using gAce2-Sg1 (sgRNA) alone. The Ace2 gene mutation includes: ① deletion of the nucleotide sequence after amino acid 94 in the entire exon 2 sequence of the Ace2 gene; as a result, the deletion of amino acid 94 leads to translation errors of the Ace2 protein.
[0037] (8) Breeding and screening of Ace2 gene-modified golden hamster models, including: ① injecting a mixture of Cas9 mRNA (or Cas9 protein) and sgRNA into golden hamster fertilized eggs and then transplanting them into surrogates to obtain F0 generation golden hamsters, and screening the positive golden hamsters among them as F0 generation Ace2 gene-modified golden hamsters; ② screening the offspring obtained by crossing F0 generation Ace2 gene-modified golden hamsters with wild-type golden hamsters, and taking the positive golden hamsters among them as F1 generation heterozygous golden hamsters; ③ screening the offspring obtained by self-breeding of F1 generation heterozygous golden hamsters, and taking the positive golden hamsters among them as F2 generation golden hamsters; the screening method for positive golden hamsters includes PCR identification and gene sequencing, and the positive homozygotes among the F2 generation golden hamsters are selected as Ace2 gene-modified golden hamster animal models.
[0038] In this embodiment of the invention, the specific primer pairs used for PCR identification and gene sequencing include: Ace2-TOF, Ace2-TOR, Ace2-TIF, and Ace2-TIR; the nucleotide sequences of Ace2-TOF, Ace2-TOR, Ace2-TIF, and Ace2-TIR are as described in SEQ ID NO:4-7.
[0039] This invention protects a method for modeling Ace2-modified golden hamsters by genetically modifying fertilized eggs or two-cell embryos and then transplanting them into surrogate mother mice for development. When Ace2-homozygous animals obtained using this method are mated with wild-type golden hamsters, their fertility is normal, but the homozygous individuals exhibit impaired development. After 18 weeks, Ace2-deficient golden hamsters show premature aging. At 8 weeks, the kidneys of the golden hamsters show vacuolar crystal-like changes, exhibiting typical pathological features of senile kidney. No Ace2 protein was detected, thus confirming the successful construction of the Ace2-modified golden hamster model.
[0040] Secondly, this invention seeks protection for the application of the Ace2 gene-modified hamster model constructed by the above method in any of the following:
[0041] (1) To study the infection mechanism of SARS-CoV-2 virus;
[0042] (2) To study the related functions and mechanisms of action of the Ace2 gene;
[0043] (3) Screening for drugs to treat SARS-CoV-2 virus infection;
[0044] (4) Used as a model of kidney injury to screen drugs for the treatment of kidney injury.
[0045] Thirdly, this invention seeks to protect the application of the Ace2 gene-modified hamster model constructed by the above method in the development of a vaccine to prevent SARS-CoV-2 virus infection.
[0046] Fourthly, this invention seeks protection for the application of the Ace2 gene-modified hamster model constructed by the above method in the evaluation of novel pathogenic SARS-CoV-2 strains.
[0047] The advantages of the Ace2 gene-modified golden hamster model constructed in this invention are:
[0048] (1) The method for constructing the golden hamster model of the present invention is highly efficient and has a stable reproductive transmission rate. Ace2 gene-modified golden hamster offspring are obtained by gene modification of two-cell embryos through true pregnancy recipient transplantation. The heterozygous strain of this modified strain has normal fertility. Therefore, the present invention provides an important method for constructing a golden hamster model for applications such as exploring the functional mechanism of the Ace2 gene, COVID-19 infection, and vaccine and drug development.
[0049] (2) The ACE2 knockout golden hamsters constructed in this invention showed reduced body weight and decreased distal lung size compared to wild-type hamsters.
[0050] Vascular expansion; delayed cardiac and renal development in 2-3 week old mice. Metagenomic results showed that Ace2 gene knockout in golden hamsters easily caused dysbiosis in the gut. The ACE2 knockout golden hamster model is helpful for research on the correlation between ACE2 and hypertension and chronic COVID-19. Attached Figure Description
[0051] Figure 1 A schematic diagram of the design and construction of the Ace2 KO golden hamster target site.
[0052] Among them, the golden hamster ACE2 gene has a total of 18 exons. A gene editing target site was designed at the 2nd exon to obtain gene-edited golden hamsters with a deletion of 3 bases and an insertion of 4 TTAC bases.
[0053] Figure 2 This is a schematic diagram of the structure of Ace2 KO golden hamster protein.
