An hbv rna capture probe, biosensor and detection system
By designing capture probes that cover the common conserved regions of all HBV genotypes and subtypes and combining them with electrochemical biosensors, we have achieved high sensitivity and high coverage of HBV RNA detection, solving the problems of missed detection and low sensitivity in existing technologies. This technology is suitable for accurate detection of HBV infection samples worldwide.
Patent Information
- Application Number
- CN202610499490.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-16
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2046-04-16
AI Technical Summary
Existing HBV RNA detection methods suffer from insufficient probe coverage, making it difficult to cover all genotypes and subtypes, leading to the risk of missed detection. Furthermore, the detection sensitivity is low, failing to meet the detection needs for early infection and low viral load.
We designed capture probes targeting the common conserved regions of different HBV genotypes, with a coverage of more than 99%, and combined them with an electrochemical biosensor to enhance the detection signal intensity through circuit amplification, thereby achieving high-sensitivity detection.
It achieves high coverage and high sensitivity detection of HBV RNA, effectively avoiding false negatives. It is suitable for HBV infection sample detection in different regions around the world, with a sensitivity improvement of 50-100 times, and is suitable for accurate detection of early HBV infection and low viral load samples.
Smart Images

Figure CN122060724B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of hepatitis B virus detection technology, specifically relating to an HBV RNA capture probe, a biosensor, and a detection system. Background Technology
[0002] Hepatitis B virus (HBV) is a globally prevalent hepatotropic virus. Its main transmission routes include blood transmission, mother-to-child transmission, and sexual contact. It can cause chronic hepatitis, cirrhosis, and even hepatocellular carcinoma, seriously threatening human health. According to the World Health Organization (WHO), there are approximately 296 million people living with chronic HBV globally, and more than 820,000 people die annually from HBV-related diseases, placing a heavy burden on global public health systems.
[0003] HBV is a small enveloped DNA virus with a genome of approximately 3.2 kb, consisting of a partially double-stranded, relaxed circular DNA containing four overlapping open reading frames (ORFs). The viral genome exhibits high heterogeneity, with at least eight major genotypes (AH type) and dozens of subtypes identified to date. In vivo, HBV primarily attaches to and invades hepatocytes via the NTCP receptor. Its relaxed circular DNA (rcDNA) enters the nucleus and is repaired by host enzymes to form a covalently closed circular DNA (cccDNA) with a supercoiled structure. cccDNA serves as a template for viral transcription, continuously producing HBV RNA intracellularly, which is used to retrotranscribe the viral genome and translate viral proteins, thus maintaining the viral replication cycle. Therefore, HBV RNA, as a core intermediate product in the HBV life cycle, directly reflects the active replication status of the virus and is a core indicator for assessing HBV replication activity. It has irreplaceable and significant clinical value for early diagnosis, treatment regimen adjustment, treatment monitoring, and prognostic assessment of HBV infection.
[0004] In early diagnosis, HBV RNA is more accurate than HBV DNA in distinguishing between occult and active infections: some occult HBV infected individuals have extremely low or undetectable HBV DNA levels, but still exhibit HBV RNA expression, indicating that the virus is still actively replicating. Without timely detection and intervention, this may gradually progress to chronic hepatitis. HBV RNA detection can effectively avoid such missed diagnoses. Regarding treatment monitoring, the trend of HBV RNA changes reflects the efficacy of antiviral therapy earlier than HBV DNA. Typically, HBV RNA levels decrease before HBV DNA levels after treatment. If HBV RNA remains positive or rebounds during treatment, it can provide early warning of treatment failure or viral resistance, providing crucial evidence for timely adjustments to the treatment plan and preventing further disease progression. Furthermore, HBV RNA detection provides crucial information for disease prognosis risk assessment. Studies have shown a positive correlation between HBV RNA levels in chronically HBV-infected individuals and the progression of liver fibrosis and cirrhosis. High HBV RNA levels indicate more severe liver tissue inflammation and damage, significantly increasing the risk of progression to cirrhosis and liver cancer. Regular HBV RNA testing allows for targeted monitoring and intervention of high-risk populations, improving long-term patient outcomes. HBV RNA also offers unique advantages in testing specific populations. For instance, in preventing mother-to-child transmission, detecting HBV RNA in newborns can help determine early onset of intrauterine infection, supporting timely intervention and reducing the incidence of chronic infection. In patients receiving immunosuppressant therapy, HBV RNA detection can detect viral reactivation early, preventing severe liver damage caused by viral reactivation. Therefore, accurate HBV RNA detection is not only a key requirement for clinical diagnosis and treatment but also a vital support for global HBV prevention and control efforts. Developing efficient and accurate HBV RNA detection technologies has significant clinical value and public health implications.
