Pig lactation performance related molecular marker and application thereof in breeding

By detecting the SNP sites of A/G mutations on chromosome 7 of the pig reference genome Sscrofa11.1, and using primer pairs U and D for PCR amplification and sequencing, the problem of difficult assessment of pig lactation capacity was solved, enabling early precision breeding and improving breeding efficiency and economic benefits.

CN122012754APending Publication Date: 2026-05-12INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-04-15
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately assess pig lactation capacity, resulting in inefficient traditional breeding methods, slow genetic progress, and an inability to achieve precise selection in the early stages.

Method used

By detecting the SNP site of the A/G mutation at position 25241438 (5' end) on chromosome 7 of the pig reference genome Sscrofa11.1, PCR amplification and sequencing were performed using primer pairs U and D to determine the genotype, and individuals with the preferred dominant allele A were selected for breeding.

Benefits of technology

It enables accurate prediction of pig lactation performance in the early stages, improves breeding efficiency, shortens the breeding process, increases economic benefits, and enhances the lactation capacity of pig herds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012754A_ABST
    Figure CN122012754A_ABST
Patent Text Reader

Abstract

The invention relates to a molecular marker related to pig lactation performance, an SNP (Single Nucleotide Polymorphism) site of the molecular marker corresponds to A / G mutation of a 25241438th base polymorphic site from the 5tail end on a No.7 chromosome of a pig reference genome Sscrofa11.1 in a GenBank database, the polymorphism of the base at the site leads to different pig lactation capacities, when the SNP site mononucleotide is A, the pig lactation capacity is high, when the SNP site mononucleotide is A, the pig lactation capacity is high, and when the SNP site mononucleotide is B, the pig lactation capacity is high, and when the SNP site mononucleotide is A, the pig lactation capacity is high. When the SNP site mononucleotide is G, the lactation ability of the pig is low. According to the method, the pigs to be selected can be subjected to early screening, the breeding cost can be reduced, the method is high in accuracy and low in detection cost, automatic detection can be achieved, and the method has high application value in the pig breeding aspect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of porcine genetic marker screening technology in molecular biology, specifically involving molecular markers related to the level of porcine lactation, their detection primers, and applications. Background Technology

[0002] Pig lactation capacity is a key indicator for measuring sow reproductive performance and nursing ability, directly affecting piglet survival rate, weaning weight, and the overall economic benefits of pig farms. However, pig lactation capacity is a complex quantitative trait, and its phenotype is difficult to measure directly and accurately. Currently, it is mainly assessed by measuring indirect indicators such as litter weaning weight and daily weight gain of piglets. This assessment method is not only time-consuming and labor-intensive, but also susceptible to interference from various environmental factors such as sow parity, nutritional level, and feeding management, and cannot accurately reflect its genetic potential. This results in low efficiency and slow genetic progress when traditional breeding methods are used to select high-lactation breeding pigs.

[0003] With the development of molecular biology techniques, marker-assisted selection has become an important tool for improving the efficiency of livestock breeding. Its core lies in discovering genetic markers that are closely linked to or have a causal effect on target traits. If molecular markers significantly associated with pig lactation can be found and applied to breeding practices, lactation performance can be accurately predicted through genotyping in the early stages of pig growth, unaffected by environmental factors. This enables early and precise selection, significantly accelerating the development of high-lactation pig breeds and playing a crucial role in enhancing the core competitiveness of the pig industry. Therefore, we propose a molecular marker related to pig lactation performance and its application in breeding. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, the primary objective of this invention is to provide a molecular marker related to porcine lactation performance and its application in breeding to solve the problems mentioned in the background art.

[0005] Another objective of this invention is to provide a molecular marker related to porcine lactation performance. The SNP site of the molecular marker corresponds to an A / G mutation at the 25241438th polymorphic base position (5' end) on chromosome 7 of the porcine reference genome Sscrofa11.1 in the GenBank database. This polymorphism leads to different levels of lactation capacity in porcines. Specifically, when the single nucleotide at the SNP site is A, the lactation capacity of porcines is high; when the single nucleotide at the SNP site is G, the lactation capacity of porcines is low.