[0054] The ACE2 gene in golden hamsters encodes an 805-amino acid protein containing a peptidase M2 and a collectorrin domain. In its mutant form, a frameshift mutation in exon 2 alters the translational frame starting at amino acid 95, resulting in a truncated protein of only 144 amino acids. This truncated protein, lacking both the peptidase M2 and collectorrin domains, is nonfunctional.
[0055] Figure 3 ACE2 KO golden hamster protein expression validation results.
[0056] Among them, the Ace2 gene knockout golden hamster showed no expression of ACE2 protein, while the control was GAPDH.
[0057] Figure 4 The weight statistics for Ace2 KO golden hamsters.
[0058] Among them, the Ace2 gene knockout golden hamsters were smaller in weight than WT. WT and Ace2 hamsters were observed in individuals aged 1-12 weeks after birth. m1 / y Golden Hamster, WT and Ace2 - / y Figure showing weight changes in mice. From 2 weeks of age, Ace2 knockout golden hamsters showed a significant decrease in weight compared to wild-type mice. At 3 weeks, Ace2 knockout mice showed a decrease in weight compared to wild-type mice; at other ages, there was no significant difference in weight between Ace2 knockout mice and wild-type mice (data are mean ± semAce2). m1 / y For n=7, the rest n=8), *P<0.05, **P<0.01, ***P<0.001.
[0059] Figure 5 Expanding distal alveoli in the lungs of Ace2 gene knockout golden hamsters.
[0060] HE staining results of the lungs of 1-week-old male WT and Ace2 KO golden hamsters showed distal alveolar dilatation, suggesting delayed lung development. (Left icon bar 200 μm, right icon bar 100 μm).
[0061] Figure 6 Pathological analysis results of kidneys in golden hamsters with Ace2 gene knockout.
[0062] Among them, compared with wild-type golden hamsters, 8-week-old Ace2 gene knockout golden hamsters showed pathological changes of vacuolation in their kidneys. This suggests that Ace2 gene knockout golden hamsters tend to have renal insufficiency and malnutrition. Scale bar, 200μm (left), 100μm (right).
[0063] Figure 7 This is a structural diagram of the U6-T7-GFP-trcRNA sequence. Detailed Implementation
[0064] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make equivalent changes to the disclosed technical content to create equivalent embodiments. Any modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the present invention fall within the protection scope of the present invention.
[0065] Example 1
[0066] This embodiment provides a method for constructing an Ace2 gene-modified hamster animal model via microinjection. The specific steps of the construction method are as follows:
[0067] (1) Structure of Ace2 gene (Gene ID: 101823817, the amino acid sequence of ACE2 protein is shown in SEQ ID NO:8) and design of sgRNA target site: Determine the target site of the gene to be knocked out in golden hamster and design sgRNA targeting hamster Ace2 gene. The sgRNA is gAce2-Sg1 (SEQ ID NO:1: TACCATCAAGCGTCAACTGCAGG).
[0068] The designed sgRNA sequence was constructed into an expression vector using an in vitro ligation cloning method to obtain an sgRNA expression plasmid. Using the validated sgRNA expression plasmid as a template, high-concentration sgRNA was synthesized and purified through in vitro transcription.
[0069] The primers used in constructing the sgRNA expression plasmid include gAce2-Sg1F and gAce2-Sg1R.
[0070] gAce2-Sg1F: (SEQ ID NO:2: TAGGTACCATCAAGCGTCAACTGC)
[0071] gAce2-Sg1R: (SEQ ID NO: 3: AAACGCAGTTGACGCTTGATGGTA).
[0072] The specific process for constructing the sgRNA expression plasmid and performing in vitro transcription is as follows:
[0073] (a) Construction of sgRNA expression plasmid
[0074] Construction of PUC57-CRISP9-sgRNA-GFP plasmid
[0075] The PUC57 (General Electric Company, GE) plasmid was purified by gel extraction using Not I and Xho I restriction endonucleases at 37°C for 2 hours to obtain a 2608 bp fragment, which was used as the PUC57-CRISP9 vector backbone.
[0076] The artificially synthesized sequence containing U6-T7-GFP-tracrRNA (containing Not I and Xho I restriction sites, nucleotide sequence as shown in SEQ ID NO:9, sequence structure as shown in...) was used. Figure 7As shown, the sgRNA was inserted into the PUC57-CRISP9 vector backbone (2608 bp) to construct PUC57-CRISP9-sgRNA-GFP, and then sequenced to verify it.
[0077] Vector backbone preparation: The PUC57-CRISP9-sgRNA-GFP plasmid was linearized by digestion with BsaI restriction endonuclease. The target vector fragment of approximately 2965 bp was then separated and purified by gel electrophoresis for later use.