[0005] Currently, HBV RNA detection methods mainly include real-time quantitative PCR and RNA capture probe methods. Among them, the RNA capture probe method is increasingly widely used in clinical testing due to its advantages such as high specificity, relatively simple operation, and avoidance of degradation during RNA extraction. However, the increasing demand for precision clinical diagnosis and treatment has placed higher requirements on the sensitivity, specificity, and operability of HBV RNA detection. Existing RNA capture probe methods still have significant technical shortcomings: First, probe coverage is insufficient. Existing probes are mostly designed for single or a few HBV genotypes, failing to cover all HBV genotypes and subtypes. Due to the differences in base sequences between different genotypes, there is a risk of missed detection of rare genotypes or variant HBV RNA, limiting detection accuracy. Second, detection sensitivity is low. Traditional RNA capture probe methods rely on the specific binding signal between the probe and HBV RNA, which is weak and difficult to detect low concentrations of HBV RNA, failing to meet the detection needs of early infection and low viral load infection. Therefore, developing a detection product that can cover all HBV genotypes and has high sensitivity has become an urgent technical problem to be solved in the field of HBV RNA detection. Summary of the Invention
[0006] To address the problems in existing technologies, this invention provides an HBV RNA capture probe, a biosensor, and a detection system. Designed targeting common conserved regions of different HBV genotypes, it achieves a coverage of over 99%, effectively preventing missed detections. Furthermore, specific modifications enhance the binding stability with HBV RNA. The capture probe is anchored to the working electrode surface of the electrochemical biosensor, and circuit amplification enhances the electrochemical detection signal intensity, achieving highly sensitive detection of HBV RNA.
[0007] The technical problem solved by this invention is achieved by the following technical solution:
[0008] The purpose of this invention is to provide an HBV RNA capture probe, the nucleotide sequence of which is shown in SEQ ID NO. 5-8.
[0009] The present invention aims to provide an HBV RNA biosensor, including the aforementioned HBV RNA capture probe.
[0010] Furthermore, the HBV RNA capture probe is modified with biotin at the 5' end and with amino groups at the 3' end.
[0011] Furthermore, the concentration of the HBV RNA capture probe was 7-8 μmol / L.
[0012] Furthermore, the HBV RNA capture probe was anchored to the pretreated electrochemical biosensor after incubation at 37°C for 1–2 h.
[0013] The present invention aims to provide an HBV RNA detection system, including the HBV RNA capture probe or the HBV RNA biosensor.
[0014] Furthermore, it also includes a circuit amplification module and a detection buffer.
[0015] Furthermore, the amplification factor of the circuit amplification module is 10³-10⁵ times.
[0016] Furthermore, the detection buffer was a PBS buffer containing 5 mmol / L K3[Fe(CN)6], 5 mmol / L K4[Fe(CN)6], and 0.1 mol / L KCl, with a pH of 7.4.
[0017] Furthermore, HBV RNA capture probes or HBV RNA biosensors capture HBV RNA under conditions of incubation at 37°C for 30-60 min.