[0006] Furthermore, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is A or G.

[0007] Furthermore, the primer pair used for detecting molecular markers includes upstream primer U and downstream primer D:

[0008] U: 5'-GGACATCAAGAACACCTGGGT-3', SEQ ID No. 2;

[0009] D: 5'-GCTCCCCTTTCCAGTCATC-3', SEQ ID No. 3.

[0010] Furthermore, the kit for detecting the molecular markers includes the primer pair as described in claim 3.

[0011] Furthermore, the pigs mentioned include Large White pigs and their synthetic lines.

[0012] Furthermore, the method for identifying the level of lactation in pigs includes the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on chromosome 7 of pigs, and determining the level of lactation in pigs based on the genotype of the SNP site. Pigs with the AA genotype of the SNP site have higher lactation capacity than pigs with the AG genotype, and pigs with the AG genotype have higher lactation capacity than pigs with the GG genotype.

[0013] The AA genotype pigs are those whose base position 25241438 from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1 is A;

[0014] The AG genotype pigs are those whose bases are A and G at position 25241438 from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1;

[0015] The pigs with the GG genotype are those whose base position 25241438 from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1 is G;

[0016] The pig reference genome Sscrofa11.1 is a pig reference genome sequence from the GenBank database.

[0017] Furthermore, the method for selecting pig breeds with high lactation capacity includes the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on pig chromosome 7, eliminating individuals whose single nucleotide of the SNP site is G, and retaining individuals whose single nucleotide of the SNP site is A as breeding pigs; the pigs include Large White pigs and their synthetic lines.

[0018] Furthermore, the detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products; (3) Perform first-generation Sanger sequencing on the PCR amplification products to obtain the sequencing results; (4) Determine the genotype based on the sequencing results.

[0019] Furthermore, the method for genetic improvement of pigs includes the following steps: identifying the molecular markers described in claim 1 or 2 for breeding pigs in the core breeding population, and making corresponding selections based on the molecular markers: selecting breeding pig individuals with the AA or AG genotype at position 25241438 from the 5' end of chromosome 7 of the Sscrofa11.1 reference genome, and culling breeding pig individuals with the GG genotype at that position, so as to increase the frequency of allele A at that locus generation by generation, thereby improving the lactation capacity of offspring pigs; the pigs include Large White pigs and their synthetic lines.

[0020] The application of a molecular marker related to pig lactation performance in breeding, wherein the molecular marker is used to select pig breeds with high lactation capacity.

[0021] This invention utilizes a method that detects the bases at the g.25241438A>G polymorphism site on chromosome 7 of the pig reference genome Sscrofa11.1 to determine the genotype of individual pigs and select for pigs with higher lactation capacity. The method provided by this invention allows for early screening of pigs, reducing breeding costs. It is highly accurate, inexpensive, and can be automated, making it highly valuable for pig breeding.

[0022] (1) This invention detected a significant molecular marker associated with pig lactation capacity on the nucleotide sequence of chromosome 7 of pigs through genome-wide association study (GWAS). This invention established the molecular marker-assisted selection breeding technology, which shortened the process of breeding large white pigs and their synthetic lines with high lactation capacity, met market demand, and contributed to increasing sales profits and improving core competitiveness for enterprises.

[0023] (2) This invention provides a primer pair and kit for detecting SNP molecular markers on chromosome 7 of pigs that are related to pig lactation. With this primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits. This technology can be applied to the genetic improvement of related traits in breeding pigs to improve the superior qualities of pigs, accelerate the breeding process, and thus increase enterprise profits and core competitiveness.

[0024] (3) This invention provides a method for pig breeding by selecting the dominant allele of the molecular marker, which can accelerate the genetic progress of pig herds and thus effectively improve the economic benefits of breeding. This invention can ultimately improve the lactation capacity of commercial pigs and increase economic benefits by selecting the dominant allele A with high lactation capacity in pigs from SNP molecular marker individuals. Attached Figure Description

[0025] Figure 1 This is a graph showing the results of a genome-wide association study (GWAS) analysis of porcine lactation capacity on chromosome 7 in Large White pigs.

