Multiple primer combination and method for identifying mycobacteria and respiratory tract pathogenic bacteria and detecting drug-resistant genes of mycobacteria and respiratory tract pathogenic bacteria

By using multiple primer combinations and high-throughput sequencing technology, rapid and comprehensive identification and drug resistance gene detection of mycobacteria and respiratory pathogens have been achieved, solving the problems of long time consumption and low sensitivity in existing technologies and providing an efficient detection solution.

CN122012685APending Publication Date: 2026-05-12SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610304755.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing methods for detecting mycobacteria and respiratory pathogens are time-consuming and have low sensitivity, failing to meet the needs of rapid clinical diagnosis and unable to comprehensively detect multiple mycobacteria and drug resistance genes.

Method used

By employing multiple primer combinations and methods, including nucleic acid extraction, reverse transcription, multiplex targeted amplification, adapter ligation, and library purification, combined with high-throughput sequencing technology, we can achieve the identification of mycobacteria and respiratory pathogens and the comprehensive screening of their drug resistance genes.

Benefits of technology

It enables comprehensive identification of 5 types of Mycobacterium tuberculosis, 34 types of non-tuberculous mycobacteria, and 55 types of respiratory pathogens, covering 2,000 drug resistance gene loci. It has a short detection cycle, high sensitivity and specificity, and is suitable for various sample types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention relates to the technical field of detection, and provides a multiple primer combination and method for identifying mycobacteria and respiratory tract pathogenic bacteria and detecting drug-resistant genes of the mycobacteria and the respiratory tract pathogenic bacteria, and the nucleotide sequence of the primer combination comprises sequences as shown in SEQ ID NO: 1-SEQ ID NO: 380; the method comprises the following steps: nucleic acid extraction: extracting DNA and RNA in a sample as templates; reverse transcription: reversely transcribing the RNA into DNA (Deoxyribonucleic Acid); carrying out multi-target amplification, and configuring multi-PCR amplification; linker connection and library purification; and performing machine sequencing and data analysis. According to the application, pathogen identification is more comprehensive and accurate, and five kinds of mycobacterium tuberculosis, 34 kinds of nontuberculous mycobacteria and 55 kinds of common respiratory tract pathogenic bacteria are included; 2000 drug-resistant gene loci of clinically used anti-tuberculosis first-line and second-line drugs are comprehensively covered; all drug-resistant gene loci recommended by WHO and a guide can be comprehensively detected; the sensitivity and the specificity are high.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of detection technology, and more specifically, to a multiple primer combination and method for the identification of mycobacteria and respiratory pathogens and the detection of their drug resistance genes. Background Technology

[0002] Mycobacteria and respiratory pathogens are both relatively common pathogens.

[0003] Existing methods for detecting mycobacteria mainly include traditional bacterial culture, microscopic examination, and molecular biology methods. Bacterial culture is the gold standard for mycobacterial detection, but it is complex and time-consuming, often requiring weeks or even months to obtain results. Molecular biology methods, such as PCR melting curve analysis and gene chip technology, can provide highly sensitive and specific detection results in a shorter time, but still have some limitations. For example, a single PCR test cannot simultaneously identify multiple mycobacteria and cannot provide information on drug resistance sites.

[0004] The development of high-throughput sequencing technology has greatly advanced genomics and transcriptomics research. High-throughput sequencing can perform deep sequencing on large amounts of DNA samples in a short time, providing comprehensive genomic information. This offers new possibilities for pathogen identification and drug resistance detection.

[0005] Current mainstream detection technologies: Traditional methods – bacterial culture: time-consuming (culture requires 2-8 weeks) and have low sensitivity, failing to meet the needs of rapid clinical diagnosis.

[0006] Quantitative real-time PCR / PCR melting curve method: can only detect a single target (such as a single bacterial species or a single drug resistance gene) at a time, requiring multiple tests, which is cumbersome and costly.

[0007] Gene-Xpert: can identify Mycobacterium tuberculosis complexes, but only detects resistance to a single drug, rifampin (rpoB gene).

[0008] PCR reverse dot hybridization-gene chip: can identify Mycobacterium tuberculosis complexes, but can only detect drug resistance genes for a few commonly used first-line drugs (rifampin, isoniazid, etc.).

[0009] The disadvantages of current mainstream detection technologies: Traditional methods – bacterial culture: time-consuming (culture requires 2-8 weeks) and have low sensitivity, failing to meet the needs of rapid clinical diagnosis.

[0010] Quantitative real-time PCR / PCR melting curve method: can only detect a single target (such as a single bacterial species or a single drug resistance gene) at a time, requiring multiple tests. It cannot comprehensively detect resistance genes of commonly used first- and second-line drugs in clinical practice.

[0011] Gene-Xpert can identify Mycobacterium tuberculosis complexes, but it only detects resistance to a single drug, rifampin (rpoB gene). It cannot comprehensively detect resistance genes for commonly used first- and second-line drugs in clinical practice.

[0012] PCR reverse dot hybridization-gene chip: can identify Mycobacterium tuberculosis complexes, but can only detect resistance genes for a few commonly used first-line drugs (rifampin, isoniazid, etc.). It cannot comprehensively detect resistance genes for commonly used first- and second-line drugs in clinical practice. Summary of the Invention

[0013] The purpose of this invention is to develop a high-throughput, high-sensitivity, and low-cost detection technology for the identification of mycobacterial species and respiratory pathogens in in vitro samples and for comprehensive screening of drug resistance genes, thereby providing clinical information on the detection of pathogens and drug resistance genes in samples.

[0014] To achieve the above-mentioned objectives, this invention provides a multiple primer combination and method for the identification of mycobacteria and respiratory pathogens and the detection of their drug resistance genes, thereby improving the aforementioned problems.

[0015] The application is as follows: The first aspect is to propose the specific multiple primer combinations used: A multiplex primer set for identifying mycobacteria and respiratory pathogens and detecting their drug resistance genes, wherein the nucleic acid sequences of the primer set include the sequences shown in SEQ ID NO:1 to SEQ ID NO:380. The primer set includes 111 primer pairs for mycobacteria identification, with nucleic acid sequences of SEQ ID NO:49 to SEQ ID NO:270; 55 primer pairs for respiratory pathogen identification, with nucleic acid sequences of SEQ ID NO:271 to SEQ ID NO:380; and 24 primer pairs for drug resistance gene detection, with nucleic acid sequences of SEQ ID NO:1 to SEQ ID NO:48.

[0016] The second aspect proposes specific detection methods: A method for identifying mycobacteria and respiratory pathogens in ex vivo samples and detecting their drug resistance genes includes the following steps: Step S1: Nucleic acid extraction, extracting DNA and RNA from the sample as templates; Step S2: Reverse transcription, converting RNA into DNA; Step S3: Multiplex targeted amplification, which is configured into multiplex PCR amplification by combining multiplex primers from the first aspect; Step S4: Connector ligation and library purification; Step S5: After sequencing and data analysis.

[0017] Furthermore, the specific process of step S1 is as follows: add an equal volume of liquefaction reagent to the sample, vortex and mix, let stand at room temperature for 10 minutes to allow the sample to fully liquefy; extract nucleic acid using the fully automated magnetic bead method, and then use the Qubit fluorometer and its matching Qubit DNA detection kit to determine the DNA concentration of the nucleic acid.

[0018] Further, in step S2, the reaction system is constructed, and the amounts used per reaction are: 5 μL of sample nucleic acid, 2 μL of dNTP mixture, 1 μL of oligo(dT), 1 μL of RNase inhibitor, 1 μL of reverse transcriptase, and 10 μL of nuclease-free water; the reaction conditions are: the reaction temperature is 42℃, the reaction time is 60 min, and then the temperature is lowered to 4℃ for subsequent use.

[0019] Furthermore, step S3 includes the following steps: Step Q1: Preparation of multiplex amplification system, each reaction includes 10 μL of PCR reaction solution, 4 μL of primer mix, 1 μL of PCR enzyme, and 5 μL of sample nucleic acid; Step Q2: The amplification reaction conditions are as follows: Set the hot cap to 105 ℃ and the volume to 20 uL. Perform (1) 95℃ for 10 min; (2) 95℃ for 30 s; (3) 62℃ for 90 s; (4) 70℃ for 90 s. Repeat (2), (3), and (4) for a total of 30 times; (5) 70℃ for 10 min; (6) Cool down to 4℃ and wait for subsequent use. Step Q3: Purify the above amplified material using a nucleic acid purification kit.