[0018] The whole-genotype HBV RNA capture probe is designed targeting the common conserved regions of all known HBV genotypes (AH type) and subtypes. These conserved regions are selected from the HBV X and C genes, and the sequence homology of these conserved regions across all HBV genotypes and subtypes is ≥85%. The HBV RNA capture probe has a coverage of ≥99%, a nucleotide sequence length of 30-40 nt, a 5' end modified with biotin, and a 3' end modified with an amino group (-NH2). The HBV RNA capture probe is purified by HPLC with a purity of ≥98%. The whole-genotype HBV RNA capture probe is anchored to an electrochemical biosensor, and the detection sensitivity is improved through circuit amplification.
[0019] Compared with the prior art, the beneficial technical effects of the present invention are as follows:
[0020] 1. High coverage, avoiding missed detections: The capture probe of this invention is designed for the common conserved regions of all HBV genotypes and subtypes, and bioinformatics analysis shows a coverage of ≥99% ( Figure 1 SPR kinetic binding curves showed that the probe rapidly bound to HBV RNA of various genotypes (A, B, C, D, etc.) with strong response signals and high affinity (Kd values <1.2 nM), confirming the probe's excellent broad-spectrum binding ability. Figure 2 This solves the problem that existing probes can only detect a few genotypes and are prone to missed detection, making it suitable for detecting HBV infection samples from different regions around the world.
[0021] 2. High detection sensitivity, capable of detecting low-concentration samples: By anchoring the capture probe to an electrochemical biosensor and utilizing the circuit amplification effect, high sensitivity of up to 10 is achieved. 4 The signal is amplified by a factor of 1. Experimental results show that its detection limit (LOD) is as low as 10 copies / mL. Figure 3 Furthermore, within the range of 10-1000 copies / mL, the DPV signal peak current showed a good linear response to HBV RNA concentration. Figure 4 Compared to traditional RNA capture probe methods, the sensitivity of this invention is increased by 50-100 times, enabling accurate detection of early HBV infection and low viral load samples, providing a reliable basis for early clinical diagnosis and treatment monitoring.
[0022] 3. High specificity and low interference: The capture probe is designed for conserved regions specific to HBV. Specificity verification has shown that it produces a strong response to HBV RNA of different genotypes, while the cross-reaction signal with HCV RNA, HDV RNA, and total human RNA is comparable to the blank background. Figure 5 This indicates that the cross-reactivity is negligible. Meanwhile, the amino group modification at the 3' end of the probe further enhances the binding stability with the target RNA, effectively reducing non-specific binding and ensuring high accuracy of the detection results.
[0023] 4. Simple, fast, and low-cost operation: The detection process does not require complex RNA extraction; samples can be tested after simple denaturation treatment, and the entire process takes less than 2 hours. The probe synthesis technology is mature, and the electrochemical biosensor can be reused more than 10 times. Performance verification shows that after 8 consecutive uses, the signal still retains more than 96% of the initial value. Figure 6 This significantly reduces the cost per test, which is beneficial for clinical application.
[0024] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention, it can be implemented according to the contents of the specification. Furthermore, in order to make the above contents, objectives, features and advantages of the present invention more obvious and understandable, specific embodiments of the present invention are described below. Attached Figure Description
[0025] Figure 1 This is a schematic diagram of the HBV RNA capture probe design of the present invention.
[0026] Figure 2 This is a graph showing the SPR kinetics of the HBV RNA capture probe of the present invention binding to HBV RNA of different genotypes.
[0027] Figure 3 This is a graph validating the sensitivity and linear range of the HBV RNA detection system of the present invention for HBV RNA detection.
[0028] Figure 4 This is a DPV response curve of the HBV RNA detection system of the present invention for detecting HBV RNA by pulse voltammetry.
[0029] Figure 5 This is a bar chart illustrating the specificity verification of the HBV RNA capture probe of this invention.