[0026] Figure 2 These are the sequencing results of individual pigs with AA, AG, and GG genotypes near the SSC7 g.25241438A>G polymorphic site. Detailed Implementation

[0027] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments, but the implementation of the present invention is not limited thereto.

[0028] The pig reference genome sequence in the following examples all refers to Sscrofa11.1.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0030] Example 1: Identifying the level of lactation capacity in pigs

[0031] I. Laboratory Animals and Determination of Lactation Capacity

[0032] The experimental pig herds used in this invention were all from breeding pig groups of Shanxi Changrong Agricultural Technology Co., Ltd. and Liaoning Weijia Agricultural and Livestock Ecological Food Co., Ltd.

[0033] This experiment selected 844 sows from the herd, with parity records ranging from 1 to 5. Since the sows lacked milk storage facilities, directly measuring their milk production capacity was impractical. Therefore, we weighed all piglets at birth, death, weaning, and fostering. The weight gain of each sow nursing all her piglets was used as the sow's lactation phenotype and considered a potential indicator of milk production capacity. Greater piglet weight gain indicates higher sow lactation capacity, and vice versa. The formula for calculating the weight gain of a sow nursing all her piglets is as follows:

[0034] .

[0035] II. Chip SNP Classification and Filling

[0036] Ear samples were taken from the phenotypic record population, ground in liquid nitrogen, and whole-genome DNA was extracted using the standard phenol-chloroform method. The DNA quality of each sample was accurately determined using a Nanodrop 2000 / 2000C nucleic acid and protein analyzer. Qualified DNA samples were sent to Neocate Biotechnology (Shanghai) Co., Ltd., where porcine whole-genome 50K microarray analysis (GenSeek Genomic Profiler Porcine, 50,697 SNPs, Illumina, San Diego, CA, United States) was performed according to the company's standard procedures. The microarray data was populated using the online platform Pig Haplotypes Reference Panel (https: / / alphaindex.zju.edu.cn / PHARP / index.php). Quality control of all data after population was performed using PLINK software, ultimately yielding valid genotype data for 9,047,887 SNPs, which were used for genome-wide association analysis of lactation performance.

[0037] III. Genome-wide association analysis

[0038] Association analysis between SNPs and lactation phenotypes was performed using GCTA software. The significance threshold for the association between SNPs and lactation trait was 1×10⁻⁶. -5 The GWAS analysis results are as follows: Figure 1 As shown. By Figure 1 It was found that there is a locus on chromosome 7 that significantly affects the level of lactation in pigs, and the SNP locus g.25241438A>G is significantly correlated with pig lactation (P < 2.82 × 10⁻⁶). -6 The lactation capacity of AA individuals in the population was significantly higher than that of GG individuals, while the lactation capacity of AG individuals was intermediate between the two homozygous types. This indicates that this molecular marker significantly affects lactation capacity in pigs, and can be used for marker-assisted selection to improve the lactation capacity of this population, thereby accelerating the breeding process for the lactation trait.

[0039] IV. Determination of the polymorphism of porcine SNP site SSC7: g.25241438A>G

[0040] (1) Genomic DNA was extracted from three pig ear samples.

[0041] (2) Primer design and synthesis

[0042] Based on the pig reference genome Sscrofa11.1 sequence, the following primers were designed and synthesized:

[0043] U (upstream primer): 5'-GGACATCAAGAACACCTGGGT-3' (SEQ ID No. 2);

[0044] D (downstream primer): 5'-GCTCCCCCTTTCCAGTCATC-3' (SEQ ID No. 3).

[0045] (3) PCR amplification

[0046] Using the genomic DNA of the three pigs obtained in step (1) as templates, and U and D as primers, PCR amplification was performed to obtain PCR amplification products, which were named products 1, 2 and 3, respectively.