[0020] Furthermore, the specific steps of step Q3 are as follows: 3.1 Equilibrate the purified magnetic beads at room temperature for 30 min; 3.2 Vortex to fully suspend the magnetic beads, add 75 μL of purified magnetic beads to the amplification product, and vortex thoroughly to mix. 3.3 Incubate at room temperature for 5 minutes to allow the DNA to fully bind to the magnetic beads. Then place the reaction tube on a magnetic rack and wait for the solution to become clear before carefully aspirating the supernatant with a pipette. 3.4 The PCR tubes were always placed on the magnetic rack. 200 μL of 80% ethanol was added to the reaction tubes and allowed to stand for 30 seconds. The supernatant was then carefully aspirated with a pipette. 3.5 Repeat step 3.4 once; 3.6 Use a 10µL pipette tip to remove any remaining cleaning solution; 3.7 The reaction tube should always be placed on the magnetic rack, and left to cool at room temperature with the lid off for 2 minutes. 3.8 Add 35 μL of elution buffer to the tube, vortex to mix and suspend the magnetic beads, let stand for 5 min, centrifuge briefly, and then place the reaction tube on a magnetic rack for 5 min. After the solution becomes clear, transfer 35 μL of supernatant to a new PCR tube for subsequent experiments.

[0021] Furthermore, in step S4, the reaction system for adapter ligation consists of the following amounts per reaction: 16 μL adapter ligation buffer, 10 μL ligase, 7 μL NF water, 2 μL 3' adapter, 2 μL 5' adapter, and 45 μL library from the previous step; the reaction conditions are: reaction temperature 25°C, duration 15 min, followed by cooling to 4°C.

[0022] Furthermore, in step S5, DNA sequence detection is performed using the Ullumina NextSeq500 and a universal sequencing reaction kit.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: In the scheme of this application: It provides more comprehensive and accurate pathogen identification, including 5 types of Mycobacterium tuberculosis, 34 types of non-tuberculous mycobacteria, and 55 types of common respiratory pathogens; it comprehensively covers 2,000 drug resistance gene loci for first- and second-line anti-tuberculosis drugs used in clinical practice; it can comprehensively detect all drug resistance gene loci recommended by WHO and guidelines; it has high sensitivity and high specificity; it is suitable for various sample types; the detection cycle is short, with results available in as little as 24 hours; and it has a large throughput, capable of detecting hundreds of samples at a time. Detailed Implementation

[0024] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0025] In the medical field, the identification criteria for mycobacteria and respiratory pathogens are as follows:

[0026] The scope of drug resistance gene testing is as follows:

[0027] The first aspect is to propose the specific multiple primer combinations used: A multiplex primer set for identifying mycobacteria and respiratory pathogens and detecting their drug resistance genes, wherein the nucleic acid sequences of the primer set include the sequences shown in SEQ ID NO:1 to SEQ ID NO:380. The primer set includes 111 primer pairs for mycobacteria identification, with nucleic acid sequences of SEQ ID NO:49 to SEQ ID NO:270; 55 primer pairs for respiratory pathogen identification, with nucleic acid sequences of SEQ ID NO:271 to SEQ ID NO:380; and 24 primer pairs for drug resistance gene detection, with nucleic acid sequences of SEQ ID NO:1 to SEQ ID NO:48.

[0028] Among them, the drug resistance genes include gyrB, gyrA, rv0678, rpsL, rplC, rrs, rrl, katG, erm, pncA, folC, thyA, alr, embB, eis, rpoB, and inhA; The primer set targeting the gyrB gene fragment consists of two pairs: the first pair is the upstream primer AAGTCAGGCGATCATCACGG (SEQ ID NO:1) and the downstream primer ACAACGTCAACAACAGCGTG (SEQ ID NO:2); the second pair is the upstream primer GGGCATGTGTTTTTGGCACA (SEQ ID NO:3) and the downstream primer CACCTAGACCCTTGTACCGC (SEQ ID NO:4).

[0029] The primer set targeting the gyrA gene fragment includes a pair: the upstream primer AGACCATGGGGGTACTACCAC (SEQ ID NO:5) and the downstream primer GGGCTTCGGTGTACCTCATC (SEQ ID NO:6).

[0030] The primer set targeting the rv0678 gene fragment consists of two pairs: the first pair is the upstream primer CGACAGATGGGCGGCTATT (SEQ ID NO:7) and the downstream primer GGATCAGCATCCGGGCATT (SEQ ID NO:8); the second pair is the upstream primer GATGCGGGATCTGTTGGCAT (SEQ ID NO:9) and the downstream primer AGGTTGCTCATCAGTCGTCC (SEQ ID NO:10).

[0031] The primer set targeting the rpsL gene fragment includes a pair: upstream primer TATGCACCCGCGTGTACAC (SEQ ID NO:11) and downstream primer ACGCGGATGATCTTGTAGC (SEQ ID NO:12).

[0032] The primer set targeting the rplC gene fragment includes a pair: the upstream primer ACCTCCAAGGGCAAAGGTTT (SEQ ID NO:13) and the downstream primer CGTTCTCGGCATCGACCTTA (SEQ ID NO:14).

[0033] The primer set targeting the rrs gene fragment includes a pair: the upstream primer CGGAGTCGCTAGTAATCGCA with SEQ ID NO:15, and the downstream primer CGTTTTAGTGTGCTCCTTAG with SEQ ID NO:16.

[0034] The primer set targeting the rrl gene fragment includes a pair: the upstream primer CCAGTGAGGAGCGACTGTTT with SEQ ID NO:17, and the downstream primer ATTCTCCGCTTCACCCTTGC with SEQ ID NO:18.

[0035] The primer set targeting the katG gene fragment includes a pair: upstream primer GGGGGTGTTCATGATACGAC (SEQ ID NO:19) and downstream primer GGCGGTCACAATTTTCGGTAA (SEQ ID NO:20).

[0036] The primer set targeting the erm gene fragment includes a pair: the upstream primer CACCGGCTCCATGACGAAT (SEQ ID NO:21) and the downstream primer ACCACGGTAATGCCAGGGAA (SEQ ID NO:22).

[0037] The primer set targeting the pncA gene fragment consists of three pairs: the first pair: upstream primer CAACAGTTCATCCCGGTTCG (SEQ ID NO:23) and downstream primer CGATGGTCGGTATTGCCA (SEQ ID NO:24); the second pair: upstream primer CCGTTCTCGTCGACTCCTTC (SEQ ID NO:25) and downstream primer GGCACACCGGACTATTCCTC (SEQ ID NO:26); and the third pair: upstream primer CCACGACGTGATGGTAGTCC (SEQ ID NO:27) and downstream primer CCCTATATCTGTGGCTGCCG (SEQ ID NO:28).

[0038] The primer set targeting the folC gene fragment includes a pair: the upstream primer ATGGATCGACGTTAGCTGC with SEQ ID NO:29, and the downstream primer TGCGCTGCAATGAATTCGAC with SEQ ID NO:30.

[0039] The primer set targeting the thyA gene fragment consists of three pairs: the first pair is the upstream primer GAATCCCGGTCGGCTAGAAG (SEQ ID NO:31) and the downstream primer TGTCAGCTCTACCAACGCAG (SEQ ID NO:32); the second pair is the upstream primer ATCACTTGCCCATTCGTCCC (SEQ ID NO:33) and the downstream primer CTTCGTGCTCGAAACGGGTA (SEQ ID NO:34).

[0040] The primer set targeting the alar gene fragment includes a pair: the upstream primer CCGCACGAATCGATTTCACC with SEQ ID NO:35, and the downstream primer GAGGTGGCGCATCTATCGAA with SEQ ID NO:36.

[0041] The primer set targeting the embB gene fragment consists of three pairs: the first pair is the upstream primer TATTCGGCTTCCTGCTCTGG (SEQ ID NO:37) and the downstream primer CATCCACAGAAGTCCCGTCG (SEQ ID NO:38); the second pair is the upstream primer TAACTGCTGTCGCGTAGGTG (SEQ ID NO:39) and the downstream primer GGTGTGAGCCCCATGTACGA (SEQ ID NO:40).

[0042] The primer set targeting the eis gene fragment includes a pair: the upstream primer ATTCGTCGCTGATTCTCGCA (SEQ ID NO:41) and the downstream primer GAAATCGGTGAAACTGGCCG (SEQ ID NO:42).

[0043] The primer set targeting the alar gene fragment includes a pair: the upstream primer GACGTTGATCAACATCCGGC with SEQ ID NO:43, and the downstream primer CCGATCAGACCGTAGTTGGG with SEQ ID NO:44.

[0044] The primer set targeting the inhA gene fragment consists of three pairs: the first pair is the upstream primer GGCGCTGGGTATTTATCCCAG (SEQ ID NO:45) and the downstream primer GATTGTGAAACGCGTAGACG (SEQ ID NO:46); the second pair is the upstream primer GGTCGAAGAGGGACGRCGTCA (SEQ ID NO:47) and the downstream primer GGTAACAGGACCGGTCGGG (SEQ ID NO:48).