[0030] Figure 6 This diagram shows the reusability performance verification of the HBV RNA electrochemical biosensor of this invention. Detailed Implementation
[0031] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.
[0032] In addition, unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or prepared by existing methods.
[0033] Example 1: Synthesis of a full-genotype HBV RNA capture probe
[0034] I. Conserved Region Screening: Nucleotide sequences of all HBV genotypes (AH type) and subtypes were retrieved from the HBVdb database. Sequence alignment was performed using UGENE software to screen out the X gene and C gene regions as common conserved regions. The sequence homology of these regions in all HBV genotypes and subtypes is greater than 85%.
[0035] The core of designing HBV RNA capture probes for all genotypes is to target common conserved regions of all known HBV genotypes (AH type) and subtypes to ensure that the probes can specifically bind to RNA from all HBV genotypes. The screening of common conserved regions is accomplished using bioinformatics methods combined with specialized software: First, the complete nucleotide sequences of all included HBV genotypes (AH type) and subtypes are retrieved from the HBVdb database. Multiple sequence alignment is performed using the MUSCLE algorithm in UGENE software, followed by conservation analysis using MEGA 11 software. Finally, common conserved regions selected from the HBV X and C genes with sequence homology ≥85% are identified, providing a basis for the specific binding of the probes.
[0036] The nucleotide sequences of the common conserved regions are as follows (all sequences are in the 5'→3' direction):
[0037] Conserved region 1 (SEQ ID NO.1): (C gene region, 1849-1897bp, W:T / C)
[0038] TGTTCATGTCCWACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTT
[0039] Conserved region 2 (SEQ ID NO.2): (C gene region, 1807-1847bp)
[0040] ACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTC
[0041] Conserved region 3 (SEQ ID NO.3): (X gene region, 1682-1720bp)
[0042] ATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGT
[0043] Conserved region 4 (SEQ ID NO.4): (X gene region, 1515-1564bp, W: A / T)
[0044] CCGACCACGGGGGCACCTCTCTTTACGCGGWCTCCCCGTCTGTGCCTTC.
[0045] II. Probe Design and Synthesis: Based on the screened conserved regions, four capture probes (sequences 1-4) were designed. The probes were 35 nt in length, with biotin modified at the 5' end and amino group modified at the 3' end. They were synthesized by a biotechnology company and purified by HPLC with a purity ≥98%.
[0046] Based on the common conserved regions identified above, this invention uses Primer Premier 5.0 software combined with OligoCalc tool to design and optimize the capture probe. The specific design parameters are as follows: the nucleotide sequence design length is between 30-40 nt, preferably 35-38 nt; the 5' end of the probe is modified with biotin to specifically bind to streptavidin on the surface of the electrochemical biosensor, thereby anchoring and immobilizing the probe; the 3' end is modified with an amino group (-NH2) to enhance the binding stability of the probe to HBV RNA and reduce non-specific binding. The modification process is completed using conventional nucleic acid chemical modification methods.
[0047] The specific nucleotide sequences of the capture probes are as follows (all sequences are in the 5'→3' direction):
[0048] Sequence 1 (SEQ ID NO.5): Biotin- GTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGT- NH2
[0049] Sequence 2 (SEQ ID NO. 6): Biotin- CGCGTCACCAGCACCATGCAACTTTTTCACCTCTG- NH2
[0050] Sequence 3 (SEQ ID NO. 7): Biotin-GAGACCACCGTGAACATGTCAACGACCGACCTTGA-NH2
[0051] Sequence 4 (SEQ ID NO.8): Biotin-TCTCTTTACGCGGACTCCCCGTCTGTGCCTTCTGT-NH2.
