Composite hydrogels and methods of making and using the same

By preparing a double-network hydrogel on a mesh metal substrate and grafting CD63 aptamer DNA long chains, the complexity and high cost of traditional exosome isolation methods are solved, achieving efficient and specific separation and enrichment of exosomes, and improving separation purity and exosome integrity.

CN122060213BActive Publication Date: 2026-07-28天津大学浙江研究院
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610519908.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-04-20
Publication Date
2026-07-28
Estimated Expiration
2046-04-20

AI Technical Summary

Technical Problem

Traditional exosome separation methods are complex, costly, and prone to damaging exosomes. Existing hydrogel separation methods are difficult to achieve efficient and specific capture and high-purity exosome separation.

Method used

A dual-network hydrogel was prepared using a mesh metal substrate as a template. Combined with DNA long chain modification, a regular three-dimensional macroporous structure and abundant CD63 aptamer capture sites were formed. DNA long chains were grafted onto the surface of the hydrogel through an amidation reaction, achieving specific and efficient separation and enrichment of exosomes.

Benefits of technology

This method achieves efficient and specific separation and enrichment of exosomes, improves separation purity, reduces operational complexity and cost, and ensures the integrity and biological activity of exosomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060213B_ABST
    Figure CN122060213B_ABST
Patent Text Reader

Abstract

The application discloses a composite hydrogel and a preparation method and application thereof, and the preparation method comprises the following steps: immersing a reticular metal substrate into a first prepolymer solution, and then cross-linking and polymerizing after taking out; immersing into a second prepolymer solution, and then cross-linking and polymerizing after taking out; dissolving and removing the reticular metal substrate to obtain a double-network hydrogel; and modifying the double-network hydrogel by using a DNA long chain to obtain the composite hydrogel, wherein the 5' end amino group of the DNA long chain is modified and grafted on the double-network hydrogel through an amidation reaction, and the DNA long chain comprises a plurality of repeated CD63 aptamer sequences. The reticular metal substrate is used as a template to sequentially initiate polymerization to form the double-network hydrogel, the internal regular three-dimensional macroporous structure is ensured, and exosomes can easily diffuse into the material interior; the DNA long chain comprising the plurality of repeated CD63 aptamer sequences is combined with carboxyl groups of the double-network hydrogel to form rich capture sites, and specific and efficient separation and enrichment of exosomes in a sample can be realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of exosome separation technology, specifically relating to a composite hydrogel, its preparation method, and its application. Background Technology

[0002] Exosomes are widely distributed in various body fluids, including blood, and have important applications in disease diagnosis, prognostic assessment, and treatment monitoring. However, efficient capture, separation, and enrichment of exosomes remain technical challenges. Traditional methods, such as ultracentrifugation and immunomagnetic beads, achieve exosome separation, but these methods are complex, costly, and prone to damaging the exosomes. Summary of the Invention

[0003] The purpose of this application is to provide a composite hydrogel, its preparation method, and its application, so as to solve the technical problems of traditional exosome separation methods, such as complex operation, high cost, and easy damage to exosomes.

[0004] To achieve the above objectives, the first aspect of this application provides a method for preparing a composite hydrogel, comprising:

[0005] The mesh metal substrate is immersed in the first prepolymer solution, and after being removed, it is crosslinked and polymerized to obtain a hydrogel-coated mesh metal substrate. The first prepolymer solution contains a first monomer.

[0006] The hydrogel-coated mesh metal substrate is immersed in a second prepolymer solution, and after being removed, it is crosslinked and polymerized to obtain a double-network hydrogel-coated mesh metal substrate. The second prepolymer solution contains a second monomer, and the second monomer has a carboxyl group.

[0007] The mesh metal substrate in the dual-network hydrogel-coated mesh metal substrate is dissolved and removed to obtain the dual-network hydrogel;

[0008] The dual-network hydrogel was modified with a long DNA chain to obtain the composite hydrogel. The 5' end amino group of the long DNA chain was modified and grafted onto the dual-network hydrogel through an amidation reaction. The long DNA chain includes multiple repeating CD63 aptamer sequences.

[0009] In one or more embodiments, the first monomer is acrylamide.

[0010] In one or more embodiments, the second monomer is acrylic acid.

[0011] In one or more embodiments, the mesh metal substrate is nickel foam.

[0012] In one or more embodiments, the first prepolymer liquid further includes a crosslinking agent and a thermal initiator, and in the step of immersing the mesh metal substrate in the first prepolymer liquid and then crosslinking and polymerizing it after removal, the crosslinking and polymerizing is specifically thermally initiated polymerization.

[0013] In one or more embodiments, the second prepolymer liquid further includes a crosslinking agent and a thermal initiator, and in the step of immersing the hydrogel-coated mesh metal substrate in the second prepolymer liquid and then crosslinking and polymerizing it, the crosslinking and polymerizing is specifically thermally initiated polymerization.