[0045] II. Mycobacteria include: The primer set for identifying Mycobacterium africanum consists of two pairs: the first pair is the upstream primer GAAGTCACAGATGGCCTAGT (SEQ ID NO:49) and the downstream primer GAACCGGCGCGAGTCGTCAG (SEQ ID NO:50); the second pair is the upstream primer GCTCCGTGTTAATCTTCCG (SEQ ID NO:51) and the downstream primer GCGCATCATTTACGAGTCG (SEQ ID NO:52).

[0046] The primer set for identifying Mycobacterium Kansas consists of three pairs: the first pair is the upstream primer CAACCGTACTGGCTGCCAC (SEQ ID NO:53) and the downstream primer GTGTTGATCTCCTAGTTGGC (SEQ ID NO:54); the second pair is the upstream primer GCGTCCGACCGTATAAATGC (SEQ ID NO:55) and the downstream primer TCGACCACGAGGTACCTCTG (SEQ ID NO:56); and the third pair is the upstream primer GACAATTCCGAGCGCACCC (SEQ ID NO:57) and the downstream primer TCCAGCCTTTTAGGCAAACT (SEQ ID NO:58).

[0047] The primer set for identifying Mycobacterium simianum consists of three pairs: the first pair is the upstream primer CGGCATGCTCCGTACTTCG (SEQ ID NO:59) and the downstream primer CGACATCCGACGTATGCGA (SEQ ID NO:60); the second pair is the upstream primer GTACGAATTTCGGCGCTGTC (SEQ ID NO:61) and the downstream primer AATTACAAGCCCGGCGGCGA (SEQ ID NO:61); and the third pair is the upstream primer GACCAACACAGGCAAACAGC (SEQ ID NO:63) and the downstream primer GCATGATCTGAACTGAAAC (SEQ ID NO:64).

[0048] The primer set for identifying Mycobacterium avium consists of three pairs: the first pair is the upstream primer AATGGGCGTTCTTGACCGTT (SEQ ID NO: 65) and the downstream primer CCGTTCCGAGTATTCCGCGA (SEQ ID NO: 66); the second pair is the upstream primer GCACAGACAATGCTGCACAA (SEQ ID NO: 67) and the downstream primer CCGTCGAACCGATAACCGAT (SEQ ID NO: 68); and the third pair is the upstream primer CAATGGCCCAATGGCGATTC (SEQ ID NO: 69) and the downstream primer TTGCCCAGTTCGAGGTCCAC (SEQ ID NO: 70).

[0049] The primer set for identifying Mycobacterium fieldella consists of three pairs: the first pair is the upstream primer CGTCTGTGCGATTTGCTAGC (SEQ ID NO:71) and the downstream primer CATTCGCTGCGACAATCTGG (SEQ ID NO:72); the second pair is the upstream primer CGTACTACGTATCGTAGTGG (SEQ ID NO:73) and the downstream primer AGTTTGAAAAACGGTACGG (SEQ ID NO:74); and the third pair is the upstream primer CAATGAGAACGCATCGCCAG (SEQ ID NO:75) and the downstream primer CTCTTTCGCTTGATCGCAGC (SEQ ID NO:76).

[0050] The primer set for identifying Mycobacterium guildrums consists of three pairs: the first pair is the upstream primer CGAGAGACTAGCTGAGCACG (SEQ ID NO:76) and the downstream primer CTGCTTTGATGCGGTGATCG (SEQ ID NO:78); the second pair is the upstream primer AGAGCGCGATGATCGACAT (SEQ ID NO:79) and the downstream primer GTGATAAACGACTCGCGCAC (SEQ ID NO:80); and the third pair is the upstream primer TAGACATCGAGCGCGTGTAC (SEQ ID NO:81) and the downstream primer GAGACTGTCTAGCTCGCGAC (SEQ ID NO:82).

[0051] The primer set for identifying occasional mycobacteria consists of three pairs: the first pair is the upstream primer CGATCACTTCTCGGCCACC (SEQ ID NO:83) and the downstream primer CGTCGACCGTCTCTTCGTAG (SEQ ID NO:84); the second pair is the upstream primer CCGACATTAGCGTTGAAGCG (SEQ ID NO:85) and the downstream primer GTATTGCGTCATCCAACGGC (SEQ ID NO:86); and the third pair is the upstream primer CGAGCGACCGCATAACTTTG (SEQ ID NO:87) and the downstream primer GCGTGGCCGGAATATTTGTC (SEQ ID NO:88).

[0052] The primer set for identifying Mycobacterium bovis consists of three pairs: the first pair is the upstream primer GTTCGCGTGTTCGGTTGACG (SEQ ID NO: 89) and the downstream primer GGCGATGGTGAATACTTCA (SEQ ID NO: 90); the second pair is the upstream primer TTCGTCATAGGGTGCGATCG (SEQ ID NO: 91) and the downstream primer GGTGATACCTAACCTCGACG (SEQ ID NO: 92); and the third pair is the upstream primer GGAATTCGAGGCATTGAACG (SEQ ID NO: 93) and the downstream primer CTCGGTGTTAGCGAAGGAGC (SEQ ID NO: 94).

[0053] The primer set for identifying Haemophilus influenzae consists of three pairs: the first pair is the upstream primer CATAACGCGTGCCATTTGAG (SEQ ID NO: 95) and the downstream primer CGAGCACCGAGACAGATCTC (SEQ ID NO: 96); the second pair is the upstream primer CGTTGTATCGCTCGCAAGTG (SEQ ID NO: 97) and the downstream primer ACAAATTCCAACGTGTGCCG (SEQ ID NO: 98); and the third pair is the upstream primer GCACCGAATCGCAATACACC (SEQ ID NO: 99) and the downstream primer GTTCGCATTCGGATCAACGG (SEQ ID NO: 100).

[0054] The primer set for identifying Mycobacterium chimera consists of three pairs: the first pair is the upstream primer CGTCGGATTGGTCGCTATCA (SEQ ID NO: 101) and the downstream primer CCCAAAACACTTGTCAGCCG (SEQ ID NO: 102); the second pair is the upstream primer CTCGCTACCTCGAAGACGAC (SEQ ID NO: 103) and the downstream primer CGATAAAGCCGAAACGTGCTG (SEQ ID NO: 104); and the third pair is the upstream primer GGATTTCAGCGCGATGTCAC (SEQ ID NO: 105) and the downstream primer CGCGCAAAAAGAAGGTGTGA (SEQ ID NO: 106).

[0055] The primer set for identifying Mycobacterium lianjiandongensis consists of three pairs: the first pair is the upstream primer CACCGTCGTAGTTGTAGCGA (SEQ ID NO: 107) and the downstream primer CGTATCAGACTTCGTCCGGG (SEQ ID NO: 108); the second pair is the upstream primer CGAGTACATCCTGACCGACG (SEQ ID NO: 109) and the downstream primer GCGGTATTTCACATGCCGTC (SEQ ID NO: 110); and the third pair is the upstream primer GGCGACGTCAATAGTCAACGC (SEQ ID NO: 111) and the downstream primer ATACTTGCCAGCACCTGACC (SEQ ID NO: 112).

[0056] The primer set for identifying intracellular mycobacteria consists of three pairs: the first pair is the upstream primer GTTGGCATGCCTGATCGC (SEQ ID NO: 113) and the downstream primer CATCGCTGAGTTGTAACGCG (SEQ ID NO: 114); the second pair is the upstream primer AAGTGAGTAATCTATGCGCA (SEQ ID NO: 115) and the downstream primer CGCTTGAACGGCTAATTCGG (SEQ ID NO: 116); and the third pair is the upstream primer GCGTCCAGGTCGATCAGTAG (SEQ ID NO: 117) and the downstream primer GATGTCGAGCACAACGATGC (SEQ ID NO: 118).

[0057] The primer set for identifying Mycobacterium leprae consists of three pairs: the first pair is the upstream primer CATTCGCGACCAACGGATTC (SEQ ID NO: 119) and the downstream primer GGCCTGATTCGAAATGACGC (SEQ ID NO: 120); the second pair is the upstream primer ATCAAGCTATCGACCGCCTG (SEQ ID NO: 121) and the downstream primer GAAAAGTCTCATGTCGTC (SEQ ID NO: 122); and the third pair is the upstream primer GGTTCGTCGTGCAATCGATG (SEQ ID NO: 123) and the downstream primer GAATTCGTGATCGTGTGCCG (SEQ ID NO: 124).

[0058] The primer set for identifying Mycobacterium abscessus consists of three pairs: the first pair is the upstream primer GAGTTGCGCTATGCTGTTG (SEQ ID NO: 125) and the downstream primer CACGGTGAGTTCTTGGACGA (SEQ ID NO: 126); the second pair is the upstream primer TATGCACCTCTCGCGATGTC (SEQ ID NO: 127) and the downstream primer CTACGACCGACGACTAGCAC (SEQ ID NO: 128); and the third pair is the upstream primer CATCGGCGTTCACGTGAATC (SEQ ID NO: 129) and the downstream primer AAGTTGTTGCCGAATGCCAC (SEQ ID NO: 130).

