Transposon insertion molecular marker related to bending proportion of beach wool strand and application of transposon insertion molecular marker

Abstract

The invention relates to the technical field of animal molecular breeding and genetic engineering, and provides a transposon insertion molecular marker related to the bending proportion of a beach wool strand and application of the transposon insertion molecular marker. According to the application, the insertion of a 2917bp transposon which is remarkably related to the hair bending ratio is identified on the No.13 chromosome of the Tan sheep for the first time, and a corresponding PCR-gel electrophoresis typing method is established; the molecular marker is extremely high in phenotype relevance, and early and accurate prediction of the bending proportion of the beach wool strand can be achieved. When the marker is used for auxiliary selection, the breeding cycle can be remarkably shortened, the feeding cost can be reduced, the genetic improvement of the quality of the Tan sheep fur can be accelerated, and the marker has great economic and social benefits.

Description

Technical Field

[0001] This application relates to the field of animal molecular breeding and genetic engineering technology. Specifically, this application provides a transposon insertion molecular marker related to the curvature ratio of Tan wool strands and its application. Background Technology

[0002] Tan sheep is a unique fur-producing sheep breed in my country. Its core genetic characteristic is the distinctive "double-wool fur" phenotype exhibited by lambs at 30-40 days of age (indicators such as the proportion and number of curls in the wool strands have been included in the national standard GB / T2033-2008). Currently, the breeding of Tan sheep mainly relies on traditional phenotypic selection, that is, selecting based on the quality of the adult sheep's wool. This method has inherent drawbacks such as a long cycle (requiring waiting until the sheep reach adulthood), high cost, low efficiency, and accuracy being easily affected by environmental factors, which seriously restricts the improvement process of Tan sheep germplasm resources.

[0003] With the development of molecular biology, marker-assisted selection (MAS) has provided a new solution for animal breeding. Structural variation (SV), especially transposon insertion, is an important type of genetic variation in the genome, which can participate in the formation of important economic traits by affecting gene structure or expression regulation. If transposon insertion molecular markers closely linked to the bending ratio of Tan sheep wool can be discovered and rapid, low-cost detection methods can be established, then precise selection can be achieved in the early stages of Tan sheep breeding, even during the embryonic period, significantly shortening the generation interval and accelerating genetic progress.

[0004] Currently, there are no reports of transposon insertions in specific regions of chromosome 13 in Tan sheep being associated with wool curvature ratio. Therefore, identifying transposon insertion molecular markers related to the wool curvature ratio in Tan sheep is of great significance for achieving molecular breeding of Tan sheep and improving the efficiency of the fur industry. Summary of the Invention

[0005] On the one hand, this application provides a transposon insertion molecular marker related to the curvature ratio of Tan wool strands, wherein the nucleotide sequence of the transposon insertion molecular marker is SEQ ID NO.

[0006] On the other hand, this application provides a method for identifying the curvature ratio of Tan wool strands using the aforementioned transposon insertion molecular markers.

[0007] Furthermore, the method includes PCR amplification of the target Tan sheep DNA sample using a primer set consisting of primers F1, R1, and R2. The nucleotide sequence of primer F1 is SEQ ID NO.4, the nucleotide sequence of primer R1 is SEQ ID NO.5, and the nucleotide sequence of primer R2 is SEQ ID NO.6.

[0008] The Tan sheep DNA sample can be extracted from various tissues and organs of the Tan sheep, including but not limited to skin, blood, hair follicles, and excrement. The extraction method can be any method known in the art or a commercially available kit.

[0009] Furthermore, the method includes detecting PCR amplification products by agarose gel electrophoresis, determining the genotype of the main body of the Tan sheep DNA sample based on the band size, and judging the curvature ratio of its Tan sheep wool strands:

[0010] The presence of only a 528bp band indicates a non-inserted homozygote.

[0011] The presence of both 528bp and 288bp bands indicates a heterozygote.

[0012] The presence of only a 288bp band indicates an insertion homozygote;

[0013] The proportion of hair curvature in the sample body with inserted homozygous Tan sheep DNA was higher than that in the sample body with inserted heterozygous Tan sheep DNA, and the proportion of hair curvature in the sample body with inserted heterozygous Tan sheep DNA was higher than that in the sample body without inserted homozygous Tan sheep DNA.