[0052] Example 2: Validation of coverage and specificity of HBV RNA capture probes of all genotypes
[0053] I. Coverage validation of the whole-genotype HBV RNA capture probe:
[0054] RNA samples from eight standard HBV genotypes (AH type) were selected, with three replicates for each genotype. Four synthesized probes (all at a concentration of 7.5 μmol / L) were mixed and hybridized with the RNA samples from each genotype. Binding efficiency was detected using quantitative real-time fluorescence assay. Results showed that the binding efficiency of the mixed four probes with all eight genotype RNAs was ≥99%, achieving a coverage of 99.2% with no missed detections, demonstrating that the probes effectively cover all HBV genotypes.
[0055] The coverage of the capture probe in this invention is ≥99%. The specific verification process is completed by combining bioinformatics analysis and in vitro experimental methods: At the bioinformatics level, the designed probe sequence is compared and verified with the RNA sequences of all HBV genotypes (AH type) and subtypes in HBVdb using BLAST software, and RNAhybrid software is used to predict the binding specificity of the probe to the target RNA; At the in vitro experimental level, RT-PCR combined with nucleic acid hybridization technology is used to incubate and bind the probe with HBV RNA samples of different genotypes, and the binding effect is verified by electrochemical signal detection. Finally, it is confirmed that the probe can specifically bind to more than 99% of the RNA of HBV genotypes and subtypes, with no obvious cross-reactivity, which can effectively avoid missed detection.
[0056] II. Specificity Validation of the Whole Genotype HBV RNA Capture Probe
[0057] HCV, HDV, HAV RNA samples and normal human hepatocyte RNA samples were selected and subjected to the hybridization conditions described above. The cross-reactivity of the probes was then detected. The results showed that the probes did not bind significantly to any of the non-HBV RNA samples, achieving 100% specificity, thus demonstrating the excellent specificity of the probes of this invention.
[0058] Example 3: HBV RNA Biosensor
[0059] The invention involves anchoring the whole-genotype HBV RNA capture probe to an electrochemical biosensor and then enhancing detection sensitivity through circuit amplification. The specific steps include:
[0060] 1. Electrochemical Biosensor Pretreatment: A gold electrode (3 mm in diameter) was selected as the working electrode, a saturated calomel electrode as the reference electrode, and a platinum electrode as the counter electrode, forming a three-electrode system. The working electrode was polished to a mirror finish with 0.3 μm and 0.05 μm alumina powders, then rinsed with ultrapure water and dried with nitrogen. Subsequently, the working electrode was placed in a 0.5 mol / L H2SO4 solution and electrochemically polished using cyclic voltammetry. The cyclic voltammetry scanning voltage range was -0.2 to 1.6 V, the scanning speed was 50 mV / s, and 5-10 scans were performed to remove impurities from the electrode surface and activate the electrode surface. Finally, the electrode was rinsed with ultrapure water and dried with nitrogen for later use.
[0061] 2. Anchoring of the capture probe to the electrochemical biosensor: A streptavidin solution (concentration 10-20 μg / mL) was added dropwise to the pretreated working electrode surface and incubated at 37℃ for 1-2 h to firmly immobilize the streptavidin on the electrode surface. After incubation, the electrode surface was rinsed three times with PBS buffer (pH=7.4) to remove unbound streptavidin. Subsequently, a whole-genotype HBV RNA capture probe solution (concentration 5-10 μmol / L) was added dropwise to the electrode surface and incubated at 37℃ for 1-2 h. The capture probe was anchored on the electrode surface through biotin-streptavidin specific binding (binding constant ≥10¹⁵ mol⁻¹). After incubation, the electrode was rinsed three times with PBS buffer to remove unanchored free probes, resulting in an electrochemical biosensor immobilized with the capture probe.
[0062] Example 4: HBV RNA Detection System
[0063] The HBV RNA detection system includes the above-mentioned HBV RNA biosensor, circuit amplification module (amplification factor of 10³-10⁵ times), and detection buffer (PBS buffer containing 5 mmol / L K₃[Fe(CN)₆], 5 mmol / L K₄[Fe(CN)₆], and 0.1 mol / L KCl, pH=7.4), or the HBV RNA detection system includes the above-mentioned HBV RNA capture probe, circuit amplification module (amplification factor of 10³-10⁵ times), and detection buffer (PBS buffer containing 5 mmol / L K₃[Fe(CN)₆], 5 mmol / L K₄[Fe(CN)₆], and 0.1 mol / L KCl, pH=7.4).