[0059] The primer set for identifying Mycobacterium bovis includes a pair: upstream primer GTTTCACGCGTTTCCGTCC with SEQ ID NO:131, and downstream primer CTGCGCTGGTCGTCAGAC with SEQ ID NO:132.

[0060] The primer set for identifying Mycobacterium smegma consists of three pairs: the first pair is the upstream primer TGTTGACGTCAGGCTGAGAC (SEQ ID NO: 133) and the downstream primer GTGAACGCCAATCATCGACG (SEQ ID NO: 134); the second pair is the upstream primer CAGAAGATTTCTCGTGCGCG (SEQ ID NO: 135) and the downstream primer GCGGCATGCAATTCGTGTAT (SEQ ID NO: 136); and the third pair is the upstream primer TCGTCTGTCTTCACCACTGC (SEQ ID NO: 137) and the downstream primer CTGCGATCGAGTTTGAAGCG (SEQ ID NO: 138).

[0061] The primer set for identifying Mycobacterium marineum consists of three pairs: the first pair is the upstream primer CTCCGGTACTCCTTCGCATC (SEQ ID NO: 139) and the downstream primer CGGTTGCCTACTCTAGCGAG (SEQ ID NO: 140); the second pair is the upstream primer GGCGATTGAACGGGTCGATTG (SEQ ID NO: 141) and the downstream primer CAGACACGTTTGGAGACGGA (SEQ ID NO: 142); and the third pair is the upstream primer CGATCTCCTTGTCGTCGAGG (SEQ ID NO: 143) and the downstream primer ACCGTTACGTCCTGTGAACC (SEQ ID NO: 144).

[0062] The primer set for identifying *Mycobacterium aureum* consists of three pairs: the first pair is the upstream primer CAGAGCTCGTCGACCAGATC (SEQ ID NO: 145) and the downstream primer GTAAATGACCGAGTTCGCGC (SEQ ID NO: 146); the second pair is the upstream primer GCCATCATTTGCCACCGATC (SEQ ID NO: 147) and the downstream primer CTTCCGATCGCGAAAACGAC (SEQ ID NO: 148); and the third pair is the upstream primer CGAAGTTGCGAAGATCTGCG (SEQ ID NO: 149) and the downstream primer CATCGCCGACATCAGCTTTG (SEQ ID NO: 150).

[0063] The primer set for identifying Mycobacterium marmoset consists of two pairs: the first pair is the upstream primer CGCGGCATTCACATCTTCAG (SEQ ID NO:151) and the downstream primer ATCTAGCGCTCGTCGTCAA (SEQ ID NO:152); the second pair is the upstream primer CGAGAACTGCAATGGCGATG (SEQ ID NO:153) and the downstream primer GCTTGGACTTGCGTTCGTTT (SEQ ID NO:154).

[0064] The primer set for identifying Mycobacterium tumefaciens consists of three pairs: the first pair is the upstream primer GCGTCGATACCGTGCTTTTC (SEQ ID NO:155) and the downstream primer ACGCGATCTTCGATGAGGTC (SEQ ID NO:156); the second pair is the upstream primer GCGCTTTCGGCTGACTATTG (SEQ ID NO:157) and the downstream primer AACAGCACGTTGACGAAAGC (SEQ ID NO:158); and the third pair is the upstream primer CCAATGTGGCATACGCTTCG (SEQ ID NO:159) and the downstream primer GACGTCATGATCACGCAAGC (SEQ ID NO:160).

[0065] The primer set for identifying Mycobacterium Asianum consists of three pairs: the first pair is the upstream primer GGCAACGCTAAATCGACGTC (SEQ ID NO: 161) and the downstream primer GGTGCAGCGATTTCGATCAC (SEQ ID NO: 162); the second pair is the upstream primer CGCGAAGTCAGCAATGTACG (SEQ ID NO: 163) and the downstream primer CCCGACCTTTCCGATAGCTC (SEQ ID NO: 164); and the third pair is the upstream primer CGATCCGACTCTTACCCACG (SEQ ID NO: 165) and the downstream primer CGTTATTCGCGGCAATCGTT (SEQ ID NO: 166).

[0066] The primer set for identifying Mycobacterium gastricis consists of three pairs: the first pair is the upstream primer GGAGCTCTTCGAGATGACCG (SEQ ID NO:167) and the downstream primer CTTGAGGATTGCGAGCATGC (SEQ ID NO:168); the second pair is the upstream primer CATGTGAATCGAGCAAGGCG (SEQ ID NO:169) and the downstream primer GAGATCTGCCCTACGACCG (SEQ ID NO:170); and the third pair is the upstream primer TTCTCCATCGCCAGGACCTA (SEQ ID NO:171) and the downstream primer CATCGGAATTCGCGGTCAC (SEQ ID NO:172).

[0067] The primer set for identifying Mycobacterium Gordon consists of three pairs: the first pair is the upstream primer ACGACATCGCCTACGTGATC (SEQ ID NO:173) and the downstream primer GTCTCGGAGATCGTCACGAC (SEQ ID NO:174); the second pair is the upstream primer GACCGGTGATGCGTCATTTCG (SEQ ID NO:175) and the downstream primer GATGCTCGACTCGTCCTCTG (SEQ ID NO:176); and the third pair is the upstream primer CCGACGGTTGATGCGATTTC (SEQ ID NO:177) and the downstream primer GTGCCGTCGAGATCCAGTAG (SEQ ID NO:178).

[0068] The primer set for identifying nonchromogenic mycobacteria consists of three pairs: the first pair is the upstream primer CGTGGGTGGTAATTCGCGA (SEQ ID NO:179) and the downstream primer GCTACTAGGTCGCCGAAGTC (SEQ ID NO:180); the second pair is the upstream primer CGTGCGAGCAGAAAGATTCG (SEQ ID NO:181) and the downstream primer TTCTTTGATGTCGCACCGGA (SEQ ID NO:182); and the third pair is the upstream primer CCCGTAACGCCGATAACGTA (SEQ ID NO:183) and the downstream primer CGATGCGACAGTCCGTCATA (SEQ ID NO:184).

[0069] The primer set for identifying Mycobacterium surgaensis consists of three pairs: the first pair is the upstream primer CGGCTATCGCAGTAAGTCGT (SEQ ID NO: 185) and the downstream primer CCGCGATGTCGAAATCACAC (SEQ ID NO: 186); the second pair is the upstream primer AAACAGTCCCACGGATCGATC (SEQ ID NO: 187) and the downstream primer GATTCATCAACCACGGTAAG (SEQ ID NO: 188); and the third pair is the upstream primer GAAGGTGATGGAACGCTGC (SEQ ID NO: 189) and the downstream primer GACGTGCTTGCCACGATGAC (SEQ ID NO: 190).

[0070] The primer set for minor mycobacterial identification consists of three pairs: the first pair is the upstream primer CGCGACTCAGAAATTCAGCG (SEQ ID NO: 191) and the downstream primer TGCGCTCGTAAGGTCAGTTT (SEQ ID NO: 192); the second pair is the upstream primer GGTTTGCTGCCATTCGCCTG (SEQ ID NO: 193) and the downstream primer GTCTCAGCTACGACGACGAG (SEQ ID NO: 194); and the third pair is the upstream primer AGTACATGTCAATGCCGTCC (SEQ ID NO: 195) and the downstream primer CATGACGACCCTGGAGATCG (SEQ ID NO: 196).

[0071] The primer set for identifying Mycobacterium aureum consists of three pairs: the first pair is the upstream primer GACTTCGGTGCCTCGATAGG (SEQ ID NO:197) and the downstream primer GGCAGTGCGATGAACTTGTCC (SEQ ID NO:198); the second pair is the upstream primer GCCCATCGAATGCCACATTC (SEQ ID NO:199) and the downstream primer CGTTCGTTGTCATCATCGCC (SEQ ID NO:200); and the third pair is the upstream primer AAACGCCACGCTTTGAACTC (SEQ ID NO:201) and the downstream primer CTGATCGTCACGCCGATGTA (SEQ ID NO:202).

[0072] The primer set for identifying Mycobacterium ulcerans consists of three pairs: the first pair is the upstream primer ATCCGCTTGACATTGGCAGA (SEQ ID NO:203) and the downstream primer CAGGTAGTCGCCGATGTCTC (SEQ ID NO:204); the second pair is the upstream primer CGGAAGCACGACTTTATGCG (SEQ ID NO:205) and the downstream primer ACTTCCCAGTTGCTCGAAGG (SEQ ID NO:206); and the third pair is the upstream primer GGCCGGAGTGAAATGACATC (SEQ ID NO:207) and the downstream primer ACTTTCAGATGGACTGGCCG (SEQ ID NO:208).