[0078] Oligo annealing: The two synthesized specific primers, gAce2-Sg1F and gAce2-Sg1F, were mixed. First, they were treated with T4 polynucleotide kinase (T4 PNK) to ensure 5' end phosphorylation of the oligonucleotide chains, which is essential for subsequent ligation. Then, the two primers were annealed to form a double-stranded DNA fragment through a temperature cycling program (37°C, 30 min → 95°C, 5 min → slow cooling to 25°C).
[0079] Ligation and Transformation: The annealed double-stranded Oligo fragment (after dilution) was mixed with the purified linearized vector backbone, and ligation was performed using T4 DNA ligase to insert the sgRNA sequence into the vector. The ligation product was transformed into DH5α competent E. coli cells, and selection was performed using Amp+ (ampicillin resistance). Only colonies successfully transformed with the plasmid were allowed to grow.
[0080] Positive clone identification: Single colonies were picked and cultured. After plasmid extraction, PCR amplification and sequencing were performed using universal primers M13F / M13R (M13R: CAG GAA ACA GCT ATG ACC; M13F: TGT AAA ACG ACG GCC AGT) to verify whether the inserted sgRNA sequence was correct.
[0081] (b) In vitro transcription to synthesize sgRNA
[0082] After obtaining a plasmid that has been correctly sequenced, it is used as a template to generate a large amount of the required sgRNA through in vitro transcription.
[0083] Transcription template amplification: Using the successfully validated plasmid as a template, PCR amplification was performed using M13F / M13R primers. The product was purified by gel excision and used as a template for in vitro transcription. The purpose of this step is to obtain a large number of pure sgRNA-encoded DNA fragments without the plasmid backbone.
[0084] In vitro transcription: Using the HiScribe T7 in vitro transcription kit, sgRNA was synthesized under the catalysis of T7 RNA polymerase, using the PCR product as a template. After the reaction was completed, TURBO DNase was added to degrade the DNA template, ensuring that the final product was pure RNA.
[0085] sgRNA purification and storage: The transcribed sgRNA was purified using ethanol precipitation to remove impurities such as salt ions, proteins, and unbound nucleotides from the reaction system. The purified sgRNA was reconstituted with RNase-free water, its concentration was determined, and it was diluted to a working concentration (e.g., 1000 ng / μl). Finally, it was stored at -80°C.
[0086] (2) Donor preparation: Select 6-8 week old golden female mice. At 9:00 AM on the first day of estrus, inject pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) intraperitoneally to induce superovulation. At 6:00 PM on the fourth day, mate with male mice in a 1:1 ratio. At 9:00 AM on the second day, examine vaginal secretions under a microscope for sperm. The presence of sperm indicates mating.
[0087] (3) Recipient preparation: Eight-week-old golden female mice were selected and mated with male mice in a 1:1 ratio at 6 pm on the fourth day of estrus. At 9 am on the second day, the vaginal secretions were examined under a microscope for sperm. The presence of sperm indicated that the recipient was a 0.5-day true pregnancy recipient.
[0088] (4) Embryo Acquisition: Hamster fertilized eggs are sensitive to pH, temperature and light. All experiments were performed at room temperature of 28.5℃ under red light. The donor female mice were anesthetized by intraperitoneal injection of 1.25% aphthine (1.8 ml / 100 g), and then euthanized by cervical dislocation. The fallopian tubes were excised from the abdomen and placed in culture droplets. Under a stereomicroscope, the ampulla of the fallopian tube was torn open with ophthalmic forceps to release the cell cluster. Two-cell embryos with uniform blastomeres were selected and transferred to HEMC-11 culture medium for temporary storage. The in vitro embryo acquisition process was completed within 30 minutes.
[0089] (5) Embryo injection: 20 ng / μl sgRNA and 50 ng / μl cas9 mRNA were injected into the cytoplasm of two-cell embryos through a micromanipulator. After injection, the embryos were cultured in a three-gas incubator with a temperature of 37.5℃, a carbon dioxide content of 10%, an oxygen concentration of 5%, and a nitrogen concentration of 85%.
[0090] (6) Embryo transfer: 1.25% aphrodisiac recipient female mice, after making an incision in the middle of the back skin, open the abdominal wall muscle layer between the abdominal ribs and iliac bone, use forceps to remove the fat pad and pull out one side of the ovary and fallopian tube, and aspirate 14-20 embryos for use. Under a stereomicroscope, use ophthalmic forceps to longitudinally tear the ampulla and fimbriae of the fallopian tube, and blow the embryo into the ampulla of the fallopian tube through the transfer tube.