[0064] Detection methods of HBV RNA detection system:
[0065] Step 1: HBV RNA capture: Mix the sample to be tested (serum, plasma, or hepatocyte lysate) with RNA denaturation solution (containing 10 mmol / L EDTA, 0.5% SDS, pH=8.0) at a volume ratio of 1:1, and denature at 65℃ for 10 min to break down the HBV RNA in the sample into single strands; then drop the denatured sample onto the surface of the biosensor electrode immobilized with the HBV RNA capture probe, and incubate at 37℃ for 30-60 min to allow the HBV RNA in the sample to specifically bind to the capture probe through complementary base pairing, thereby capturing HBV RNA; after incubation, rinse the electrode three times with washing buffer (PBS buffer containing 0.1% Tween-20) to remove unbound impurities and free RNA.
[0066] Step 2, HBV RNA Detection: The HBV RNA biosensor containing HBV RNA from Step 1 was placed in a detection buffer (PBS buffer containing 5 mmol / L K3[Fe(CN)6], 5 mmol / L K4[Fe(CN)6], and 0.1 mol / L KCl, pH=7.4). Electrochemical signal detection was performed using differential pulse voltammetry (DPV). The scan voltage range was 0.2–0.6 V, the scan rate was 50 mV / s, the pulse width was 50 ms, and the pulse period was 200 ms. The detected electrochemical signal was amplified by a circuit amplification module (using a multi-stage transistor amplifier circuit) at a magnification of 10³–10⁵ times, converting the weak binding signal into a precisely detectable electrical signal. The concentration of HBV RNA in the sample was determined by comparing the peak intensity of the electrical signal with a standard curve.
[0067] Example 5: Performance Validation of HBV RNA Detection System
[0068] Standard curve plotting: Prepare a series of HBV RNA standards with gradient concentrations (10 copies / mL, 102 copies / mL, 103 copies / mL, 104 copies / mL, 105 copies / mL, 106 copies / mL), with 3 replicates for each concentration. The standard was mixed with RNA denaturing solution (containing 10 mmol / L EDTA, 0.5% SDS, pH=8.0) at a 1:1 volume ratio and denatured at 65°C for 10 min. The mixture was then added dropwise to the surface of the biosensor electrode containing the HBV RNA capture probe and incubated at 37°C for 45 min. The electrode was washed three times with washing buffer. The biosensor containing the HBV RNA capture probe was placed in detection buffer (PBS buffer containing 5 mmol / L K3[Fe(CN)6], 5 mmol / L K4[Fe(CN)6], and 0.1 mol / L KCl, pH=7.4). Differential pulse voltammetry was used for detection. The scan voltage range was 0.2–0.6 V, the scan rate was 50 mV / s, the pulse width was 50 ms, and the pulse period was 200 ms. The circuit amplification was set to 104 times, and the peak intensity of the electrical signal corresponding to each concentration was recorded. A standard curve was plotted with the logarithm of HBV RNA standard concentration on the x-axis and the peak intensity of the electrical signal on the y-axis. The regression equation was y = 0.32x + 0.15, R² = 0.998, indicating that HBV RNA concentration and peak intensity of electrical signal showed a good linear relationship in the range of 10 to 106 copies / mL.
[0069] Sensitivity validation: HBV RNA standards were diluted to 10 copies / mL and 5 copies / mL, and detection was performed according to the steps in the standard curve plotting section above, with 5 replicates for each concentration. Results showed that the positive rate was 100% in the 10 copies / mL concentration group and 60% in the 5 copies / mL concentration group, indicating that the detection limit of this system is 10 copies / mL, which is 50 times more sensitive than the traditional RNA capture probe method (detection limit of 500 copies / mL).