[0073] The primer set for identifying Mycobacterium vulnificus includes a pair: the upstream primer CGCAGCATTCGGTAGTGGTC (SEQ ID NO:209) and the downstream primer GTGAGACGGTACATGGTGGG (SEQ ID NO:210).

[0074] The primer set for identifying Mycobacterium intercalation consists of three pairs: the first pair is the upstream primer CTAGTACAGCGACGTCGTCC (SEQ ID NO:211) and the downstream primer CTCTCCGACATCCGTTAGCC (SEQ ID NO:212); the second pair is the upstream primer CGACGGCTAGCTTTTCATGC (SEQ ID NO:213) and the downstream primer GCTTTTCCTCGCTAATGCTGC (SEQ ID NO:214); and the third pair is the upstream primer GTGTCGATGAATGCGTGACG (SEQ ID NO:215) and the downstream primer CCGTAGAAGATGACCCGACG (SEQ ID NO:216).

[0075] The primer set for identifying Mycobacterium tumefaciens consists of three pairs: the first pair is the upstream primer CCGCGTAGGTTTCGTCGATA (SEQ ID NO:217) and the downstream primer CAGTGCGGTAAAGCTGTTGC (SEQ ID NO:218); the second pair is the upstream primer CAGTGCGGTAAAGCTGTTGC (SEQ ID NO:219) and the downstream primer TGTGGTGTTCCTCGAACTCG (SEQ ID NO:220); and the third pair is the upstream primer CGAAGATGAGAAACGCGCTG (SEQ ID NO:221) and the downstream primer GCGAGATAGCTTTCTCCGCT (SEQ ID NO:222).

[0076] The primer set for identifying Mycobacterium dichotoma consists of three pairs: the first pair is the upstream primer GATCGGTTCGTGATCGTCGA (SEQ ID NO:223) and the downstream primer CGACTACATCAACGCGCTTG (SEQ ID NO:224); the second pair is the upstream primer GAACGCATTCACGATGTCCG (SEQ ID NO:225) and the downstream primer CAACAGTTTGGAACCCAAAG (SEQ ID NO:226); and the third pair is the upstream primer CGGCATAAAATGGTCCAGCG (SEQ ID NO:227) and the downstream primer CGAACTGCGAGACGTATCGA (SEQ ID NO:228).

[0077] The primer set for identifying Mycobacterium scrofula consists of three pairs: the first pair is the upstream primer CGGCGCGTAATAACACACTG (SEQ ID NO:229) and the downstream primer TTGATCGCCCGATTCCTACG (SEQ ID NO:230); the second pair is the upstream primer GTTACGCTCGGTTGCGATTCG (SEQ ID NO:231) and the downstream primer CGTACCACCACGCCTATACC (SEQ ID NO:232); and the third pair is the upstream primer CCGTAAATTGCTGCTCGACG (SEQ ID NO:233) and the downstream primer ACGGTCACGGCGATATCTTC (SEQ ID NO:234).

[0078] The primer set for identifying Mycobacterium suis consists of three pairs: the first pair is the upstream primer CGCATTGAAGCCATCGACTG (SEQ ID NO:235) and the downstream primer GCATGAACCGTTCGACATCG (SEQ ID NO:236); the second pair is the upstream primer CACGCTGATGTGCATTACCG (SEQ ID NO:237) and the downstream primer CCGAGTCCGACGATCAAGAG (SEQ ID NO:238); and the third pair is the upstream primer GAATTGACATCGCCTCACGC (SEQ ID NO:239) and the downstream primer CGATCAGTTCGTCCCGGTAG (SEQ ID NO:240).

[0079] The primer set for identifying Mycobacterium masei consists of three pairs: the first pair is the upstream primer CTGCAACAACACCCTGTTCG (SEQ ID NO:241) and the downstream primer GTCCAGTCCTTTTCGCCTCA (SEQ ID NO:242); the second pair is the upstream primer ATCTGACCGTAGGCAACAGG (SEQ ID NO:243) and the downstream primer CGCATATCTTTAGGTTGTTG (SEQ ID NO:244); and the third pair is the upstream primer TTGTCGACCGAGGTTGTTGAG (SEQ ID NO:245) and the downstream primer CGATAGATCGTATCGCGCGA (SEQ ID NO:246).

[0080] The primer set for identifying Mycobacterium bufossa consists of three pairs: the first pair is the upstream primer GCGTGCTGTATTTCGCAGAG (SEQ ID NO:247) and the downstream primer CTGAGAGTTCACCGCTCCG (SEQ ID NO:248); the second pair is the upstream primer ATCCTGCAAAGGTCAACTAC (SEQ ID NO:249) and the downstream primer CTTTTGAGGTCCCAATCTG (SEQ ID NO:250); and the third pair is the upstream primer GTGCGTGCGGGTACCCGCC (SEQ ID NO:251) and the downstream primer CTAGTACCCGACGATGACAC (SEQ ID NO:252).

[0081] The primer set for identifying Mycobacterium tumefaciens consists of three pairs: the first pair is the upstream primer AGTAAGTCACAGGTGCACC (SEQ ID NO:253) and the downstream primer CGAAAGTTACCCGACGTGAG (SEQ ID NO:254); the second pair is the upstream primer GTGCGGTCCATCGGTTGTCC (SEQ ID NO:255) and the downstream primer CGGTAATTGCGACCGTGATC (SEQ ID NO:256); and the third pair is the upstream primer CATTACGAGTGACGGAAGCG (SEQ ID NO:257) and the downstream primer CGTTCGACGCCGTTATCCTC (SEQ ID NO:258).

[0082] The primer set for identifying Mycobacterium flavonoids consists of three pairs: the first pair is the upstream primer GCGTACGGGGAAGTATGAGG (SEQ ID NO:259) and the downstream primer GCGTACGGGTAACTTCGATTC (SEQ ID NO:260); the second pair is the upstream primer CGAGTTTCTCAATCTTCG (SEQ ID NO:261) and the downstream primer GGCCGAAATCGACCTCTAGG (SEQ ID NO:262); and the third pair is the upstream primer CAATGCCGATCGCTACTGCG (SEQ ID NO:263) and the downstream primer AATGCTGCGTAACCGTCG (SEQ ID NO:264).

[0083] The primer set for identifying Mycobacterium tuberculosis complex consists of two pairs: the first pair is the upstream primer TTACAGGCCTGGGAAATCGAA (SEQ ID NO:265) and the downstream primer CGGGTATGATCGGCGATGAC (SEQ ID NO:266); the second pair is the upstream primer AAGATGTAGCGGGCCAGCAA (SEQ ID NO:267) and the downstream primer CATCGAGTATCGCACGGGTC (SEQ ID NO:268).

[0084] The primer set for identifying Mycobacterium tuberculosis includes a pair: upstream primer GACGATAGGAAATGGAGTTGCG (SEQ ID NO: 269) and downstream primer GGGATAGCAAACCCGTTGAA (SEQ ID NO: 270).

[0085] III. Primers for identifying respiratory pathogens include the following: The primer set for identifying Streptococcus intermedia includes a pair: the upstream primer CAGTCACCAGCTTATTCGT with SEQ ID NO:271, and the downstream primer CCCGGTCAGGCTCGCAAGGT with SEQ ID NO:272.

[0086] The primer set for identifying Neisseria meningitidis includes a pair: the upstream primer AGTTGTACCATGGCGTGAG (SEQ ID NO:273) and the downstream primer GCGCTTCAACCGCGTGTTAA (SEQ ID NO:274).

[0087] The primer set for identifying Moraxella catarrhalis includes a pair: the upstream primer GTGATATTAAAGATTTGGC (SEQ ID NO:275) and the downstream primer CAAAAATTAACGGACAAGTC (SEQ ID NO:276).

[0088] The primer set for identifying Streptococcus pharyngitis includes a pair: the upstream primer TATGATTGTTCACCTTCCAA with SEQ ID NO:277, and the downstream primer GCGTATTATCCGTCCTGTCT with SEQ ID NO:278.

[0089] The primer set for identifying Streptococcus dysgalactiae includes a pair: upstream primer ATTACAATCGAAGCTTCAG (SEQ ID NO: 279) and downstream primer ACAAGTGACGAGCACGGTAC (SEQ ID NO: 280).

[0090] The primer set for Chlamydia trachomatis identification includes a pair: upstream primer AAGTAGCTGGAGACCGATG (SEQ ID NO:281) and downstream primer TCCAGAAGTTGCTAATGAGGC (SEQ ID NO:282).

[0091] The primer set for identifying Chlamydia psittaci includes a pair: upstream primer AGAAGGTGGTAAGTATTCA (SEQ ID NO:283) and downstream primer ATTTGGGGTGGTGGTCCCGT (SEQ ID NO:284).

[0092] The primer set for identifying Legionella pneumophila includes a pair: the upstream primer TTTAACTAAAGTGCTTATT with SEQ ID NO:285, and the downstream primer CTTCTCGGCATGCACTTCCG with SEQ ID NO:286.