[0014] In one or more embodiments, the volume fraction of the first monomer in the first prepolymer liquid is 20-25%.

[0015] In one or more embodiments, the volume fraction of the second monomer in the second prepolymer liquid is 20-25%.

[0016] In one or more embodiments, the step of dissolving and removing the mesh metal substrate from the dual-network hydrogel-coated mesh metal substrate includes:

[0017] The dual-network hydrogel-coated mesh metal substrate is immersed in acid and stirred until the mesh metal substrate dissolves.

[0018] In one or more embodiments, the step of modifying the dual-network hydrogel with a long DNA chain to obtain the composite hydrogel includes:

[0019] A circular DNA template was prepared using primers and single-stranded DNA. The single-stranded DNA was phosphorylated at the 5' end and included an antisense sequence of the CD63 aptamer. The primers were amino-modified at the 5' end. The 5' and 3' ends of the single-stranded DNA were complementary to the 3' and 5' ends of the primers, respectively.

[0020] The dual-network hydrogel is added to the solution of the circular DNA template to perform an amidation reaction, so that the circular DNA template is grafted onto the dual-network hydrogel through the primers;

[0021] The dual-network hydrogel grafted with the circular DNA template was added to the amplification system, and rolling circle amplification was performed to obtain the composite hydrogel.

[0022] In one or more embodiments, the sequence of the single-stranded DNA is shown in SEQ ID NO.1, and the sequence of the primer is shown in SEQ ID NO.2.

[0023] In one or more embodiments, the sequence of the single-stranded DNA is shown in SEQ ID NO.3, and the sequence of the primer is shown in SEQ ID NO.4.

[0024] In one or more embodiments, the sequence of the single-stranded DNA is shown in SEQ ID NO.5, and the sequence of the primer is shown in SEQ ID NO.6.

[0025] In one or more embodiments, the step of preparing a circular DNA template using primers and single-stranded DNA includes:

[0026] The primers and the single-stranded DNA are mixed and subjected to high-temperature denaturation and low-temperature annealing under polymerase chain reaction treatment, so that the primers recognize the single-stranded DNA and form a circular nick template with a gap through complementary base pairing;

[0027] The circular notch template was mixed with T4 DNA ligase and incubated to ligate the notch, thus obtaining the circular DNA template.

[0028] In one or more embodiments, in the step of mixing the primers and the single-stranded DNA and sequentially denaturing and annealing at low temperature under polymerase chain reaction (PCR), the molar ratio of the single-stranded DNA to the primers is 1:(1~2), and the specific reaction program of the PCR is as follows: 95 °C for 2 min; 65 °C for 2 min; 60 °C for 5 min 30 s; then the temperature is lowered to 20 °C at a cooling rate of 0.5 °C every 30 s; 20 °C for 30 s; and 10 °C for 10 min.

[0029] In one or more embodiments, the step of mixing the circular notch template with T4 DNA ligase and incubating to ligate the notch specifically involves reacting at 10 ℃~16 ℃ for 12~16 h, followed by inactivation at 65 ℃~80 ℃ for 8~15 min.

[0030] In one or more embodiments, the amplification system includes phi29 DNA polymerase and dNTPs, and the rolling circle amplification reaction procedure is to react at 30 ℃ to 37 ℃ for 1 to 4 h.

[0031] In one or more embodiments, the method further includes, prior to the step of modifying the dual-network hydrogel with a long DNA chain:

[0032] The dual-network hydrogel was added to a catalyst for carboxyl activation, the catalyst comprising 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide.

[0033] In one or more embodiments, the CD63 aptamer sequence is shown in SEQ ID NO.7.

[0034] To achieve the above objectives, a second aspect of this application provides a composite hydrogel prepared by the preparation method described in any of the above embodiments.

[0035] To achieve the above objectives, a third aspect of this application provides a composite hydrogel prepared by the preparation method described in any of the above embodiments, or the composite hydrogel described in any of the above embodiments, for use in exosome separation.

[0036] The advantages of this application, which differ from existing technologies, are:

[0037] The preparation method of this application uses a mesh metal substrate as a template to sequentially initiate polymerization on the surface and internal pores of the substrate to form a double-network hydrogel. This ensures a regular three-dimensional macroporous structure inside the hydrogel, avoiding problems such as disorder and collapse of the pores, allowing the extracted sample to flow through quickly, and making it easy for exosomes to diffuse into the interior of the material. At the same time, long DNA chains including multiple repetitive CD63 aptamer sequences bind to the abundant carboxyl groups on the surface and inside of the double-network hydrogel, forming abundant capture sites on the surface and inside of the double-network hydrogel. These capture sites can achieve specific and efficient separation and enrichment of exosomes in the sample.