[0047] PCR amplification system: 100 ng genomic DNA, 10 µL 2×Es Taq MasterMix (Dye), 1 µL each of 10 µM upstream and downstream primers, and ddH2O to bring the system to 20 µL.

[0048] PCR amplification program: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 32 cycles; final extension at 72℃ for 10 minutes.

[0049] (4) Sequencing and sequence analysis

[0050] Products 1, 2, and 3 were sequenced, yielding their sequences. The three product sequences differed by only one base, located at position 149 from the 5' end of each sequence. This position contained an A / G mutation. Figure 2 As shown in the image. This site is the 25241438th base from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1, therefore it is named SSC7: g.25241438A>G. ​​The primer amplification sequence SEQ ID No.1 is as follows:

[0051] GGACATCAAGAACACCTGGGTTTCTTTTATAGGGTCGGGGAGGAGGCATGTACTGAACGATCAGTCACTTCAGGAAGGGCAAGGGGTCTCGAAAGGACTTCAGGCCTGGCAGGTCAAGGGGCCATGGGGAAGTTCACTCAAGGATGTGGMGT CACAGGAAAACAGGAAATGAAAGTGGAGAGGCAGGAAGTGGGTCACAACCTCTCACCTGGGGACTGCTGACAGGCCCGGAGAATCCTGGGGGAGCTGGAGGGGGCAGACCAGGGGACCCCATGGAAGAGCTGATGACTGGAAAGGGGGAGC

[0052] Individuals whose genotype is A at position 25241438 from the 5' end of chromosome 7 of the pig reference genome Sscrofa11.1, or at position 149 from the 5' end of the PCR amplification product obtained in step (3), are homozygous individuals, and their genotype is named AA. Individuals whose genotype is G at position 25241438 from the 5' end of chromosome 7 of the pig reference genome Sscrofa11.1, or at position 149 from the 5' end of the PCR amplification product obtained in step (3), are homozygous individuals, and their genotype is named GG. Individuals whose genotype is both A and G at position 25241438 from the 5' end of chromosome 7 of the pig reference genome Sscrofa11.1, or at position 149 from the 5' end of the PCR amplification product obtained in step (3), are heterozygous individuals, and their genotype is named AG.

[0053] V. Validation analysis of phenotypic differences in lactation capacity among different genotypes of SSC7:25241438A / G in the population

[0054] To verify the correlation between the SSC7:25241438A / G polymorphism and the porcine lactation trait, a new Large White pig population exhibiting lactation phenotype was used as experimental material, and the following experiment was conducted:

[0055] (1) Genomic DNA was extracted from the ear margin tissue of each pig and PCR amplified according to the method in section 4. After obtaining each PCR amplification product, the genotype of each pig was determined by sequencing and sequence analysis.

[0056] (2) Record the lactation phenotype, pedigree information and batch effects of each pig.

[0057] (3) The association between pig genotype and pig lactation capacity was analyzed using the least squares method. The model used was Y = μ + G + N + B + e, where Y is the lactation capacity phenotypic value, G is the genotype effect, N is the effect of the number of piglets suckled by the sow, B is the batch effect, and e is the residual effect. The results are shown in Table 1.

[0058]

[0059] Table 1 shows that the lactation capacity of AA genotype pigs was significantly higher than that of AG and GG genotype pigs (P < 0.01), and the lactation capacity of AG genotype pigs was significantly higher than that of GG genotype pigs (P < 0.01).

[0060] The results showed that the polymorphism at position 25241438 (from the 5' end) on chromosome 7 of the pig reference genome Sscrofa11.1, as determined in this invention, was consistent with the actual measured results of pig lactation capacity. In practical breeding, to obtain pigs with higher lactation capacity, it is best to select pigs with the AA genotype for breeding.