[0093] The primer set for identifying Haemophilus influenzae consists of a pair: the upstream primer TGATCTTCAACAACGTTAA with SEQ ID NO:287, and the downstream primer GCTGCTAAAGTATTAGTAAAT with SEQ ID NO:288.

[0094] The primer set for identifying Streptococcus pyogenes includes a pair: the upstream primer AGCACCGTCAAGTTTACCGT with SEQ ID NO:289, and the downstream primer GGTCCGTCAAGGATCATTTG with SEQ ID NO:290.

[0095] The primer set for Neisseria gonorrhoeae identification includes a pair: upstream primer TGGCGCGCATCAGTTGATAA (SEQ ID NO:291) and downstream primer GGTATTGTTGAAGGCTTGAG (SEQ ID NO:292).

[0096] The primer set for Staphylococcus aureus identification includes a pair: the upstream primer CAAGCGAAACAAACGCAGGT (SEQ ID NO:293) and the downstream primer GTAACAACACATGCAGATGAT (SEQ ID NO:294).

[0097] The primer set for identifying Streptococcus agalactiae includes a pair: upstream primer GCCAGGTACCAGGACGCATG with SEQ ID NO:295, and downstream primer TGTCTCTATTGCATGGTTGGT with SEQ ID NO:296.

[0098] The primer set for identifying influenza B virus consists of a pair: upstream primer GGCAAACTAGTAAAAGGAA with SEQ ID NO:297, and downstream primer ATGCTCAATTGGAGGGGTTA with SEQ ID NO:298.

[0099] The primer set for identifying human coronavirus HKU1 includes a pair: upstream primer ATGGTCTTTTTGTAGTATCT with SEQ ID NO:299, and downstream primer TTTTTAAGTTATTATATGGCCG with SEQ ID NO:300.

[0100] The measles virus identification primer set consists of a pair: upstream primer GGCGGTTACGGCCCTTGCA with SEQ ID NO:301, and downstream primer GGAGAAAATGGTTGGATGTG with SEQ ID NO:302.

[0101] The primer set for identifying human coronavirus NL63 includes a pair: the upstream primer CTCCTTGCGTTCTTTCAAGTC with SEQ ID NO:303, and the downstream primer TATTTTGATAATAGTAGCAC with SEQ ID NO:304.

[0102] The primer set for identifying human bocavirus includes a pair: the upstream primer CTACACGTCCTTTTGAACC with SEQ ID NO:305, and the downstream primer ATCGCAGAGGAGACCTTCAT with SEQ ID NO:306.

[0103] The mumps virus identification primer set includes a pair: upstream primer TCACATTCCGACAACTGCA with SEQ ID NO:307 and downstream primer CATCTGGGTGCGAAATCAAGG with SEQ ID NO:308.

[0104] The primer set for identifying human parvovirus B19 includes a pair: upstream primer ATTATTGTGTGGGATGGTGTAA (SEQ ID NO:309) and downstream primer ATTTCGAGAATTTACCCCGTA (SEQ ID NO:310).

[0105] The primer set for identifying Mycoplasma pneumoniae includes a pair: the upstream primer CATCACGTTGTGGGTCCAT (SEQ ID NO:311) and the downstream primer TTTGCTCTAGGTTAAGCGAT (SEQ ID NO:312).

[0106] The primer set for identifying human enterovirus D includes a pair: the upstream primer GCGGCTAATCCCAACCACG (SEQ ID NO:313) and the downstream primer AGTCTGTGGCGGAACCAATGC (SEQ ID NO:314).

[0107] The primer set for identifying human enterovirus B includes a pair: the upstream primer CAGCGTCTTTTGGACAGAGG (SEQ ID NO:315) and the downstream primer GGTTTACGGCATTAATACTTGC (SEQ ID NO:316).

[0108] The primer set for identifying human rhinovirus type 14 includes a pair: the upstream primer GCGGCTAACCTTAACCCTT (SEQ ID NO: 317) and the downstream primer CAATTCCGGGACGGGACCATTG (SEQ ID NO: 318).

[0109] The rubella virus identification primer set includes a pair: the upstream primer CTGTGTTCACGCAGATGCAG with SEQ ID NO:319, and the downstream primer ATACCCGCCGCCATTGCGTGT with SEQ ID NO:320.

[0110] The primer set for identifying human enterovirus A includes a pair: upstream primer TCGATGATGAGTCACTGCGATCCC (SEQ ID NO:321) and downstream primer CGTAACGGGCATGCGCGGAACC (SEQ ID NO:322).

[0111] The human rhinovirus A (HRV-A) identification primer set includes a pair: the upstream primer GTGGCTAACCTTAACCCTGC with SEQ ID NO:323, and the downstream primer AATGCGTAAGTGCGGGATGACC with SEQ ID NO:324.

[0112] The primer set for identifying human parainfluenza virus 3 includes a pair: upstream primer CACAAACAGAACGAATGGTA (SEQ ID NO:325) and downstream primer GGAAAGCGATGCTAAAAACTAT (SEQ ID NO:326).

[0113] The primer set for identifying human herpesvirus type 2 / HHV-2 includes a pair: upstream primer CAGGACGTAGCGGAAGGATGC (SEQ ID NO: 327) and downstream primer GCAGCCCCAGAAGCGCCCGAAG (SEQ ID NO: 328).

[0114] The primer set for identifying human respiratory syncytial virus (RSV) consists of a pair: upstream primer ACAACTGCAATCATACAAGA (SEQ ID NO:329) and downstream primer CTTCAACAACACCAAGTGTCAA (SEQ ID NO:330).

[0115] The primer set for identifying human herpesvirus type 1 / HHV-1 includes a pair: the upstream primer ATCATCAACTTCGACTGGCCT with SEQ ID NO:331, and the downstream primer TTCCAGAAGCGCAAGATAAAG with SEQ ID NO:332.

[0116] The primer set for identifying influenza A virus H1N1 includes a pair: the upstream primer ACTGCTGGTCTCCGACGGAAT with SEQ ID NO:333, and the downstream primer AAAATGGGAATTGATGATTA with SEQ ID NO:334.

[0117] The primer set for identifying human enterovirus C includes a pair: upstream primer TCAAATAGAGCGTATGGTGGT (SEQ ID NO:335) and downstream primer ACTTCTCTCAAGACCCTTCGG (SEQ ID NO:336).

[0118] The primer set for identifying human coronavirus 229E includes a pair: the upstream primer CCAAACAGTAAAACCTGGCCA with SEQ ID NO:337, and the downstream primer GAAGCATTTCTCCCATACACC with SEQ ID NO:338.

[0119] The primer set for identifying Bordetella pertussis includes a pair: upstream primer CGCCCACAGACCAATGGCAAG (SEQ ID NO:339) and downstream primer CCAGAACTCCCAACACCGAG (SEQ ID NO:340).

[0120] The primer set for identifying Corynebacterium diphtheriae includes a pair: upstream primer TTCGCAGGAAAGGCATGTTCC with SEQ ID NO:341, and downstream primer CCACATCACAAGCTCACTGTG with SEQ ID NO:342.

[0121] The primer set for identifying human parainfluenza virus 1 includes a pair: the upstream primer ATTGCAACAATGCATACAGTA with SEQ ID NO:343, and the downstream primer AAGACAAAATCATGACAGTATC with SEQ ID NO:344.

[0122] The primer set for identifying influenza A virus H9N2 includes a pair: upstream primer AGTCCTCATCGGAGGAACCTA (SEQ ID NO:345) and downstream primer AGTCTCTGAAACTCGGATAGT (SEQ ID NO:346).

[0123] The primer set for identifying Chlamydia pneumoniae includes a pair: the upstream primer GACCGTCTTTGTGATCTGAT (SEQ ID NO:347) and the downstream primer ATGAACAAAGGCTTCATCAA (SEQ ID NO:348).

[0124] The primer set for identifying human coronavirus OC43 includes a pair: upstream primer TGTGGGCGTAGATTTTTCAA (SEQ ID NO:349) and downstream primer CCCATAGGTCACAATGTCGAA (SEQ ID NO:350).

[0125] The primer set for identifying human herpesvirus type 5 / HHV-5 includes a pair: the upstream primer GCGCACCGCGGCAAAGTATT with SEQ ID NO:351, and the downstream primer CAAGCCAGCCACGCCGATATT with SEQ ID NO:352.

[0126] The primer set for identifying influenza A virus H5N1 includes a pair: upstream primer CAGACAAAGCTCTATCAAAAC (SEQ ID NO:353) and downstream primer TAGACCCAAGGTAACGGTGGC (SEQ ID NO:354).

[0127] The primer set for identifying influenza A virus H3N2 includes a pair: the upstream primer GCACGTCTTGGGCACCCAGTA (SEQ ID NO:355) and the downstream primer GTTCCTCAACAATGACATG (SEQ ID NO:356).