[0038] The composite hydrogel of this application is a polyacrylamide-polyacrylic acid dual network hydrogel. The internal polyacrylamide ensures the mechanical strength of the hydrogel to maintain the macroporous structure, while the surface polyacrylic acid has abundant carboxyl groups, which effectively improves the grafting rate of long DNA chains, and forms abundant capture sites on the surface and inside of the dual network hydrogel.

[0039] The preparation method of this application first grafts a circular DNA template onto the surface of a double-network hydrogel using primers, and then performs rolling circle amplification to ensure that the end of each DNA strand is connected to the double-network hydrogel, thereby ensuring the grafting rate and improving the utilization rate of carboxylic acid sites on the surface and internal pores of the double-network hydrogel. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0041] Figure 1 This is a schematic flowchart of one embodiment of the preparation method of the composite hydrogel of this application;

[0042] Figure 2 yes Figure 1 A flowchart of one embodiment corresponding to S500;

[0043] Figure 3 This is a graph showing the electrophoresis experimental results of Example 1 of this application;

[0044] Figure 4 This is a scanning electron microscope image of PAAm-PAAc@AptCD63 prepared in Example 5 of this application;

[0045] Figure 5 This is a fluorescence image of Example 2 of the effect of this application;

[0046] Figure 6 This is a fluorescence image of Example 3 of the effect of this application. Detailed Implementation

[0047] To enable those skilled in the art to better understand the technical solutions in this disclosure, the technical solutions in the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this disclosure, and not all embodiments. Based on the embodiments in this disclosure, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this disclosure.

[0048] The efficient capture, separation, and enrichment of exosomes is a technical challenge in the diagnosis, prognostic assessment, and therapeutic detection of exosomes. Traditional methods such as ultracentrifugation and immunomagnetic beads are complex to operate, costly, and prone to damaging exosomes. Developing a mild and efficient exosome capture and separation material has important scientific research and clinical value.

[0049] The tunable three-dimensional network structure of hydrogels can be used to separate exosomes through physical sieving, but it is difficult to distinguish exosomes from other particles of similar size, resulting in limited separation purity. Furthermore, due to the wide pore size distribution of the hydrogel network, it is difficult to achieve efficient retention of exosomes in the range of 30 to 200 nm, which poses a risk of loss of small exosomes or infiltration of large impurities.

[0050] Hydrogels based on hydrophilic-hydrophobic interactions can be used to separate exosomes, but this method suffers from severe non-specific adsorption and lacks specificity in hydrophobic interactions. They also readily adsorb proteins, lipids, and other negatively charged biomolecules from the sample, leading to a decrease in exosome purity. Furthermore, the release conditions are demanding, requiring the use of high salt, extreme pH, organic solvents, etc., to disrupt physical interactions, which may affect the integrity and biological activity of exosomes, making it difficult to achieve truly non-destructive release.

[0051] The applicant has developed a novel composite hydrogel that enables the specific and efficient separation of exosomes, and has a simple preparation process, high stability, and wide applicability.

[0052] Specifically, please refer to Figure 1 , Figure 1 This is a schematic flowchart illustrating one embodiment of the preparation method of the composite hydrogel of this application.

[0053] like Figure 1 As shown, the preparation method includes:

[0054] S100. Immerse the mesh metal substrate in the first prepolymer solution, remove it and crosslink it to obtain a hydrogel-coated mesh metal substrate.

[0055] This application uses a mesh metal substrate as a template to prepare hydrogels, thereby ensuring the internal structure of the hydrogels and obtaining a regular three-dimensional macroporous structure, thus solving the problems of disordered channels and collapse in traditional hydrogels.

[0056] Specifically, this application first immerses the mesh metal substrate in a first prepolymer liquid including a first monomer, so that the first prepolymer liquid fully fills the internal pores of the mesh metal substrate, then removes the mesh metal substrate and performs crosslinking polymerization, thereby forming a first polymer coating on the inside and surface of the mesh metal substrate.

[0057] The first prepolymer liquid also includes a crosslinking agent and an initiator. In one embodiment, the initiator may be a thermal initiator, which crosslinks and polymerizes the first monomer by thermal initiation polymerization.

[0058] In one embodiment, the volume fraction of the first monomer in the first prepolymer liquid can be 20-25%.

[0059] In one embodiment, the mesh metal substrate can be nickel foam; in other embodiments, the mesh metal substrate can also be other metal mesh materials.

[0060] In one embodiment, the first monomer may specifically be acrylamide, and accordingly, based on S100, a nickel foam with a polyacrylamide coating on its surface and internal pores is obtained.

[0061] S200. The hydrogel-coated network metal substrate is immersed in the second prepolymer solution, and after being removed, it is crosslinked and polymerized to obtain a double-network hydrogel-coated network metal substrate.

[0062] The second prepolymer contains a second monomer, which has a carboxyl group.