[0014] Furthermore, the PCR reaction system in the PCR amplification is 20 μL, containing: 10.0 μL of 2×Taq PCR MasterMix, 50-100 ng of template DNA, 0.4 μM each of primer F1, primer R1, and primer R2, and double-distilled water to make up to 20 μL.

[0015] Furthermore, the PCR reaction procedure in the PCR amplification is as follows: pre-denaturation at 95°C for 5 minutes; then 35 cycles, each cycle consisting of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds; and finally extension at 72°C for 5 minutes.

[0016] On the other hand, this application provides the application of the above-mentioned methods or molecular markers in Tan sheep breeding, wherein the application is used to select Tan sheep individuals with a high wool curvature ratio, and wherein Tan sheep individuals with an insert homozygous or heterozygous genotype are selected for breeding.

[0017] On the other hand, this application provides a kit for identifying the curvature ratio of Tan wool strands, the kit comprising primer F1, primer R1 and primer R2, wherein the nucleotide sequence of primer F1 is SEQ ID NO., the nucleotide sequence of primer R1 is SEQ ID NO., and the nucleotide sequence of primer R2 is SEQ ID NO.

[0018] Furthermore, the kit contains one or more components selected from DNA polymerase, magnesium ions, dNTPs, and buffer solutions.

[0019] Furthermore, the kit also includes DNA extraction reagents.

[0020] Beneficial effects:

[0021] This invention is the first to identify a 2917bp transposon insertion on chromosome 13 of Tan sheep that is highly correlated with the proportion of wool curvature, providing a novel molecular marker with independent intellectual property rights.

[0022] The primer set designed and the PCR-gel electrophoresis typing method established in this invention are simple, rapid, and inexpensive to operate, and the results are clear and reliable. They can be completed in ordinary molecular laboratories and are particularly suitable for promotion and application in grassroots breeding farms.

[0023] This molecular marker exhibits a strong correlation with phenotype, enabling early and accurate prediction of the crimp ratio of Tan sheep wool. Using this marker for assisted selection can significantly shorten the breeding cycle, reduce feeding costs, and accelerate the genetic improvement of Tan sheep fur quality, yielding substantial economic and social benefits. Attached Figure Description

[0024] Figure 1 A schematic diagram of PCR identification of the bending ratio of Tan sheep wool strands, where genotype A / A represents homozygous target transposon insertion, A / - represents heterozygous target transposon insertion, and - / - represents no target transposon insertion.

[0025] Figure 2 This is an electrophoresis diagram of PCR amplification products used for genotyping in an embodiment of the present invention; M: DNA molecular weight standard; Lane 1: non-inserted homozygote; Lane 2: heterozygote; Lane 3: inserted homozygote.

[0026] Figure 3 A comparison chart of the wool curvature ratios of three different genotypes of Tan sheep. Detailed Implementation

[0027] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0028] Example 1: Discovery and Validation of Transposon Insertion of Molecular Markers

[0029] Experimental animals and phenotypic records: Fifty adult Tan sheep with representative wool curvature ratios were used as research subjects, and the wool curvature ratio of each sheep was accurately recorded.

[0030] Genomic DNA Extraction: High-quality genomic DNA was extracted from anticoagulated blood samples from the jugular vein using the Tiangen Biotech Blood Genomic DNA Extraction Kit, following the instructions. DNA concentration and purity were measured using a micro-spectrophotometer and stored at -20°C for later use.

[0031] Abnormal Fragment Detection and Insertion Identification: PCR amplification and sequencing were performed using pre-designed primers across the suspected region, revealing enlarged expected fragments in some individuals. Through long-fragment amplification and sequencing, a 2917 bp DNA sequence insertion was finally identified at locus 49863916 on chromosome 13 of the Tan sheep reference genome ARS-UI_Ramb_v3.0. This sequence was submitted to the Dfam database for alignment and was predicted to be a transposon sequence.