[0128] The primer set for identifying influenza A virus H2N2 includes a pair: the upstream primer CCAGAATGTGATAGGCTTCTA (SEQ ID NO:357) and the downstream primer TGAGAATTGAAAGTATCGTA (SEQ ID NO:358).

[0129] The primer set for identifying human enterovirus 100 includes a pair: the upstream primer TCGATGATGAGTCACCGCGTTCCCC (SEQ ID NO:359) and the downstream primer GCAACTCCGCAGCGGAACCA (SEQ ID NO:360).

[0130] The human rhinovirus C (HRV-C) identification primer set includes a pair: the upstream primer AAACAGGAAAAAGATTTGACT with SEQ ID NO:361, and the downstream primer CAGTAAACCAAGCTTTGGGA with SEQ ID NO:362.

[0131] The primer set for identifying human enterovirus J includes a pair: the upstream primer GCGGCTAATCCTAACTCCGAT (SEQ ID NO:363) and the downstream primer AAGTCTGGAGCGGAACCGGT (SEQ ID NO:364).

[0132] The primer set for identifying Streptococcus pneumoniae includes a pair: the upstream primer CTAAATGGAAATGGTCTGGGA (SEQ ID NO:365) and the downstream primer CCCCACTATATTTTCACCAAA (SEQ ID NO:366).

[0133] The primer set for identifying human enterovirus 98 includes a pair: the upstream primer TCGATGATGAGTCACCGCATTCCC (SEQ ID NO: 367) and the downstream primer GTAACTCTGCGGCGGAACCA (SEQ ID NO: 368).

[0134] The primer set for identifying human enterovirus 107 includes a pair: the upstream primer TCGATGAGTCACCGCATTCCC (SEQ ID NO: 369) and the downstream primer GGCAACTCCGCAGCGGAACC (SEQ ID NO: 370).

[0135] The primer set for identifying human enterovirus 109 includes a pair: the upstream primer GTGGATAATCCTAACTTGAC with SEQ ID NO:371, and the downstream primer AAGTCGGTGGCGGAACCAACG with SEQ ID NO:372.

[0136] The primer set for identifying human parainfluenza virus type 4 (PIV4) includes a pair: upstream primer ATTTATACAATCCATATCGA (SEQ ID NO: 373) and downstream primer GAATATCTAGGTTTGATAGGT (SEQ ID NO: 374).

[0137] The human rhinovirus B (HRV-B) identification primer set includes a pair: the upstream primer GCGGCTAACCTTAACCCTGT (SEQ ID NO:375) and the downstream primer AATTCCGGGACGGGACCGGGA (SEQ ID NO:376).

[0138] The human metapneumovirus identification primer set includes a pair: the upstream primer TAAGAGAGCTCAGAACTCGG with SEQ ID NO:377, and the downstream primer GCTGCAGTTACAGCAGGTGTT with SEQ ID NO:378.

[0139] The adenovirus identification primer set consists of a pair: the upstream primer AGTGGAGCACCCCGAGACG (SEQ ID NO:379) and the downstream primer GCTTTTGCTATATGAGGACCT (SEQ ID NO:380).

[0140] Secondly, a method for identifying mycobacteria and respiratory pathogens in ex vivo samples and detecting their drug resistance genes includes the following steps: Step S1: Nucleic acid extraction, extracting DNA and RNA from the sample as templates; Step S2: Reverse transcription, converting RNA into DNA; Step S3: Multiplex targeted amplification, which is configured into multiplex PCR amplification by combining multiplex primers from the first aspect; Step S4: Connector ligation and library purification; Step S5: Perform sequencing and data analysis to obtain results.

[0141] The specific process of step S1 is as follows: add an equal volume of liquefaction reagent to the sample, vortex and mix, let stand at room temperature for 10 minutes to allow the sample to fully liquefy; extract nucleic acid using the fully automated magnetic bead method, and then use the Qubit fluorometer and its matching Qubit DNA detection kit to determine the DNA concentration of the nucleic acid.

[0142] This fully automated nucleic acid extraction equipment is used to extract pathogen nucleic acids, simultaneously extracting DNA and RNA from samples. DNA is used for the detection of bacteria, while RNA is used for the detection of RNA viruses. This extraction protocol is applicable to most clinical sample types (sputum, bronchoalveolar lavage fluid, fresh tissue, paraffin-embedded tissue, pleural and peritoneal fluid, cerebrospinal fluid, pus, etc.).

[0143] In step S2, the reaction system was constructed, and the amounts used per reaction were as follows: 5 μL of sample nucleic acid, 2 μL of dNTP mixture, 1 μL of oligo(dT), 1 μL of RNase inhibitor, 1 μL of reverse transcriptase, and 10 μL of nuclease-free water. The reaction conditions were: reaction temperature of 42℃, reaction time of 60 min, followed by cooling to 4℃, ready for subsequent use.

[0144] Step S3 includes the following steps: Step Q1: Preparation of the multiplex amplification system. Each reaction includes 10 μL of PCR reaction solution, 4 μL of primer mix, 1 μL of PCR enzyme, and 5 μL of sample nucleic acid. After preparing the reagents, thaw them on ice and mix thoroughly. Prepare 0.2 mL of nuclease-free PCR eight-tube strips according to the number of samples and the number of quality controls (N+2), and label them accordingly. For the preparation and aliquoting of the reaction solution, please use new (uncontaminated) pipette tips, centrifuge tubes, etc. Avoid cross-contamination of samples when handling each reaction well.

[0145] The PCR reaction solution contains an UDG anti-contamination system, dNTPS (dATP, dGTP, dCTP, dTTP, dUTP), Mg, KCl, glycerol, etc. The main component of the PCR amplification enzyme is Tag enzyme.

[0146] Step Q2: The amplification reaction conditions are as follows: Set the hot cap to 105 ℃ and the volume to 20 uL. Perform steps (1) 95℃ for 10 min; (2) 95℃ for 30 s; (3) 62℃ for 90 s; (4) 70℃ for 90 s. Repeat steps (2), (3), and (4) a total of 30 times. Step (5) 70℃ for 10 min. Step (6) Cool down to 4℃ and wait for subsequent use. Step Q3: Purify the above amplified material using a nucleic acid purification kit.

[0147] The specific steps for step Q3 are as follows: 3.1 Equilibrate the purified magnetic beads at room temperature for 30 min; 3.2 Vortex to fully suspend the magnetic beads, add 75 μL of purified magnetic beads to the amplification product, and vortex thoroughly to mix. 3.3 Incubate at room temperature for 5 minutes to allow the DNA to fully bind to the magnetic beads. Then place the reaction tube on a magnetic rack and wait for the solution to become clear before carefully aspirating the supernatant with a pipette. 3.4 The PCR tubes were always placed on the magnetic rack. 200 μL of 80% ethanol was added to the reaction tubes and allowed to stand for 30 seconds. The supernatant was then carefully aspirated with a pipette. 3.5 Repeat step 3.4 once; 3.6 Use a 10µL pipette tip to remove any remaining cleaning solution; 3.7 The reaction tube should always be placed on the magnetic rack, and left to cool at room temperature with the lid off for 2 minutes. 3.8 Add 35 μL of elution buffer to the tube, vortex to mix and suspend the magnetic beads, let stand for 5 min, centrifuge briefly, and then place the reaction tube on a magnetic rack for 5 min. After the solution becomes clear, transfer 35 μL of supernatant to a new PCR tube for subsequent experiments.

[0148] In step S4, the reaction system for adapter ligation consists of the following amounts per reaction: 16 μL adapter ligation buffer, 10 μL ligase, 7 μL NF water, 2 μL 3' adapter, 2 μL 5' adapter, and 45 μL library from the previous step. The reaction conditions are: reaction temperature 25°C for 15 min, followed by a cooling to 4°C.

[0149] After the adapter is connected, library purification is performed again, and the specific process is similar to step Q3: 4.1 Purify the magnetic beads and equilibrate at room temperature for 30 min.

[0150] 4.2 Vortex to fully suspend the magnetic beads, add 60 μL of purified magnetic beads to the amplification product, and vortex thoroughly to mix.

[0151] 4.3 Incubate at room temperature for 5 minutes to allow the DNA to fully bind to the magnetic beads, then place the reaction tube on a magnetic rack. After the solution becomes clear, carefully aspirate the supernatant using a pipette.

[0152] 4.4 The PCR tubes were always placed on a magnetic rack. 200 μL of 80% ethanol was added to the reaction tubes and allowed to stand for 30 seconds. The supernatant was then carefully aspirated with a pipette.

[0153] 4.5 Repeat step 3.4 once.

[0154] 4.6 Use a 10µL pipette tip to remove any remaining cleaning solution.