[0063] By immersing the hydrogel-coated mesh metal substrate in the second prepolymer solution, the second prepolymer solution can fully fill the internal pores of the mesh metal substrate. After that, it is taken out and cross-linked polymerized, thereby forming a second polymer coating on the surface of the first polymer coating.

[0064] In one embodiment, the initiator of the second prepolymer liquid crosslinking agent and the initiator may be a thermal initiator, which crosslinks and polymerizes the second monomer by thermal initiation polymerization.

[0065] In one embodiment, the volume fraction of the second monomer in the second prepolymer liquid can be 20-25%.

[0066] In one embodiment, the second monomer may specifically be acrylic acid, and accordingly, a polyacrylic acid coating may be formed on the surface of the first polymer coating.

[0067] In other embodiments, the second monomer may also be other monomers including a carboxyl group.

[0068] S300. Dissolve and remove the mesh metal substrate in the double-network hydrogel-coated mesh metal substrate to obtain the double-network hydrogel.

[0069] After the hydrogel preparation is completed, the network metal substrate is dissolved and removed to obtain the double network hydrogel. The double network hydrogel maintains a regular three-dimensional macroporous structure on the one hand, and has abundant carboxyl groups on the other hand.

[0070] In one embodiment, the dual-network hydrogel is specifically a polyacrylamide-polyacrylic acid (PAM-PAA) dual-network hydrogel, in which the internal polyacrylamide ensures the mechanical strength of the hydrogel to maintain the macroporous structure, and the surface polyacrylic acid has abundant carboxyl groups for subsequent DNA fixation.

[0071] In one embodiment, the method for removing the mesh metal substrate may specifically involve immersing the double-network hydrogel-coated mesh metal substrate in acid and stirring until the mesh metal substrate dissolves.

[0072] S400: The dual-network hydrogel is added to the catalyst for carboxyl activation.

[0073] In one embodiment, the catalyst comprises 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide, i.e., the catalyst is an EDC / NHS system, thereby effectively improving the subsequent coupling efficiency between the carboxyl group and the amino group.

[0074] S500: A composite hydrogel was obtained by modifying a double-network hydrogel with a long DNA chain.

[0075] The long DNA chain includes multiple repeating CD63 aptamer sequences.

[0076] In one implementation, the CD63 aptamer sequence is as follows:

[0077] CACCCCACCTCGCTCCCGTGACACTAATGCTA (SEQ ID NO. 7).

[0078] By grafting long DNA chains onto the carboxyl groups on the surface of a dual-network hydrogel, a composite hydrogel is obtained. This composite hydrogel has abundant CD63 aptamer sequences on its surface, numerous capture sites, and a regular macroporous structure with high porosity, allowing extracted samples to flow through rapidly. This facilitates the easy diffusion of exosomes into the material's interior to contact the capture sites, enabling specific and efficient separation and enrichment of exosomes. At the same time, polyacrylic acid reduces the specific adsorption of impurities by the hydrogel, improving the purity of the separation.

[0079] Specifically, please refer to Figure 2 , Figure 2 yes Figure 1 A flowchart of one embodiment corresponding to S500.

[0080] like Figure 2 As shown, methods for modifying dual-network hydrogels using long DNA chains include:

[0081] S501. Prepare circular DNA templates using primers and single-stranded DNA.

[0082] The single-stranded DNA undergoes 5' end phosphorylation modification, including the antisense sequence of the CD63 aptamer, and the primer undergoes 5' end amino modification. The 5' and 3' ends of the single-stranded DNA are complementary to the 3' and 5' ends of the primer, respectively.

[0083] The preparation process of the circular DNA template is described in detail below:

[0084] 1. Mix the primers and single-stranded DNA, and then denature them at high temperature and anneal them at low temperature under polymerase chain reaction treatment, so that the primers can recognize the single-stranded DNA and form a circular template with a gap through complementary base pairing.

[0085] Understandably, since the 5' and 3' ends of the single-stranded DNA are complementary to the 3' and 5' ends of the primers, the single-stranded DNA can be circularized under the action of the primers, resulting in a circular template with a gap.

[0086] In one implementation, the molar ratio of single-stranded DNA to primers can be 1:(1~2).

[0087] In one embodiment, the polymerase chain reaction (PCR) procedure may be as follows: hold at 95 °C for 2 min; hold at 65 °C for 2 min; hold at 60 °C for 5 min 30 s; then lower the temperature to 20 °C at a cooling rate of 0.5 °C every 30 s; hold at 20 °C for 30 s; and hold at 10 °C for 10 min.

[0088] 2. Mix the circular notch template with T4 DNA ligase and incubate to ligate the notch, thus obtaining a circular DNA template.

[0089] Furthermore, the gap was ligated using T4 DNA ligase to obtain a circular DNA template.