[0070] Repeatability verification: HBV RNA standard at 103 copies / mL was selected, and five replicate tests were performed following the steps in the standard curve plotting section above. The coefficient of variation (CV) was calculated. The results showed that the average peak intensity of the electrical signal in the five tests was 1.28, and the CV was 3.2%, indicating that the system of this invention has good repeatability.
[0071] Clinical sample validation: Serum samples from 50 clinical HBV-infected patients (10 with genotype A, 12 with genotype B, 10 with genotype C, 8 with genotype D, and 2 each with genotype EH) and 20 healthy individuals were selected. The system of this invention and the traditional RNA capture probe method were compared for detection. Results showed that the positive rate of the system of this invention was 98% (49 / 50), while the positive rate of the traditional method was 82% (41 / 50). All 20 healthy samples tested negative, and the specificity of both methods was 100%. This demonstrates that the system of this invention has a higher positive detection rate in clinical sample detection and can effectively avoid missed detections.
[0072] Example 6: Parameter Optimization Experiment
[0073] The study found that parameters such as the concentration of the capture probe, incubation temperature and time, and circuit amplification factor have a significant impact on the detection effect. The optimal parameters were determined through optimization as follows:
[0074] 1. Probe Concentration Optimization: Probe concentrations of 5 μmol / L, 6 μmol / L, 7 μmol / L, 8 μmol / L, 9 μmol / L, and 10 μmol / L were set, using 10³ copies / mL of HBV RNA standard as the detection target. With other conditions unchanged, the peak intensity of the electrical signal and the non-specific signal were measured. The results showed that the peak intensity of the electrical signal was the highest and the non-specific signal was the lowest at a probe concentration of 7-8 μmol / L, thus determining the optimal concentration as 7-8 μmol / L.
[0075] The optimal concentration of the capture probe is 7-8 μmol / L. When the concentration is too low, the number of probes anchored on the electrode surface is insufficient, resulting in low efficiency in capturing HBV RNA and weak signal intensity. When the concentration is too high, the probes are prone to aggregation, leading to increased non-specific binding and interference with the detection results.
[0076] 2. Incubation Time Optimization: Probe anchoring incubation times were set to 0.5h, 1h, 1.2h, 1.5h, and 2h, and HBV RNA capture incubation times were set to 20min, 30min, 45min, 60min, and 90min, respectively, with other conditions remaining constant. The peak intensity of the electrochemical signal was measured. The results showed that the highest binding efficiency and strongest electrochemical signal were achieved when probe anchoring incubation was performed for 1-2h and HBV RNA capture incubation was performed for 45min, which were determined to be the optimal incubation conditions.
[0077] The optimal conditions for probe anchoring incubation are 37℃ for 1-2 hours, and the optimal conditions for HBV RNA capture incubation are 37℃ for 45 minutes. Too low a temperature will slow down the binding rate, insufficient incubation time will lead to incomplete binding, and too high a temperature or too long an incubation time will lead to an increase in nonspecific binding.
[0078] 3. Circuit Amplification Optimization: Amplification factors of 10³, 10⁴, and 10⁵ were set respectively, with other conditions remaining unchanged, to detect HBV RNA standards of 10 copies / mL and 10² copies / mL. The results showed that at an amplification factor of 10⁴, the signal of low-concentration samples could be effectively amplified without significant enhancement of the background signal, and this was determined to be the optimal amplification factor.
[0079] The optimal amplification factor of the circuit is 104 times. If the amplification factor is too low, it will not be able to effectively amplify weak signals and will be difficult to detect low concentrations of HBV RNA. If the amplification factor is too high, the background signal will be amplified, reducing the detection specificity.
[0080] 4. Optimization of Detection Buffer pH: The detection buffer pH was set to 7.0, 7.4, and 7.8 respectively, with other conditions remaining unchanged, and HBV RNA standards of 10 copies / mL and 102 copies / mL were detected. The results showed that the electrochemical signal was most stable at a detection buffer pH of 7.4.