[0032] Genotyping primer design: To establish a rapid and low-cost genotyping method, a specific downstream primer R2 was designed within the 2917 bp insert sequence. Pairing it with primer F1, located upstream of the insert site, amplifies a fragment of approximately 300 bp. Simultaneously, using primers F1 and R1 spanning the original insert site, a wild-type fragment of approximately 500 bp can be amplified.

[0033] DNA insert sequence (SEQ ID NO.1):

[0034]

[0035] An amplified 288bp fragment sequence (SEQ ID NO.2):

[0036] GGCCAAGCCAAGCTAGTTACACTTTCAAATTACTTGATTTTCTTATATTTTATCAGGAAGAATTGGGGGGTGGTGCTATAGGTTTAGAATTTATCCAGCAGTAGCCATTGAAATATCTGATGTAAGAGAAGTCACGTATTTTTTTTTTTGTTTGTTTTTTGTTTTTTTTTTTTTAATTTTAGTTTTTTATTTTTTAAATTTTAAAATCTTTAATTCTTACATGCATTCCCAAACATGAACCCCCCTCCCACCTCCCTCCCCATAATATCTTCTGGGTCATCCCCATGC

[0037] An amplified 528bp fragment sequence (SEQ ID NO.3):

[0038] GGCCAAGCCAAGCTAGTTACACTTTCAAATTACTTGATTTTCTTATATTTTATCAGGAAGAATTGGGGGGTGGTGCTATAGGTTTAGAATTTATCCAGCAGTAGCCATTGAAATATCTGATGTAAGAGAAGTCATGTATTAAGTAACTGTGGATATCATAAGGATCTTCCCTGGTGGTTCATATGATATAGAATCTGCCTGCAATGCAAGAGACCCAAGTTCAATCCTTGGGTTGGGAAGATACCCTGGAGAAGGGAATAACAACCCACTCCAGTATTCTTGCCTGGAGAATTCCATGGACACAAGAGCCTGGTGGGCTACTGTCCATGGGGTTGCAAAGAGTTGGACACAACTGAGCGACTAATACTTTCATTTCACTTTTTGATATCATAAAGACTCTAATAAAATAATGAGATGGGAGAATCATAATGTTTTTATTTTGACAGTGATATTAGAAAAGTTTCACTCCGATTCCTCTTCAAGCATTCTTTTAGCTTTACAGTGTCTGTTGGCTTTCTTCATTGAGCA

[0039] Example 2: Genotyping and Phenotypic Association Analysis of Tan Sheep Population

[0040] PCR genotyping

[0041] Primer sequence: F1: 5'-GGCCAAGCCAAGCTAGTTAC-3' (SEQ ID NO.4);

[0042] R1: 5'-TGCTCAATGAAGAAAGCCAACAG-3' (SEQ ID NO.5);

[0043] R2: 5'-GCATGGGGATGACCCAGAAG-3' (SEQ ID NO.6);

[0044] Reaction system:

[0045] The PCR reaction system is 20 μL, containing: 10.0 μL of 2×Taq PCR MasterMix, 50-100 ng of template DNA, 0.4 μM each of primers F1, R1, and R2, and double-distilled water to make up to 20 μL.

[0046] PCR reaction procedure:

[0047] Pre-denaturation at 95°C for 5 minutes; then perform 35 cycles, each cycle consisting of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds; finally extend at 72°C for 5 minutes.

[0048] Electrophoretic testing:

[0049] Take 5 μL of PCR product and perform electrophoresis on a 1.5% agarose gel. Observe and photograph under UV light.

[0050] Genotyping: Based on the electrophoresis results, the 50 Tan sheep individuals were divided into three genotypes:

[0051] Uninserted homozygotes: Only one band of about 500 bp was observed.

[0052] Heterozygote: Two lines of approximately 500bp and approximately 300bp are present simultaneously.

[0053] Insertion homozygote: Only one band of about 300bp was observed.

[0054] Association analysis results as follows Figure 2As shown: Statistical analysis was performed on genotypic data and wool curvature ratio phenotypic data. One-way ANOVA was used for comparison, and the results showed highly significant differences in wool curvature ratio among the three genotypes. The wool curvature ratio of the inserted homozygous individuals was significantly higher than that of the heterozygous individuals, and the wool curvature ratio of the heterozygous individuals was significantly higher than that of the non-inserted homozygous individuals. This indicates a highly significant positive correlation between this transposon insertion marker and the high wool curvature ratio trait in Tan sheep.