[0090] In one embodiment, the incubation may specifically involve reacting at 10 °C to 16 °C for 12 to 16 h, followed by inactivation at 65 °C to 80 °C for 8 to 15 min.

[0091] Specifically, in one embodiment, the sequence of the single-stranded DNA is as follows:

[0092] Phosphate-TCGTTTGATGTTTCCTAAAGTACCAAGTACC TAGCATTAGTGTCACGGGAGCGAGGTGG GGTG GAGCATAGAGGGATCATAGAGGGATGGCTGACTGACTGAC (SEQ ID NO. 1);

[0093] The primer sequences are as follows:

[0094] NH2 -AGGGATCATAGAGGGATGGCTCGA (SEQ ID NO. 2).

[0095] In another embodiment, the sequence of the single-stranded DNA is as follows:

[0096] Phosphate-TCGTTTGATGTTTCCTAAAGTACCAAGTACC TAGCATTAGTGTCACGGGAGCGAGGTGG GGTG GAGCATAGAGGGATCATAGAGGGATGGCTG (SEQ ID NO. 3);

[0097] The primer sequences are as follows:

[0098] NH2-TAGGAACATCAAACGACAGCCA (SEQ ID NO. 4).

[0099] In yet another implementation, the sequence of the single-stranded DNA is as follows:

[0100] Phosphate-TCGTTTGATGTTTCCTAAAGTACCAAGTACC TAGCATTAGTGTCACGGGAGCGAGGTGG GGTG GAGCATAGAGGGATCATAGAGGGATGGCTGACGTACGTACGTACGTACGT (SEQ ID NO.5);

[0101] The primer sequences are as follows:

[0102] NH2-ACGTACGTACGTACGTACGTCAGCCATCCCTCTATGATCC (SEQ ID NO. 6).

[0103] In the single-stranded DNA sequences of the above embodiments, the underlined portions are the antisense sequences of the CD63 aptamer.

[0104] S502. Add the double-network hydrogel to the solution of the circular DNA template to carry out the amidation reaction.

[0105] In the circular DNA template prepared based on S401, the primers are linked to the circular DNA template through base pairing, and the 5' end amino group of the primers is modified.

[0106] When a dual-network hydrogel is added to a solution of a circular DNA template, the abundant carboxyl groups on the surface of the dual-network hydrogel can undergo an amidation reaction with the amino groups of the primers on the circular DNA template, thereby grafting the circular DNA template and primers onto the dual-network hydrogel.

[0107] In one embodiment, the dual-network hydrogel can be added to a solution of the circular DNA template and reacted overnight at 4 °C to ensure that the circular DNA template is fully grafted onto the surface of the dual-network hydrogel.

[0108] S503. Add the double-network hydrogel grafted with circular DNA template to the amplification system and perform rolling circle amplification to obtain a composite hydrogel.

[0109] After grafting the circular DNA template and primers onto a dual-network hydrogel, rolling circle amplification is performed in the amplification system. The primers amplify along the circular DNA template to obtain long DNA chains, thus obtaining a composite hydrogel with long DNA chains grafted on its surface.

[0110] The amplification system includes phi29 DNA polymerase and dNTPs, and the rolling circle amplification reaction procedure is to react at 30 ℃~37 ℃ for 1~4 h.

[0111] In one implementation, the amplification system can be specifically as follows:

[0112] dNTPs (0.5~1 mM), 1×phi 29 DNA polymerase buffer, bovine serum albumin (BSA) solution (0.2 mg / mL), phi 29 DNA polymerase (0.1 U / μL).

[0113] In this embodiment, the circular DNA template is first grafted onto the surface of the double-network hydrogel using primers, and then rolling circle amplification is performed to ensure that the end of each DNA strand is connected to the double-network hydrogel, thereby ensuring the grafting rate and improving the utilization rate of carboxylic acid sites on the surface and internal pores of the double-network hydrogel.

[0114] In other embodiments, long DNA chains can be prepared first and then grafted onto the dual-network hydrogel, which can also achieve the same effect as this embodiment to some extent.

[0115] Based on the methods described above, a double-network hydrogel is formed by sequentially initiating polymerization on the surface and internal pores of a mesh metal substrate as a template. This ensures a regular three-dimensional macroporous structure inside the hydrogel, avoiding problems such as disordered pores and collapse, allowing the extracted sample to flow through quickly, and facilitating the diffusion of exosomes into the material. Simultaneously, long DNA chains including multiple repetitive CD63 aptamer sequences bind to the abundant carboxyl groups on the surface and inside the double-network hydrogel, forming abundant capture sites on the surface and inside the double-network hydrogel. These capture sites enable the specific and efficient separation and enrichment of exosomes in the sample. Furthermore, polyacrylic acid reduces the specific adsorption of impurities by the hydrogel, improving the purity of the separation.