[0155] 4.7 The reaction tube should always be placed on the magnetic rack and left to cool at room temperature for 2 minutes with the lid off.

[0156] 4.8 Add 20 μL of elution buffer to the tube, vortex to mix and suspend the magnetic beads, let stand for 5 min, centrifuge briefly, and then place the reaction tube on a magnetic rack for 5 min. After the solution becomes clear, transfer 20 μL of supernatant to a new PCR tube.

[0157] 4.9 The library concentration was then determined using the Qubit fluorometer and its matching Qubit DNA detection kit.

[0158] In step S5, DNA sequence detection is performed using the Ullumina NextSeq500 and a universal sequencing reaction kit.

[0159] Further comparative analysis was conducted: I. Fourteen samples were tested for Mycobacterium tuberculosis using PCR. The results are shown in the table below. The results are largely consistent with those obtained using this method.

[0160] 2. Twenty-two in vitro samples with known pathogens and drug resistance gene information were tested. The pathogen identification and drug resistance gene detection results of the data are shown in the table below. The results are consistent with the preset target pathogens and drug resistance gene standard information in the samples (verifying the detection accuracy of this method).

[0161]

[0162]

[0163] III. Sensitivity analysis for Mycobacterium tuberculosis identification: National reference standards for Mycobacterium tuberculosis were tested at final concentrations of 10000 CFU / mL, 1000 CFU / mL, 100 CFU / mL, 10 CFU / mL, and 1 CFU / mL (three replicates). The results are shown in the table below.

[0164] The results showed that the primer set had good uniformity in detecting Mycobacterium tuberculosis complexes at different concentrations, and could stably detect the lowest concentration of 10 CFU / mL. This indicates that the primers designed in this invention for the identification of Mycobacterium tuberculosis complexes and the detection of drug resistance gene mutations can accurately and sensitively identify Mycobacterium tuberculosis complexes.

[0165] IV. Sensitivity Analysis of Drug Resistance Detection for Mycobacterium tuberculosis The sensitivity of this reagent for detecting rifampicin-resistant Mycobacterium tuberculosis was analyzed, and the results are as follows:

[0166] The results showed that the primer set had good uniformity in detecting rifampicin resistance in Mycobacterium tuberculosis complex at different concentrations, and could stably detect the lowest concentration of 100 CFU / mL.

[0167] V. Sensitivity analysis of drug resistance detection for Mycobacterium tuberculosis heterogeneity: This reagent was used to detect mixed samples of rifampicin-resistant mutant-positive and mutant-negative Mycobacterium tuberculosis reference materials (mutation-positive: mutant-negative bacterial mixture ratio: 90%, 50%, 30%, 10%, 5%, 1%). The sensitivity of heterogeneous drug resistance detection was analyzed, and the results are as follows:

[0168] The results showed that when the proportion of drug-resistant bacteria was 5% or higher, the primer set could stably detect drug-resistant mutations.

[0169] It should be noted that the detection method described in this application is only used for qualitative / quantitative detection of nucleic acids and drug resistance genes of mycobacteria and respiratory pathogens in isolated samples. The output results are the types of pathogens and drug resistance gene mutations in the sample, and cannot be used alone as a basis for diagnosing whether a subject has an infectious disease, nor is it used to predict the subject's risk of developing the disease. The core purpose of this method is to provide objective detection data for clinical use, assisting physicians in making comprehensive judgments based on clinical symptoms and other examination results.

[0170] Obviously, the embodiments described above are merely some embodiments of the present invention, and not all embodiments. The present invention can be implemented in many different forms; rather, these embodiments are provided to provide a more thorough and complete understanding of the disclosure of the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing specific embodiments, or make equivalent substitutions for some of the technical features.

Claims

1. A multiplex primer combination for the identification of mycobacteria and respiratory pathogens and the detection of their drug resistance genes, characterized in that: The nucleic acid sequences of the primer combination include those shown in SEQ ID NO:1 to SEQ ID NO:

380.

2. The multiple primer combination for identifying mycobacteria and respiratory pathogens and detecting their drug resistance genes according to claim 1, characterized in that, The primer sets include 111 primer pairs for mycobacterial identification, with nucleic acid sequences of SEQ ID NO:49 to SEQ ID NO:270; 55 primer pairs for respiratory pathogen identification, with nucleic acid sequences of SEQ ID NO:271 to SEQ ID NO:380; and 24 primer pairs for drug resistance genes, with nucleic acid sequences of SEQ ID NO:1 to SEQ ID NO:

48.

3. A method for identifying mycobacteria and respiratory pathogens in in vitro samples and detecting their drug resistance genes, characterized in that, Includes the following steps: Step S1: Nucleic acid extraction, extracting DNA and RNA from the sample as templates; Step S2: Reverse transcription, converting RNA into DNA; Step S3: Multiplex targeted amplification, configured with the multiplex primers described in claim 1 or 2 to form multiplex PCR amplification; Step S4: Connector ligation and library purification; Step S5: Sequencing and data analysis.

4. The method for identifying mycobacteria and respiratory pathogens in isolated samples and detecting their drug resistance genes according to claim 3, characterized in that: The specific process of step S1 is as follows: add an equal volume of liquefaction reagent to the sample, vortex and mix, let stand at room temperature for 10 minutes to allow the sample to fully liquefy; extract nucleic acid using the fully automated magnetic bead method, and then use the Qubit fluorometer and its matching Qubit DNA detection kit to determine the DNA concentration of the nucleic acid.

5. The method for identifying mycobacteria and respiratory pathogens in isolated samples and detecting their drug resistance genes according to claim 3, characterized in that: In step S2, the reaction system was constructed, and the amounts used per reaction were as follows: 5 μL of sample nucleic acid, 2 μL of dNTP mixture, 1 μL of oligo(dT), 1 μL of RNase inhibitor, 1 μL of reverse transcriptase, and 10 μL of nuclease-free water. The reaction conditions were: reaction temperature of 42℃, reaction time of 60 min, followed by cooling to 4℃, ready for subsequent use.

6. The method for identifying mycobacteria and respiratory pathogens in isolated samples and detecting their drug resistance genes according to claim 3, characterized in that: Step S3 includes the following steps: Step Q1: Preparation of multiplex amplification system, each reaction includes 10 μL of PCR reaction solution, 4 μL of primer mix, 1 μL of PCR enzyme, and 5 μL of sample nucleic acid; Step Q2: The amplification reaction conditions are as follows: Set the hot cap to 105 ℃ and the volume to 20 uL. Perform (1) 95℃ for 10 min; (2) 95℃ for 30 s; (3) 62℃ for 90 s; (4) 70℃ for 90 s. Repeat (2), (3), and (4) for a total of 30 times; (5) 70℃ for 10 min; (6) Cool down to 4℃ and wait for subsequent use. Step Q3: Purify the above amplified material using a nucleic acid purification kit.

7. The method for identifying mycobacteria and respiratory pathogens in isolated samples and detecting their drug resistance genes according to claim 6, characterized in that, The specific steps for step Q3 are as follows: 3.1 Equilibrate the purified magnetic beads at room temperature for 30 min; 3.2 Vortex to fully suspend the magnetic beads, add 75 μL of purified magnetic beads to the amplification product, and vortex thoroughly to mix. 3.3 Incubate at room temperature for 5 minutes to allow the DNA to fully bind to the magnetic beads. Then place the reaction tube on a magnetic rack and wait for the solution to become clear before carefully aspirating the supernatant with a pipette. 3.4 The PCR tubes were always placed on the magnetic rack. 200 μL of 80% ethanol was added to the reaction tubes and allowed to stand for 30 seconds. The supernatant was then carefully aspirated with a pipette. 3.5 Repeat step 3.4 once; 3.6 Use a 10µL pipette tip to remove any remaining cleaning solution; 3.7 The reaction tube should always be placed on the magnetic rack, and left to cool at room temperature with the lid off for 2 minutes. 3.8 Add 35 μL of elution buffer to the tube, vortex to mix and suspend the magnetic beads, let stand for 5 min, centrifuge briefly, and then place the reaction tube on a magnetic rack for 5 min. After the solution becomes clear, transfer 35 μL of supernatant to a new PCR tube for subsequent experiments.

8. The method for identifying mycobacteria and respiratory pathogens in isolated samples and detecting their drug resistance genes according to claim 3, characterized in that, In step S4, the reaction system for adapter ligation consists of the following amounts per reaction: 16 μL adapter ligation buffer, 10 μL ligase, 7 μL NF water, 2 μL 3' adapter, 2 μL 5' adapter, and 45 μL library from the previous step. The reaction conditions are: reaction temperature 25°C for 15 min, followed by a cooling to 4°C.

9. A method for identifying mycobacteria and respiratory pathogens in isolated samples and detecting their drug resistance genes according to claim 3, characterized in that, In step S5, DNA sequence detection is performed using the Ullumina NextSeq500 and a universal sequencing reaction kit.