[0055] The effect of this molecular marker was subsequently validated in a population of 500 Tan sheep. The results showed that the target production trait corresponding to the dominant genotype was significantly better than that of other genotypes. Specifically, the A / A genotype improved by about 30 percentage points compared to the - / A genotype and by about 90 percentage points compared to the - / - genotype, further confirming that the marker can be stably used for trait-assisted selection.

[0056] Example 3: Application of molecular markers in early selection of Tan sheep. In the core breeding farm of Tan sheep, the molecular markers of the present invention can be used for early selection.

[0057] Genomic DNA was extracted from the candidate Tan sheep lambs.

[0058] Genotyping was performed using the PCR method and system described in Example 2.

[0059] Genotype is determined based on electrophoresis results.

[0060] Breeding decisions: With the goal of developing a new breed of Tan sheep with a high proportion of wool curliness, priority will be given to selecting homozygous individuals for the core breeding group; heterozygous individuals can be used as a selection group to maintain the genetic diversity of the population and continue breeding; individuals that are not homozygous can be considered for commercial sheep.

[0061] This method allows for accurate prediction of an individual's future fur quality early in life, enabling precise and efficient breeding and significantly improving breeding efficiency.

[0062] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A transposon insertion molecular marker related to the curvature ratio of Tan wool strands, characterized in that, The nucleotide sequence of the transposon inserted molecular marker is SEQ ID NO.

2. A method for identifying the curvature ratio of Tan wool strands using transposon insertion molecular markers as described in claim 1.

3. The method according to claim 2, wherein the method comprises PCR amplification of the target Tan sheep DNA sample using a primer set consisting of primer F1, primer R1, and primer R2; wherein the nucleotide sequence of primer F1 is SEQ ID NO.4, the nucleotide sequence of primer R1 is SEQ ID NO.5, and the nucleotide sequence of primer R2 is SEQ ID NO.

6.

4. The method according to claim 2, further comprising detecting PCR amplification products by agarose gel electrophoresis, determining the genotype of the main body of the Tan sheep DNA sample based on the band size, and determining the proportion of Tan sheep wool strand curvature: The presence of only a 528bp band indicates a non-inserted homozygote. The presence of both 528bp and 288bp bands indicates a heterozygote. The presence of only a 288bp band indicates an insertion homozygote; The proportion of hair curvature in the sample body with inserted homozygous Tan sheep DNA was higher than that in the sample body with inserted heterozygous Tan sheep DNA, and the proportion of hair curvature in the sample body with inserted heterozygous Tan sheep DNA was higher than that in the sample body without inserted homozygous Tan sheep DNA.

5. The method according to any one of claims 2-4, wherein the PCR reaction system in the PCR amplification is 20 μL, comprising: 10.0 μL of 2×Taq PCR MasterMix, 50-100 ng of template DNA, 0.4 μM each of primer F1, primer R1, and primer R2, and double-distilled water to a final volume of 20 μL.

6. The method according to any one of claims 2-4, wherein the PCR reaction program in the PCR amplification is as follows: pre-denaturation at 95°C for 5 minutes; then 35 cycles, each cycle including 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds; and finally extension at 72°C for 5 minutes.

7. The method according to any one of claims 2-6 or the application of the transposon insertion molecular marker according to claim 1 in the breeding of Tan sheep, wherein the application is used to select Tan sheep individuals with a high wool curvature ratio, and wherein Tan sheep individuals with a genotype of insertion homozygote or heterozygote are selected for breeding.

8. A reagent kit for identifying the curvature ratio of Tan wool strands, characterized in that, The kit contains primers F1, R1, and R2, wherein the nucleotide sequence of primer F1 is SEQ ID NO., the nucleotide sequence of primer R1 is SEQ ID NO., and the nucleotide sequence of primer R2 is SEQ ID NO.

9. The kit according to claim 8, wherein the kit comprises one or more components selected from DNA polymerase, magnesium ions, dNTPs, and buffer.

10. The kit according to claim 8 or 9, wherein the kit further comprises a DNA extraction reagent.

Images