[0116] The beneficial effects of the technical solution of this application will be further described in detail below with reference to specific embodiments.

[0117] Example 1: Preparation of circular DNA template containing CD63 aptamer

[0118] a. Design and synthesize ssDNA containing the antisense sequence of the CD63 aptamer with 5' phosphorylation modification, SEQ ID NO.1, and design primers (SEQ ID NO.2), with the 5' and 3' ends of the ssDNA complementary to the 3' and 5' ends of the primers, respectively.

[0119] b. Mix the 5' phosphorylated ssDNA and the 5' amino-modified primer at a molar ratio of 1:1, add NaCl to a final concentration of 80 mmol / L, and add sterile water to a total volume of 20 μL. Then, synthesize circular DNA with a notch at the end according to the following heating and annealing procedure.

[0120] Annealing procedure: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, repeated 80 times.

[0121] Step 1: 95 ℃ for 2 min

[0122] Step 2: 65 ℃ for 2 min

[0123] Step 3: 60 ℃ for 5 min 30 s

[0124] Step 4: 20 ℃ for 30 s

[0125] Step 5: 10℃ Pause

[0126] c. Add 70 μL of 10 × T4 DNA ligase buffer and 1 μL of T4 DNA ligase solution to the product from step b. Finally, add deionized water to bring the total volume to 700 μL. React at 12°C for 12 h to obtain a circular DNA template containing the CD63 aptamer sequence.

[0127] Example 2:

[0128] A circular DNA template containing a CD63 aptamer was prepared using a method essentially the same as in Example 1, except that:

[0129] The ssDNA sequence is shown in SEQ ID NO.3, and the primer sequence is shown in SEQ ID NO.4.

[0130] Example 3:

[0131] A circular DNA template containing a CD63 aptamer was prepared using a method essentially the same as in Example 1, except that:

[0132] The ssDNA sequence is shown in SEQ ID NO.5, and the primer sequence is shown in SEQ ID NO.6.

[0133] Example 4: Preparation of a dual-network hydrogel

[0134] Step 1:

[0135] A 15 mm diameter and 1.5 mm height nickel foam disc was selected as the template material. The nickel foam disc was then subjected to the following cleaning treatments in sequence: ultrasonic cleaning in acetone for 30 min, then placed on filter paper to absorb the solvent, followed by ultrasonic cleaning in anhydrous ethanol for 30 min, then placed on filter paper to absorb the solvent, and finally ultrasonic cleaning in ultrapure water for 30 min. After cleaning, the nickel foam disc was placed in a 60 ℃ oven to dry for later use.

[0136] Step Two:

[0137] Weigh 2 g of acrylamide and dissolve it in 10 mL of ultrapure water. Then add 0.02 g of ammonium persulfate (APS) and 0.1 g of N,N'-methylenebisacrylamide (BIs), and stir thoroughly to dissolve to obtain acrylamide prepolymer solution.

[0138] The pretreated nickel foam was immersed in acrylamide prepolymer solution and stirred for 1 min to allow the prepolymer solution to fully fill the pores of the nickel foam. The nickel foam was then removed and placed in another clean centrifuge tube. The excess acrylamide prepolymer solution was removed by centrifugation at 2000 rpm.

[0139] Nickel foam loaded with acrylamide prepolymer was placed in an oven at 60 °C and thermally crosslinked for 4 h to obtain nickel foam material coated with polyacrylamide hydrogel.

[0140] Take 2 mL of acrylic monomer solution, add 10 mL of ultrapure water, then add 0.02 g of APS and 0.1 g of BIs, stir thoroughly to dissolve, and obtain acrylic prepolymer solution;

[0141] The polyacrylamide hydrogel-coated nickel foam material was immersed in acrylic prepolymer solution and swollen for 1 h. After being removed, it was centrifuged at 5000 rpm for 3 min to remove excess acrylic prepolymer solution.

[0142] The material was placed in a 60 ℃ oven and thermally crosslinked and polymerized for 4 h to obtain a double-network hydrogel-coated nickel foam material.

[0143] The nickel foam material coated with the double-network hydrogel was placed in nitric acid diluted 1:3 and incubated at 220 rpm for 6 hours until the nickel foam template was completely dissolved. The obtained pure gel material was repeatedly washed with pure water and tested with pH paper until the supernatant was neutral. The gel sheet was removed and stored in pure water at 4 ℃ to obtain the double-network hydrogel, denoted as PAAm-PAAc.

[0144] Example 5: Preparation of PAAm-PAAc loaded with CD63 aptamers

[0145] The PAAm-PAAc prepared in Example 4 was immersed in 0.1 mol / L 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and reacted for 30 min. Then, 0.025 mol / L N-hydroxysuccinimide (NHS) was added and incubated for another 30 min.