[0091] (7) The identification primers are any one or a combination of two of the outer identification primer pair and the inner identification primer pair; F0 generation positive heterozygous hamsters are selected by sequencing and mated with wild-type hamsters to obtain F1 generation hamsters. F1 generation heterozygous hamsters are then hybridized to obtain F2 generation hamsters. The obtained F2 generation hamsters are identified by PCR and sequenced to obtain homozygotes in the F2 generation hamsters. The sequencing results show that there is a 4-nucleotide deletion (del4) in the Ace2-deficient (Ace2- / -) golden hamster strain, which leads to translation errors of Ace2 protein. The short chain screening and identification primer pairs include: Ace2-TOF, Ace2-TOR, Ace2-TIF and Ace2-TIR.
[0092] Ace2-TOF: GCCACGCAGGAAGTAGTAGAT (SEQ ID NO:4)
[0093] Ace2-TOR: CAGGTAAGGAACTCATCCATGTAAG (SEQ ID NO:5)
[0094] Ace2-TIF: GGAAGTAGTAGATGTTTCACCA (SEQ ID NO: 6)
[0095] Ace2-TIR:CTCATCCATGTAAGCTGTAAGTATG (SEQ ID NO:7).
[0096] (8) Comparative Experiment: The experiment was divided into basic phenotype and functional phenotype. ① Ace2- / - fertility was tested by comparing the reproductive performance of male and female Ace2 Hom (homozygous) golden hamsters with wild-type (WT), Het (heterozygous) hamsters with Het, and WT hamsters with WT to determine the decrease in Hom fertility. ② Western blotting showed the complete absence of Ace2 expression in the kidneys of Ace2- / - male golden hamsters, with GAPDH used as a control. Figure 3 ) ) Growth curves of Ace2- / - and WT male and female golden hamsters (N=8 per group) at 2-12 weeks. There was a significant difference in body weight between Ace2- / - male and female golden hamsters and wild-type controls, with weight loss.
[0097] Example 2
[0098] (1) Construction of the ACE2 knockout golden hamster model and its lung phenotype analysis. Compared with the wild-type (WT) control group, ACE2 KO golden hamsters showed individual growth retardation ( Figure 4 Further histological analysis of the lung tissue revealed abnormal dilation of the distal alveoli, suggesting delayed lung development. Figure 5 ).
[0099] (2) Kidney phenotype study of ACE2 knockout golden hamsters. Pathological examination of the kidneys of 8-week-old ACE2 KO golden hamsters revealed vacuolar crystal-like changes in the kidney tissue. Figure 6 This is a typical pathological feature of senile kidney disease. The results suggest that ACE2 gene deletion may lead to an early trend of renal insufficiency and malnutrition in golden hamsters.
[0100] (3) Ace2 deficiency leads to spontaneous atherosclerosis in golden hamsters.
[0101] sequence list
[0102] The amino acid sequence of the protein encoded by the Ace2 gene (XP_005074266.1, SEQ ID NO:8)
[0103] MSSSSWLLLSLVAVTTAQSIIEEQAKTFLDKFNQEAEDLSYQSALASWNYNTNITEENAQKMNEAAAKWSAFYEEQSKLAKNYSLQEVQNLTIKRQLQALQQSGSSALSADKNKQLNTILNTMSTIYSTGKVCNPKNPQECLLLEPGLDDIMATSTDYNERLWAWEGWRAEVGKQLRPLYEEYVVLKNEMARANNYEDYGDYWRGDYEAEGADGYNYNGNQLIEDVERTFKEIKPLYEQLHAYVRTKLMNTYPSYISPTGCLPAHLLGDMWGRFWTNLYPLTVPFGQKPNIDVTDAMVNQGWNAERIFKEAEKFFVSVGLPYMTQGFWENSMLTDPGDDRKVVCHPTAWDLGKGDFRIKMCTKVTMDNFLTAHHEMGHIQYDMAYATQPFLLRNGANEGFHEAVGEIMSLSAATPEHLKSIGLLPSDFQEDNETEINFLLKQALTIVGTLPFTYMLEKWRWMVFKGDIPKEQWMEKWWEMKREIVGVVEPLPHDETYCDPAALFHVSNDYSFIRYYTRTIYQFQFQEALCQAAKHDGPLHKCDISNSTEAGQKLLNMLRLGKSEPWTLALENVVGARNMDVRPLLNYFEPLSVWLKEQNKNSFVGWNTDWSPYADQSIKVRISLKSALGENAYEWDDNEMYLFRASVAYAMRVYFAKNKTQTVPFGVEDIRVSDLKPRVSFNFFVTSPQNVSDIIPRNEVEEAVRLSRGRINDVFGLDDNSLEFLGINPTLSPPYQPPVTIWLIIFGVVMGIVVVGIIILIFTGIKGRKKKNETKREENPYDSVDIGKGESNAGFLSNDDAQTSF。
[0104] Nucleotide sequence of U6-T7-GFP-trcRNA (SEQ ID NO:9):
[0105]
Claims
1. A method for constructing an Ace2 gene-modified golden hamster model, characterized in that, The method includes: injecting Cas9 functional elements and sgRNA targeting exon 2 of the Ace2 gene into two-cell embryos under a red light source, transplanting the embryos into recipients, and thus obtaining an Ace2 gene-modified golden hamster model.