[0081] The optimal pH of the detection buffer is 7.4. A pH that is too high or too low will affect the binding stability of the probe to HBV RNA and also affect the generation and conduction of electrochemical signals.
[0082] To address the shortcomings of existing HBV RNA capture probe methods, such as insufficient coverage and low detection sensitivity, this invention provides a whole-genotype HBV RNA capture probe, biosensor, and detection system. The capture probe is designed targeting the common conserved regions of all known HBV genotypes (AH type) and subtypes. The common conserved regions are selected from the HBV X gene and C gene, with sequence homology ≥85% across all HBV genotypes and subtypes, and were obtained using the MUSCLE algorithm in UGENE software. The probe coverage is ≥99%, the nucleotide sequence length is 30-40 nt, the 5' end is modified with biotin to achieve anchoring and immobilization with the electrochemical biosensor, and the 3' end is modified with an amino group (-NH2) to enhance binding stability. After HPLC purification, the purity is ≥99%, and its specific nucleotide sequence contains 4 specific modified sequences. The HBV RNA detection method based on this capture probe involves anchoring the probe to an electrochemical biosensor. Following electrode pretreatment, probe anchoring, RNA capture, circuit amplification, and signal detection steps, detection is achieved using differential pulse voltammetry. The detection limit is as low as 10 copies / mL, the entire detection process takes less than 2 hours, the sensor can be reused more than 10 times, and it can specifically bind to more than 99% of HBV genotypes and subtypes of RNA with no significant cross-reactivity, effectively avoiding missed detections. It is suitable for rapid and accurate detection of HBV RNA in serum, plasma, and hepatocyte lysates.
[0083] By optimizing probe design and combining it with an electrochemical biosensor, efficient and accurate detection of HBV RNA was achieved. The HBV RNA capture probe can cover all HBV genotypes and subtypes, with high coverage. The HBV RNA capture probe has strong binding specificity to HBV RNA, avoiding cross-reaction. It has an effective signal amplification mechanism to improve detection sensitivity. It is simple and fast to operate, and suitable for batch clinical testing.
[0084] The sequence numbers of the above embodiments of the present invention are for descriptive purposes only and do not represent the superiority or inferiority of the embodiments.
[0085] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.
Claims
1. An HBV RNA detection system, characterized in that, It includes an HBV RNA capture probe or an HBV RNA biosensor. The HBV RNA biosensor includes an HBV RNA capture probe, which is a mixed probe with nucleotide sequences such as SEQ ID NO. 5-8. It also includes a circuit amplification module and a detection buffer.
2. The HBV RNA detection system as described in claim 1, characterized in that: The HBV RNA capture probe is modified with biotin at the 5' end and amino groups at the 3' end.
3. The HBV RNA detection system as described in claim 1, characterized in that: The concentration of the HBV RNA capture probe is 7-8 μmol / L.
4. The HBV RNA detection system as described in claim 1, characterized in that: HBV RNA capture probes were anchored to pretreated electrochemical biosensors after incubation at 37°C for 1–2 h.
5. The HBV RNA detection system as described in claim 1, characterized in that: The detection buffer was a PBS buffer containing 5 mmol / L K3[Fe(CN)6], 5 mmol / L K4[Fe(CN)6], and 0.1 mol / L KCl, with a pH of 7.
4.
6. The HBV RNA detection system as described in claim 1, characterized in that: HBV RNA capture probes or HBV RNA biosensors capture HBV RNA under conditions of incubation at 37°C for 30-60 min.
Citation Information
Patent Citations
HBV magnetic bead as well as preparation method and application thereof
CN121450764A
PCR primer set for detecting hepatitis b virus, method for detecting hepatitis b using the primer set, and hepatitis b virus detection kit including the primer set
CN1626677A