[0146] After washing three times with pure water, remove the gel sheet, absorb excess liquid with filter paper, and add 0.029 μmol / L of the circular DNA template prepared in Example 2. Incubate overnight at 4 °C.

[0147] Remove the gel sheet material and add 20 μL of phi 29 DNA polymerase, a final concentration of 1× phi 29 DNA polymerase buffer, a final concentration of 20 mg / mL BSA, 1 mmol of dNTPs, and a final concentration of 80 mmol / L NaCl. Mix them together and then bring the volume to 1 mL with sterile water. Shake at 37 °C for 1–4 h at 450 rpm to obtain the PAAm-PAAc material loaded with the CD63 aptamer, denoted as PAAm-PAAc@AptCD63.

[0148] Example of effect 1:

[0149] Electrophoresis experiments were performed at different stages of the preparation of the circular DNA template in Example 2. Simultaneously, rolling circle amplification experiments were conducted using the circular DNA template from Example 2, with electrophoresis performed at different amplification times to obtain… Figure 3 , Figure 3 This is a graph showing the electrophoresis experimental results of Example 1 of this application.

[0150] like Figure 3 As shown, the hybridize lane bands are concentrated around 309bp, indicating successful hybridization between the template and primers; the T4 ligation lane forms a new band, indicating successful circularization; the products in the RCA lanes are all concentrated in the sample wells, and the brightness of the bands in the wells continues to increase with the extension of amplification time, indicating successful rolling circle amplification.

[0151] In summary, this demonstrates that Example 2 successfully prepared a circular DNA template.

[0152] Example of effect 2:

[0153] The PAAm-PAAc@AptCD63 prepared in Example 5 was characterized and analyzed to obtain... Figure 4 , Figure 4 This is a scanning electron microscope image of PAAm-PAAc@AptCD63 prepared in Example 5 of this application.

[0154] like Figure 4 As shown, PAAm-PAAc@AptCD63 perfectly preserves the porous structure of nickel foam, with a regular macroporous structure inside.

[0155] PAAm-PAAc from Example 4 and PAAm-PAAc@AptCD63 from Example 5 were stained with SYBR and subjected to fluorescence analysis to obtain... Figure 5 , Figure 5 This is a fluorescence image of Example 2 of the effect of this application. The fluorescence is shown for ease of demonstration. Figure 5 Use color images.

[0156] like Figure 5 As shown, both PAAm-PAAc and PAAm-PAAc@AptCD63 exhibit typical three-dimensional porous structures in bright-field images. However, in SYBR channel images, PAAm-PAAc showed no specific green fluorescence, while PAAm-PAAc@AptCD63 showed a significant green fluorescence signal, indicating that the long DNA chain containing the CD63 aptamer has been successfully loaded into the surface and internal pores of PAAm-PAAc.

[0157] Example 3: Exosome capture experiment

[0158] a. A piece of PAAm-PAAc@AptCD63 gel prepared in Example 5 was stained with SYBR dye, and exosomes were labeled with CM-DiI.

[0159] b. Remove the affinity column and place it in a clean bench under UV light for at least 30 minutes. Then, pack the stained PAAm-PAAc@AptCD63 gel sheet into the column, with the material positioned between two hydrophilic sieve plates to form a sandwich structure.

[0160] c. Remove the top cap and bottom plug of the affinity column in sequence, add buffer solution from the top, let stand until the buffer solution has drained, and repeat the addition of equilibration solution three times.

[0161] d. After the equilibration buffer has completely drained, slowly add the pretreated exosome solution in batches from the top, wait for the solution to flow naturally through the affinity column, and collect the filtrate using centrifuge tubes at the bottom.

[0162] e. After the sample has drained, rinse again with buffer to remove unbound nonspecific impurities. Add equilibration buffer from the top, allow to stand until the buffer has drained, remove the PAAm-PAAc@AptCD63 gel slide, and observe using an inverted fluorescence microscope to obtain... Figure 6 , Figure 6 This is a fluorescence image of Example 3 of the effect of this application. The fluorescence is shown for ease of demonstration. Figure 6 Use color images.

[0163] like Figure 6 As shown, the green fluorescence of the CD63 aptamer in the SYBR channel and the red fluorescence of the exosome in the Dil channel exhibit high colocalization, indicating that the exosome can be specifically recognized and captured by the aptamer on the material surface.

[0164] It will be apparent to those skilled in the art that this disclosure is not limited to the details of the exemplary embodiments described above, and that this disclosure can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of this disclosure is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within this disclosure. No reference numerals in the claims should be construed as limiting the scope of the claims.