2. The construction method according to claim 1, characterized in that, The target site of the gene to be knocked out in golden hamster was determined, and an sgRNA targeting the Ace2 gene in golden hamster was designed. The nucleotide sequence of the sgRNA is shown in SEQ ID NO:
1.
3. The construction method according to claim 1 or 2, characterized in that, The process for preparing the sgRNA is as follows: a double-stranded DNA fragment is formed by annealing with primers gAce2-Sg1F and gAce2-Sg1R; the double-stranded DNA fragment is inserted into the PUC57-CRISP9 vector linearized with BsaI; after transformation and screening, an sgRNA expression plasmid is obtained; using the verified sgRNA expression plasmid as a template, high-concentration sgRNA is synthesized and purified by in vitro transcription; the nucleotide sequence of gAce2-Sg1F is shown in SEQ ID NO:2, and the nucleotide sequence of gAce2-Sg1R is shown in SEQ ID NO:
3.
4. The construction method according to claim 3, characterized in that, The PUC57-CRISP9 vector is a PUC57-CRISP9-sgRNA-GFP plasmid. The construction method of the PUC57-CRISP9-sgRNA-GFP plasmid includes: digesting the PUC57 plasmid with Not I and Xho I restriction endonucleases to obtain a 2608 bp fragment as the PUC57-CRISP9 vector backbone; inserting the U6-T7-GFP-tracrRNA sequence, as shown in SEQ ID NO:9, into the PUC57-CRISP9 vector backbone to construct the PUC57-CRISP9-sgRNA-GFP plasmid.
5. The construction method according to any one of claims 1-4, characterized in that, The method specifically includes the following steps: (1) Under red light, active sgRNA and Cas9 functional elements were co-injected into the cytoplasm or nucleus of two-cell embryos of golden hamsters, and the injected embryos were transplanted into recipient mother mice for gestation to obtain F0 generation hamsters, and PCR identification and sequencing were performed. (2) F0 generation hamsters were crossed with wild-type hamsters to obtain F1 generation hamsters, and PCR identification and sequencing were performed; (3) Cross F1 generation heterozygous hamsters to obtain F2 generation hamsters. After PCR identification and sequencing, stable homozygotes were obtained, which are the Ace2 gene modified golden hamster animal models.
6. The construction method according to claim 1 or 5, characterized in that, The Cas9 functional element is Cas9 mRNA or Cas9 protein.
7. The construction method according to claim 5, characterized in that, The specific primer pairs for PCR identification include: Ace2-TOF, Ace2-TOR, Ace2-TIF, and Ace2-TIR; the nucleotide sequence of Ace2-TOF is shown in SEQ ID NO:4, the nucleotide sequence of Ace2-TOR is shown in SEQ ID NO:5, the nucleotide sequence of Ace2-TIF is shown in SEQ ID NO:6, and the nucleotide sequence of Ace2-TIR is shown in SEQ ID NO:
7.
8. The application of the Ace2 gene-modified hamster model constructed by any of the methods described in claims 1-7 in any of the following: (1) To study the infection mechanism of SARS-CoV-2 virus; (2) To study the related functions and mechanisms of action of the Ace2 gene; (3) Screening for drugs to treat SARS-CoV-2 virus infection; (4) Used as a model of kidney injury to screen drugs for the treatment of kidney injury.
9. The application of the Ace2 gene-modified hamster model constructed by any of the methods described in claims 1-7 in the development of a vaccine to prevent SARS-CoV-2 virus infection.
10. The application of the Ace2 gene-modified hamster model constructed by any of the methods described in claims 1-7 in the evaluation of novel pathogenic strains of SARS-CoV-2.