[0061] This invention provides a SNP molecular marker that can significantly improve the lactation performance of pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of Large White pigs with high lactation capacity. The lactation capacity of AA-type individuals is 62.0216±2.2848 kg, while that of GG-type individuals is 43.5184±1.9732 kg. The lactation capacity of AA-type individuals is significantly higher than that of GG-type individuals. If this invention can convert all GG-type individuals into AA-type individuals, it will significantly improve the lactation capacity of the pig herd, thereby increasing the survival rate of piglets. The potential economic benefits for a large-scale pig farm with tens of thousands of pigs are enormous. In individuals with this SNP molecular marker, by selecting the dominant allele A of this SNP, the economic benefits of commercial pigs can ultimately be improved, thereby increasing the profits of the enterprise.

[0062] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A molecular marker related to porcine lactation performance, characterized in that: The SNP site of the molecular marker corresponds to the A / G mutation at the 25241438th base polymorphism site on chromosome 7 of the pig reference genome Sscrofa11.1 in the GenBank database, starting from the 5' end. The polymorphism at this site leads to different lactation capacity in pigs. Specifically, when the single nucleotide of the SNP site is A, the lactation capacity of pigs is high; when the single nucleotide of the SNP site is G, the lactation capacity of pigs is low.

2. The molecular marker related to porcine lactation performance according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where M in the sequence is A or G.

3. The molecular marker related to porcine lactation performance according to claim 1, characterized in that: Primer pairs used for detecting molecular markers include upstream primer U and downstream primer D: U: 5'-GGACATCAAGAACACCTGGGT-3', SEQ ID No. 2; D: 5'-GCTCCCCTTTCCAGTCATC-3', SEQ ID No.

3.

4. The molecular marker related to porcine lactation performance according to claim 3, characterized in that: The kit for detecting the molecular markers described herein includes the primer pair as described in claim 3.

5. The molecular marker related to porcine lactation performance according to claim 4, characterized in that: The pigs mentioned include Large White pigs and their synthetic lines.

6. A molecular marker related to porcine lactation performance according to claim 1 or 2, characterized in that, The method for determining the level of lactation in pigs includes the following steps: Detect the SNP site of the molecular marker described in claim 1 or 2 on chromosome 7 of pigs, and determine the level of lactation capacity of pigs based on the genotype of the SNP site. Pigs with the AA genotype of the SNP site have higher lactation capacity than pigs with the AG genotype, and pigs with the AG genotype have higher lactation capacity than pigs with the GG genotype. The AA genotype pigs are those whose base position 25241438 from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1 is A; The AG genotype pigs are those whose bases are A and G at position 25241438 from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1; The pigs with the GG genotype are those whose base position 25241438 from the 5' end on chromosome 7 of the pig reference genome Sscrofa11.1 is G; The pig reference genome Sscrofa11.1 is a pig reference genome sequence from the GenBank database.

7. A molecular marker related to porcine lactation performance according to claim 1 or 2, characterized in that, The method for selecting pig breeds with high lactation capacity includes the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on pig chromosome 7, eliminating individuals whose single nucleotide of the SNP site is G, and retaining individuals whose single nucleotide of the SNP site is A as breeding pigs; the pigs include Large White pigs and their synthetic lines.

8. A molecular marker related to porcine lactation performance according to claim 3 or 4, characterized in that, The detection method includes the following steps: (1) extracting genomic DNA from the pig to be tested; (2) Using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products; (3) Perform first-generation Sanger sequencing on the PCR amplification products to obtain the sequencing results; (4) Determine the genotype based on the sequencing results.

9. A molecular marker related to porcine lactation performance according to claim 1 or 2, characterized in that, The method for genetic improvement of pigs includes the following steps: identifying the molecular markers described in claim 1 or 2 for breeding pigs in the core breeding population, and making corresponding selections based on the molecular markers: selecting breeding pig individuals with the AA or AG genotype at position 25241438 from the 5' end of chromosome 7 of the Sscrofa11.1 reference genome, and culling breeding pig individuals with the GG genotype at that position, in order to increase the frequency of allele A at that locus generation by generation, thereby improving the lactation capacity of offspring pigs; the pigs include Large White pigs and their synthetic lines.

10. The application of a molecular marker related to porcine lactation performance in breeding, characterized in that, The molecular markers described in claim 1 or 2 are used to breed pig breeds with high lactation capacity.