[0165] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A method for preparing a composite hydrogel, characterized in that, include: A mesh metal substrate is immersed in a first prepolymer solution, and then crosslinked and polymerized to obtain a hydrogel-coated mesh metal substrate. The first prepolymer solution contains a first monomer, which is acrylamide, and the volume fraction of the first monomer in the first prepolymer solution is 20-25%. The hydrogel-coated mesh metal substrate is immersed in a second prepolymer solution, and then crosslinked and polymerized to obtain a double-network hydrogel-coated mesh metal substrate. The second prepolymer solution contains a second monomer, which has a carboxyl group and is acrylic acid. The volume fraction of the second monomer in the second prepolymer solution is 20-25%. The mesh metal substrate in the dual-network hydrogel-coated mesh metal substrate is dissolved and removed to obtain the dual-network hydrogel; The dual-network hydrogel was modified with a long DNA chain to obtain the composite hydrogel. The 5' end amino group of the long DNA chain was modified and grafted onto the dual-network hydrogel by an amidation reaction. The long DNA chain included multiple repeating CD63 aptamer sequences. The step of modifying the dual-network hydrogel with long DNA chains to obtain the composite hydrogel includes: A circular DNA template was prepared using primers and single-stranded DNA. The single-stranded DNA was phosphorylated at the 5' end and included an antisense sequence of the CD63 aptamer. The primers were amino-modified at the 5' end. The 5' and 3' ends of the single-stranded DNA were complementary to the 3' and 5' ends of the primers, respectively. The dual-network hydrogel is added to the solution of the circular DNA template to perform an amidation reaction, so that the circular DNA template is grafted onto the dual-network hydrogel through the primers; The dual-network hydrogel grafted with the circular DNA template was added to the amplification system, and rolling circle amplification was performed to obtain the composite hydrogel. Wherein, the sequence of the single-stranded DNA is shown in SEQ ID NO.1, and the sequence of the primer is shown in SEQ ID NO.2; or, The sequence of the single-stranded DNA is shown in SEQ ID NO.3, and the sequence of the primer is shown in SEQ ID NO.4; or, The sequence of the single-stranded DNA is shown in SEQ ID NO.5, and the sequence of the primer is shown in SEQ ID NO.

6.

2. The preparation method according to claim 1, characterized in that, The mesh metal substrate is nickel foam.

3. The preparation method according to claim 1, characterized in that, The first prepolymer solution further includes a crosslinking agent and a thermal initiator. In the step of immersing the mesh metal substrate in the first prepolymer solution and then performing crosslinking polymerization after removal, the crosslinking polymerization is specifically thermally initiated polymerization; and / or, The second prepolymer solution also includes a crosslinking agent and a thermal initiator. In the step of immersing the hydrogel-coated mesh metal substrate in the second prepolymer solution and then crosslinking and polymerizing it, the crosslinking and polymerizing is specifically a thermally initiated polymerization.

4. The preparation method according to claim 1, characterized in that, The step of dissolving and removing the mesh metal substrate from the dual-network hydrogel-coated mesh metal substrate includes: The dual-network hydrogel-coated mesh metal substrate is immersed in acid and stirred until the mesh metal substrate dissolves.

5. The preparation method according to claim 1, characterized in that, The step of preparing a circular DNA template using primers and single-stranded DNA includes: The primers and the single-stranded DNA are mixed and subjected to high-temperature denaturation and low-temperature annealing under polymerase chain reaction treatment, so that the primers recognize the single-stranded DNA and form a circular nick template with a gap through complementary base pairing; The circular notch template was mixed with T4 DNA ligase and incubated to ligate the notch, thus obtaining the circular DNA template.

6. The preparation method according to claim 5, characterized in that, In the step of mixing the primers and the single-stranded DNA and sequentially denaturing and annealing them at high temperature using polymerase chain reaction (PCR), the molar ratio of the single-stranded DNA to the primers is 1:(1~2). The specific PCR reaction program is as follows: 95 °C for 2 min; 65 °C for 2 min; 60 °C for 5 min 30 s; then cooling the temperature to 20 °C at a rate of 0.5 °C every 30 s; holding at 20 °C for 30 s; holding at 10 °C for 10 min; and / or, In the step of mixing the circular notch template with T4 DNA ligase and incubating to ligate the notch, the incubation specifically involves reacting at 10 ℃~16 ℃ for 12~16 h, followed by inactivation at 65 ℃~80 ℃ for 8~15 min.

7. The preparation method according to claim 1, characterized in that, The amplification system includes phi29 DNA polymerase and dNTPs, and the rolling circle amplification reaction procedure is to react at 30 ℃~37 ℃ for 1~4 h.

8. The preparation method according to claim 1, characterized in that, Prior to the step of modifying the dual-network hydrogel with long DNA chains, the method further includes: The dual-network hydrogel was added to a catalyst for carboxyl activation, the catalyst comprising 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide.

9. The preparation method according to claim 1, characterized in that, The CD63 aptamer sequence is shown in SEQ ID NO.

7.

10. A composite hydrogel prepared by any one of the preparation methods according to claims 1 to 9.